Blockade of Platelet-Derived Growth Factor or Its Receptors Transiently Delays but Does Not Prevent Fibrous Cap Formation in ApoE Null Mice
2002; Elsevier BV; Volume: 161; Issue: 4 Linguagem: Inglês
10.1016/s0002-9440(10)64415-x
ISSN1525-2191
AutoresKoichi Kozaki, Wolfgang E. Kaminski, Jingjing Tang, Stan Hollenbach, Per Lindahl, Carol M. Sullivan, Jin-Chen Yu, Keith Abe, Paul J. Martin, Russell Ross, Christer Betsholtz, Neill A. Giese, Elaine W. Raines,
Tópico(s)Kruppel-like factors research
ResumoPlatelet-derived growth factor (PDGF) is a potent stimulant of smooth muscle cell migration and proliferation in culture. To test the role of PDGF in the accumulation of smooth muscle cells in vivo, we evaluated ApoE −/− mice that develop complex lesions of atherosclerosis. Fetal liver cells from PDGF-B-deficient embryos were used to replace the circulating cells of lethally irradiated ApoE −/− mice. One month after transplant, all monocytes in PDGF-B −/− chimeras are of donor origin (lack PDGF), and no PDGF-BB is detected in circulating platelets, primary sources of PDGF in lesions. Although lesion volumes are comparable in the PDGF-B +/+ and −/− chimeras at 35 weeks, lesions in PDGF-B −/− chimeras contain mostly macrophages, appear less mature, and have a reduced frequency of fibrous cap formation as compared with PDGF-B +/+ chimeras. However, after 45 weeks, smooth muscle cell accumulation in fibrous caps is indistinguishable in the two groups. Comparison of elicited peritoneal macrophages by RNase protection assay shows an altered cytokine and cytokine receptor profile in PDGF-B −/− chimeras. ApoE −/− mice were also treated for up to 50 weeks with a PDGF receptor antagonist that blocks all three PDGF receptor dimers. Blockade of the PDGF receptors similarly delays, but does not prevent, accumulation of smooth muscle and fibrous cap formation. Thus, elimination of PDGF-B from circulating cells or blockade of PDGF receptors does not appear sufficient to prevent smooth muscle accumulation in advanced lesions of atherosclerosis. Platelet-derived growth factor (PDGF) is a potent stimulant of smooth muscle cell migration and proliferation in culture. To test the role of PDGF in the accumulation of smooth muscle cells in vivo, we evaluated ApoE −/− mice that develop complex lesions of atherosclerosis. Fetal liver cells from PDGF-B-deficient embryos were used to replace the circulating cells of lethally irradiated ApoE −/− mice. One month after transplant, all monocytes in PDGF-B −/− chimeras are of donor origin (lack PDGF), and no PDGF-BB is detected in circulating platelets, primary sources of PDGF in lesions. Although lesion volumes are comparable in the PDGF-B +/+ and −/− chimeras at 35 weeks, lesions in PDGF-B −/− chimeras contain mostly macrophages, appear less mature, and have a reduced frequency of fibrous cap formation as compared with PDGF-B +/+ chimeras. However, after 45 weeks, smooth muscle cell accumulation in fibrous caps is indistinguishable in the two groups. Comparison of elicited peritoneal macrophages by RNase protection assay shows an altered cytokine and cytokine receptor profile in PDGF-B −/− chimeras. ApoE −/− mice were also treated for up to 50 weeks with a PDGF receptor antagonist that blocks all three PDGF receptor dimers. Blockade of the PDGF receptors similarly delays, but does not prevent, accumulation of smooth muscle and fibrous cap formation. Thus, elimination of PDGF-B from circulating cells or blockade of PDGF receptors does not appear sufficient to prevent smooth muscle accumulation in advanced lesions of atherosclerosis. Platelet-derived growth factor (PDGF) was first recognized, and later purified, based on its ability to stimulate the proliferation of a number of connective tissue cells, particularly smooth muscle cells (SMC).1Ross R Raines EW Bowen-Pope DF The biology of platelet-derived growth factor.Cell. 1986; 46: 155-169Abstract Full Text PDF PubMed Scopus (1571) Google Scholar, 2Raines EW Ross R Smooth muscle cells and the pathogenesis of the lesions of atherosclerosis.Br Heart J. 1993; 69: S30-S37Crossref PubMed Scopus (304) Google Scholar PDGF is released from activated platelets and also synthesized by a number of other cells after activation or injury. Although it has not been possible to analyze the effect of targeted deletion of PDGF A- or PDGF B-chain or either of its receptors in adult animals because of embryonic lethality,3Leveen P Pekny M Gebre-Medhin S Swolin B Larsson E Betsholtz C Mice deficient for PDGF B show renal, cardiovascular, and hematological abnormalities.Genes Dev. 1994; 8: 1875-1887Crossref PubMed Scopus (852) Google Scholar, 4Soriano P Abnormal kidney development and hematological disorders in PDGF β-receptor mutant mice.Genes Dev. 1994; 8: 1888-1896Crossref PubMed Scopus (784) Google Scholar, 5Bostrom H Willetts K Pekny M Leveen P Lindahl P Hedstrand H Pekna M Hellstrom M Gebre-Medhin S Schalling M Nilsson M Kurland S Tornell J Heath JK Betsholtz C PDGF-A signaling is a critical event in lung alveolar myofibroblast development and alveogenesis.Cell. 1996; 85: 863-873Abstract Full Text Full Text PDF PubMed Scopus (676) Google Scholar, 6Soriano P The PDGF alpha receptor is required for neural crest cell development and for normal patterning of the somites.Development. 1997; 124: 2691-2700Crossref PubMed Google Scholar examination of mice from chimeric blastocysts (composed of a mixture of wild-type cells and cells with targeted inactivation of the PDGF β-receptor) demonstrated a role for the PDGF β-receptor in all muscle lineages.7Crosby JR Seifert RA Soriano P Bowen-Pope DF Chimaeric analysis reveals role of Pdgf receptors in all muscle lineages.Nat Genet. 1998; 18: 385-388Crossref PubMed Scopus (94) Google Scholar Analysis of the genotypes in cells competing for representation in different cell lineages revealed that PDGF β-receptor −/− cells were reduced eight-fold in SMC-rich tissues relative to PDGF β-receptor +/+ cells. PDGF is a family of disulfide-bonded homo- or heterodimers of four possible subunits (PDGF-A, PDGF-B, PDGF-C, and PDGF-D) which act on cells by binding to homo- or heterodimers of the two PDGF receptor proteins, PDGF α-receptor and β-receptor. PDGF-B is able to bind to both the PDGF α- and β-receptors, whereas PDGF-A can bind only to the PDGF α-receptor.8Seifert RA Hart CE Phillips PE Forstrom JW Ross R Murray MJ Bowen-Pope DF Two different subunits associate to create isoform-specific platelet-derived growth factor receptors.J Biol Chem. 1989; 264: 8771-8778Abstract Full Text PDF PubMed Google Scholar PDGF-C and PDGF-D have been identified recently,9Li X Ponten A Aase K Karlsson L Abramsson A Uutela M Backstrom G Hellstrom M Bostrom H Li H Soriano P Betsholtz C Heldin CH Alitalo K Ostman A Eriksson U PDGF-C is a new protease-activated ligand for the PDGF α-receptor.Nat Cell Biol. 2000; 2: 302-309Crossref PubMed Scopus (493) Google Scholar, 10Bergsten E Uutela M Li X Pietras K Ostman A Heldin CH Alitalo K Eriksson U PDGF-D is a specific, protease-activated ligand for the PDGF β-receptor.Nat Cell Biol. 2001; 3: 512-516Crossref PubMed Scopus (456) Google Scholar, 11Uutela M Lauren J Bergsten E Li X Horelli-Kuitunen N Eriksson U Alitalo K Chromosomal location, exon structure, and vascular expression patterns of the human PDGFC and PDGFC genes.Circulation. 2001; 103: 2242-2247Crossref PubMed Scopus (105) Google Scholar, 12LaRochelle WJ Jeffers M McDonald WF Chillakuru RA Giese NA Lokker NA Sullivan C Boldog FL Yang M Vernet C Burgess CE Fernandes E Deegler LL Rittman B Shimkets J Shimkets RA Rothberg JM Lichenstein HS PDGF-D, a new protease-activated growth factor.Nat Cell Biol. 2001; 3: 517-521Crossref PubMed Scopus (309) Google Scholar and much less is known about their roles and cellular sources. PDGF-CC and PDGF-DD form only homodimers, with PDGF-CC binding to PDGF α-receptor homodimers or PDGF α/β-receptor heterodimers13Gilbertson DG Duff ME West JW Kelly JD Sheppard PO Hofstrand PD Gao Z Shoemaker K Bukowski TR Moore M Feldhaus AL Humes JM Palmer TE Hart CE Platelet-derived growth factor C (PDGF-C), a novel growth factor that binds to PDGF α and β receptor.J Biol Chem. 2001; 276: 27406-27414Crossref PubMed Scopus (223) Google Scholar and PDGF-DD binding to PDGF β-receptor homodimers or PDGF α/β-receptor heterodimers.12LaRochelle WJ Jeffers M McDonald WF Chillakuru RA Giese NA Lokker NA Sullivan C Boldog FL Yang M Vernet C Burgess CE Fernandes E Deegler LL Rittman B Shimkets J Shimkets RA Rothberg JM Lichenstein HS PDGF-D, a new protease-activated growth factor.Nat Cell Biol. 2001; 3: 517-521Crossref PubMed Scopus (309) Google Scholar After vascular injury of a normal artery, increased levels of PDGF-A and PDGF β-receptor have been detected primarily in SMC neointima.14Majesky MW Reidy MA Bowen-Pope DF Hart CE Wilcox JN Schwartz SM PDGF ligand and receptor gene expression during repair of arterial injury.J Cell Biol. 1990; 111: 2149-2158Crossref PubMed Scopus (361) Google Scholar In vascular grafts15Kraiss LW Raines EW Wilcox JN Seifert RA Barrett TB Kirkman TR Hart CE Bowen-Pope DF Ross R Clowes AW Regional expression of the platelet-derived growth factor and its receptors in a primate graft model of vessel wall assembly.J Clin Invest. 1993; 92: 338-348Crossref PubMed Scopus (51) Google Scholar and atherosclerosis,16Ross R Masuda J Raines EW Gown AM Katsuda S Sasahara M Malden LT Masuko H Sato H Localization of PDGF-B protein in macrophages in all phases of atherogenesis.Science. 1990; 248: 1009-1012Crossref PubMed Scopus (467) Google Scholar which have a significant inflammatory component, macrophages are a major source of PDGF-A and PDGF-B, whereas SMC in the neointima express both PDGF-A and PDGF-B to a lesser extent. Increased expression of the PDGF β-receptor is also observed. Although weak staining for PDGF-C has been observed in medial SMC of the normal arterial wall11Uutela M Lauren J Bergsten E Li X Horelli-Kuitunen N Eriksson U Alitalo K Chromosomal location, exon structure, and vascular expression patterns of the human PDGFC and PDGFC genes.Circulation. 2001; 103: 2242-2247Crossref PubMed Scopus (105) Google Scholar and PDGF-D mRNA has been detected in circulating leukocytes,10Bergsten E Uutela M Li X Pietras K Ostman A Heldin CH Alitalo K Eriksson U PDGF-D is a specific, protease-activated ligand for the PDGF β-receptor.Nat Cell Biol. 2001; 3: 512-516Crossref PubMed Scopus (456) Google Scholar changes in the expression of PDGF-C and PDGF-D have not been analyzed after injury or in atherosclerosis. A role for PDGF in attracting SMC has been established in models of restenosis and vascular grafts,17Ferns GA Raines EW Sprugel KH Motani AS Reidy MA Ross R Inhibition of neointimal smooth muscle accumulation after angioplasty by an antibody to PDGF.Science. 1991; 253: 1129-1132Crossref PubMed Scopus (939) Google Scholar, 18Jawien A Bowen-Pope DF Lindner V Schwartz SM Clowes AW Platelet-derived growth factor promotes smooth muscle migration and intimal thickening in a rat model of balloon angioplasty.J Clin Invest. 1992; 89: 507-511Crossref PubMed Scopus (582) Google Scholar, 19Jackson CL Raines EW Ross R Reidy MA Role of endogenous platelet-derived growth factor in arterial smooth muscle cell migration after balloon catheter injury.Arterioscler Thromb. 1993; 13: 1218-1226Crossref PubMed Scopus (229) Google Scholar, 20Giese NA Marijianowski MM McCook O Hancock A Ramakrishnan V Fretto LJ Chen C Kelly AB Koziol JA Wilcox JN Hanson SR The role of α and β platelet-derived growth factor receptor in the vascular response to injury in nonhuman primates.Arterioscler Thromb Vasc Biol. 1999; 19: 900-909Crossref PubMed Scopus (67) Google Scholar, 21Hart CE Kraiss LW Vergel S Gilbertson D Kenagy R Kirkman T Crandall DL Tickle S Finney H Yarranton G Clowes AW PDGFβ receptor blockade inhibits intimal hyperplasia in the baboon.Circulation. 1999; 99: 564-569Crossref PubMed Scopus (98) Google Scholar, 22Davies MG Owens EL Mason DP Lea H Tran PK Vergel S Hawkins SA Hart CE Clowes AW Effect of platelet-derived growth factor receptor-α and -β blockade on flow-induced neointimal formation in endothelialized baboon vascular grafts.Circ Res. 2000; 86: 779-786Crossref PubMed Scopus (37) Google Scholar in which the increase in SMC occurs within the first 2 to 4 weeks after injury or implant. However, SMC accumulation in atherosclerosis occurs over decades in humans and many months in animals placed on high cholesterol diets that accelerate lesion formation.23Faggiotto A Ross R Studies of hypercholesterolemia in the nonhuman primate: II. fatty streak conversion to fibrous plaque.Arteriosclerosis. 1984; 4: 341-356Crossref PubMed Google Scholar Protracted lesion formation requires a prolonged period of treatment and poses problems for experimental investigation, particularly with the administration of blocking antibodies. Studies in which endogenous neutralizing antibodies were induced in rabbits before initiation of the atherosclerotic diet24Rutherford C Martin W Carrier M Anggard EE Ferns GA Endogenously elicited antibodies to platelet derived growth factor-BB and platelet cytosolic protein inhibit aortic lesion development in the cholesterol-fed rabbit.Int J Exp Pathol. 1997; 78: 21-32Crossref PubMed Scopus (37) Google Scholar, 25Lamb DJ Avades TY Ferns GA Endogenous neutralizing antibodies against platelet-derived growth factor-aa inhibit atherogenesis in the cholesterol-fed rabbit.Arterioscler Thromb Vasc Biol. 2001; 21: 997-1003Crossref PubMed Scopus (17) Google Scholar and PDGF receptor antibodies were administered long term in the ApoE null mouse model of atherosclerosis26Sano H Sudo T Yokode M Murayama T Kataoka H Takakura N Nishikawa S Nishikawa SI Kita T Functional blockade of platelet-derived growth factor receptor-β but not of receptor-α prevents vascular smooth muscle cell accumulation in fibrous cap lesions in apolipoprotein E-deficient mice.Circulation. 2001; 103: 2955-2960Crossref PubMed Scopus (142) Google Scholar have suggested the possibility that blockade of PDGF or the PDGF β-receptor can reduce lesion size. In this study, we have examined lesions in detail in ApoE −/− mice at extended time points and used two different approaches to test the role of PDGF in SMC accumulation in advanced lesions of atherosclerosis: hematopoietic chimeras lacking PDGF-B in their circulating cells and mice treated daily with a PDGF receptor antagonist. Although we demonstrate evidence that PDGF can transiently delay SMC accumulation in ApoE −/− mice at 35 weeks, neither method of blockade is able to prevent formation of advanced fibrous caps analyzed at 45 and 50 weeks. Antibodies used for immunostaining include: Mac-2 antibody for macrophages,27Ho MK Springer TA Mac-2, a novel 32, 000 Mr mouse macrophage subpopulation-specific antigen defined by monoclonal antibodies.J Immunol. 1982; 128: 1221-1228PubMed Google Scholar a rat anti-mouse monoclonal antibody (ATCC, Manassas, VA, monoclonal supernatant diluted 1:4), PGF-007, a mouse monoclonal antibody to PDGF-B16, and anti-α-actin (DAKO, Carpinteria, CA) for SMC. Male ApoE −/− mice were purchased from the Jackson Laboratory (Bar Harbor, ME) at the age of 5 weeks. This strain was produced by backcrossing the ApoEtmlUnc-null strain 10 times to C57BL/6J (G10). PDGF-B +/− mice that are 129 Ola/C57BL/6J3Leveen P Pekny M Gebre-Medhin S Swolin B Larsson E Betsholtz C Mice deficient for PDGF B show renal, cardiovascular, and hematological abnormalities.Genes Dev. 1994; 8: 1875-1887Crossref PubMed Scopus (852) Google Scholar were backcrossed 6 times with ApoE −/− (G6) mice in the Department of Medical Biochemistry, University of Göteborg (Göteborg, Sweden). All experimental protocols were approved by the Animal Care Institutional Review Board (University of Washington) or the IACUC Review committee (COR Therapeutics, Inc., South San Francisco, CA). Details describing first generation PDGF-B null hematopoietic chimeras have been published.28Kaminski WE Lindahl P Lin NL Broudy VC Crosby JR Hellstrom M Swolin B Bowen-Pope DF Martin PJ Ross R Betsholtz C Raines EW Basis of hematopoietic defects in platelet-derived growth factor (PDGF)-B and PDGF β-receptor null mice.Blood. 2001; 97: 1990-1998Crossref PubMed Scopus (58) Google Scholar In this study, male ApoE −/− recipients of 7 to 8 weeks were prepared by total body irradiation in a single 14-Gy fraction from dual-opposed Co-60 sources at an exposure rate of 20 cGy/min on the day before transplant. The next day, 5 × 106 to 10 × 106 viable marrow cells from a pool of first generation chimeras (repopulated with fetal liver cells from ApoE null/PDGF-B +/+ or −/− E16.5 fetal livers from littermate embryos) were injected into each recipient through the lateral tail vein. The PDGF receptor antagonist CT5292329Yu JC Lokker NA Hollenbach S Apatira M Li J Betz A Sedlock D Oda S Nomoto Y Matsuno K Ide S Tsukuda E Giese NA Efficacy of the novel selective platelet-derived growth factor receptor antagonist ct52923 on cellular proliferation, migration, and suppression of neointima following vascular injury.J Pharmacol Exp Ther. 2001; 298: 1172-1178PubMed Google Scholar was pulverized using a mortar and pestle and suspended in 0.5% methyl cellulose. The suspension of CT52923 or 0.5% methyl cellulose (vehicle) was orally administered to ApoE null mice at a dose of 60 mg/kg once daily from 8 weeks of age to the time of sacrifice. Plasma samples were obtained at various time points to measure cholesterol levels, drug concentration, and ability to inhibit ex vivo PDGF receptor tyrosine kinase phosphorylation. Venous blood (100–200 μl) from chimeras was obtained from the orbital venous plexus without killing the mice or from the heart at the time of sacrifice. Peripheral blood cell counts were measured at the Phoenix Central Laboratory (Everett, WA). Plasma cholesterol levels were measured at the Northwest Lipid Research Laboratories (Seattle, WA). Plasma concentrations of the PDGF receptor antagonist CT52923 were determined by high pressure liquid chromatography (HPLC, detection limit 0.5 μg/ml), and the ability of the plasma to inhibit PDGF receptor phosphorylation was determined in an ex vivo receptor autophosphorylation assay.29Yu JC Lokker NA Hollenbach S Apatira M Li J Betz A Sedlock D Oda S Nomoto Y Matsuno K Ide S Tsukuda E Giese NA Efficacy of the novel selective platelet-derived growth factor receptor antagonist ct52923 on cellular proliferation, migration, and suppression of neointima following vascular injury.J Pharmacol Exp Ther. 2001; 298: 1172-1178PubMed Google Scholar For analysis of mouse platelets with a chain-specific PDGF ELISA,30Raines EW Ross R Compartmentalization of PDGF on extracellular binding sites dependent on exon-6-encoded sequences.J Cell Biol. 1992; 116: 533-543Crossref PubMed Scopus (144) Google Scholar blood was collected in sodium citrate (final concentration 0.37%), and the platelet-rich plasma was collected after centrifugation at 4°C for 15 minutes at 200 × g. Platelets were pelleted by centrifugation at 4°C for 15 minutes at 800 × g and then lysed for ELISA analysis. After mice were killed, they were perfusion-fixed with methyl Carnoy's fixative. The aorta was dissected and fixed in methyl Carnoy's for 48 hours. The brachiocephalic trunk (innominate artery), from the bifurcation off the aortic arch to the branching point to the right subclavian artery and common carotid artery, was dissected and embedded in a sandwich cassette. Using a random start site from a random number table and within the first 75 μm, we serially sectioned the entire brachiocephalic trunk (5-μm sections), and every 75 μm a section was stained with hematoxylin and eosin (H & E). All of the H & E-stained images were captured with a microscope equipped with a Hamamatsu CCD camera (Bridgewater, NJ). Lesion area was quantitated with NIH Image 1.59 software. The volume of the brachiocephalic trunk lesion was calculated by the Cavalieri stereologic method [∑ (lesion area) × (distance; 75 μm)]. All analyses were done without knowledge of the tissue source. Sirius red was used to stain collagen fibrils31Junqueira LC Cossermelli W Brentani R Differential staining of collagens type I, II, and III by Sirius Red and polarization microscopy.Arch Histol Jpn. 1978; 41: 267-274Crossref PubMed Scopus (438) Google Scholar and quantitated using polarization microscopy. Images were captured with a Spot Insight digital camera (Diagnostic Instruments, Sterling Heights, MI), and collagen area was quantitated using a color threshold and Image-Pro Plus 4.5 Software (Media Cybernetics, Silver Spring, MD). Fibrous cap formation was evaluated in H & E-stained slides. All of the H & E-stained sections in the brachiocephalic trunk were examined randomly by a single observer without knowledge of the tissue source. The extent of fibrous cap formation was scored as four different levels: thick (greater than 4 elastic layers), intermediate (two to four elastic layers), thin (a single elastic layer), and no fibrous cap (foam cell lesion only with no fibrous cap). Elastic fibers in the fibrous cap identified in H & E-stained sections were verified by staining serial sections with Verhoeff-Van Gieson (VVG) and Gomori's aldehyde fuchsin (GAF) elastin-specific stains.32Learn DB Moloney SJ Giddens LD Quantitative determination of murine dermal elastic fibers by color image analysis: comparison of three staining methods.Biotech Histochem. 1992; 67: 125-130Crossref PubMed Scopus (5) Google Scholar Fibrous cap lesion area was also evaluated for the most advanced lesion in each mouse by using the VVG-stained slides. Only the elastin-stained area was selected using Photoshop (Adobe Systems Inc., San Jose, CA) and quantitated with NIH Image 1.59. The VVG-stained area was expressed as a percentage of total lesion area. All immunohistochemical procedures were performed as previously described.33Nakashima Y Plump AS Raines EW Breslow JL Ross R ApoE-deficient mice develop lesions of all phases of atherosclerosis throughout the arterial tree.Arterioscler Thromb. 1994; 14: 133-140Crossref PubMed Google Scholar Endogenous peroxidase activity was blocked by incubating the tissue sections in 0.3% H2O2 with 1% sodium azide. Primary antibodies were incubated overnight at 4°C with the sections in 3% serum matched to the species of the secondary antibody. Biotinylated second antibodies were incubated for 30 minutes at room temp followed by 30 minutes with horseradish peroxidase-conjugated streptavidin (1/5000; ImmunoResearch Laboratories, Inc., West Grove, PA), and the antibody binding was visualized with diaminobenzidine (Sigma, St. Louis, MO). The percentage of lesion area occupied by staining for macrophages was quantitated as described for fibrous cap area analysis. Peritoneal macrophages from PDGF-B chimeric ApoE −/− mice were collected four days after injection of 3% thioglycolate (BD Biosciences, San Diego, CA) into the peritoneal cavity. RNA was isolated with Trizol, followed by LiCl precipitation and RNeasy column (Qiagen, Inc., Valencia, CA) after removal of lymphocytes from the purified peritoneal macrophages with anti-CD2 selection. cDNA was primed by random hexamers and made from the extracted RNA by the use of the Superscript Preamplification System (Gibco/BRL, Rockville, MD). Transcript levels were quantitated by real-time PCR as previously described.34Buetow BS Crosby JR Kaminski WE Ramachandran RK Lindahl P Martin P Betsholtz C Seifert RA Raines EW Bowen-Pope DF Platelet-derived growth factor B-chain of hematopoietic origin is not necessary for granulation tissue formation and its absence enhances vascularization.Am J Pathol. 2001; 159: 1869-1876Abstract Full Text Full Text PDF PubMed Scopus (19) Google Scholar Standard 18 seconds primers and TaqMan probe and custom-made PDGF B-chain primers and TaqMan probe were obtained from Perkin Elmer Biosystems (Foster City, CA): PDGF B-chain forward primer, tccggagtcgagttggaaag; reverse primer, ggcgattacagcaggctctg; probe, FAM-tcgagggaggaggagccta. Thermocycling was performed on the GeneAmp 5700 Sequence Detection System (Perkin Elmer) using the following parameters: 50°C for 2 minutes, 95°C for 10 minutes, then alternating 40 times between 95°C for 20 seconds and 50°C for 60 seconds. Threshold (CT) values were calculated by the GeneAmp 5700 SDS Detector software. Each sample was analyzed in triplicate PCR reactions accompanied by a standard curve and two no-template control reactions. Total RNA was isolated from peritoneal macrophages using Trizol reagent (Gibco/BRL). Peritoneal macrophages were collected from PDGF-B +/+ and −/− chimeras at 24 weeks (n = 1), 30 weeks (n = 3), 35 weeks (n = 2), and 45 weeks (n = 2) on day 4 after intraperitoneal injection of aged, sterile 3% thioglycolate (Difco Laboratories, Becton Dickinson Microbiology, Sparks, MD). Multiprobe template sets for mouse chemokines, cytokines, and their receptors (mCK-1, mCK-2b, mDK-4, mCK-5, mCR-1, mCR-3, and mCR-5) were purchased from PharMingen International (San Diego, CA). RNA probes were synthesized with α-[32P]UTP (Amersham Pharmacia Biotech, Piscataway, NJ) and used within 2 days. RNase protection assays were performed according to the manufacturer's instructions. Ten to 20 μg of total RNA was used in each hybridization reaction, and RNase-protected probe fragments were resolved on 0.4 mm 5% polyacrylamide gels containing 8 mol/L urea. After they were dried, the gels were quantitated by PhosphorImage analysis. L32 and GAPDH were used for normalization. Data are presented as means ± SEM. Statistical analyses used Wilcoxon rank sum (Mann-Whitney) test statistic with Instat 2.01 (Graphpad Software, San Diego, CA). A value of P < 0.05 indicates statistical significance. Lesions of atherosclerosis result from focal accumulation within the arterial intima of mononuclear inflammatory cells from the circulation and SMC from the underlying media. PDGF is a potent stimulant of SMC migration and proliferation in culture, suggesting that PDGF may play a role in the accumulation of SMC in atherogenesis. We have directly tested the role of PDGF in the accumulation of SMC in vivo using ApoE −/− mice that develop complex lesions of atherosclerosis. Although targeted deletion of the PDGF A- or B-chain3Leveen P Pekny M Gebre-Medhin S Swolin B Larsson E Betsholtz C Mice deficient for PDGF B show renal, cardiovascular, and hematological abnormalities.Genes Dev. 1994; 8: 1875-1887Crossref PubMed Scopus (852) Google Scholar, 5Bostrom H Willetts K Pekny M Leveen P Lindahl P Hedstrand H Pekna M Hellstrom M Gebre-Medhin S Schalling M Nilsson M Kurland S Tornell J Heath JK Betsholtz C PDGF-A signaling is a critical event in lung alveolar myofibroblast development and alveogenesis.Cell. 1996; 85: 863-873Abstract Full Text Full Text PDF PubMed Scopus (676) Google Scholar or PDGF receptor genes4Soriano P Abnormal kidney development and hematological disorders in PDGF β-receptor mutant mice.Genes Dev. 1994; 8: 1888-1896Crossref PubMed Scopus (784) Google Scholar, 6Soriano P The PDGF alpha receptor is required for neural crest cell development and for normal patterning of the somites.Development. 1997; 124: 2691-2700Crossref PubMed Google Scholar is embryonic lethal, we have developed chimeric mice in which fetal liver cells from PDGF-B-deficient embryos are used to replace the circulating cells of lethally irradiated ApoE −/− mice, and marrow from these chimeras were used to repopulate the marrow of lethally irradiated study mice (Figure 1). The ApoE −/− recipients were transplanted at 7 to 8 weeks before monocyte adhesion and early lesion formation.33Nakashima Y Plump AS Raines EW Breslow JL Ross R ApoE-deficient mice develop lesions of all phases of atherosclerosis throughout the arterial tree.Arterioscler Thromb. 1994; 14: 133-140Crossref PubMed Google Scholar Complete repopulation by donor monocytes, granulocytes, and B cells was achieved within 30 days after transplant, while T-cell reconstitution required more than 100 days for both PDGF-B +/+ and −/− chimeras.28Kaminski WE Lindahl P Lin NL Broudy VC Crosby JR Hellstrom M Swolin B Bowen-Pope DF Martin PJ Ross R Betsholtz C Raines EW Basis of hematopoietic defects in platelet-derived growth factor (PDGF)-B and PDGF β-receptor null mice.Blood. 2001; 97: 1990-1998Crossref PubMed Scopus (58) Google Scholar Peritoneal macrophages from PDGF-B −/− chimeric mice harvested at 24, 27, and 31 weeks do not express the PDGF-B gene as detected by real time PCR, whereas PDGF B-chain mRNA copy number of 90 per 106 18S copies is detected in peritoneal macrophages from PDGF-B +/+ chimeras (data not shown). Also PDGF-B was not detected in platelet extracts from PDGF-B −/− chimeras by PDGF-B-specific ELISA (data not shown). No significant differences in body weights, plasma cholesterol levels, lipoprotein profiles, red cell counts, platelet counts, or differential counts of granulocytes, lymphocytes, or monocytes are found between PDGF-B −/− and PDGF-B +/+ ApoE −/− chimeras (Table 1 and data not shown).Table 1Body Weights and Blood Parameters of PDGF-B Chimeric ApoE−/− Mice35 weeks45 weeksParameterPDGF-B +/+ (n = 9)PDGF-B −/− (n = 8)PDGF-B +/+ (n = 12)PDGF-B −/− (n = 13)Body weight (g)25.3 ± 1.526.0 ± 2.824.0 ± 1.722.9 ± 1.9RBC (×106/μl)8.0 ± 0.77.5 ± 9.07.6 ± 0.57.1 ± 0.2Hematocrit (%)37.4 ± 2.835.0 ± 3.527.8 ± 3.728.5 ± 2.2WBC (×103/μl)8.6 ± 2.810.5 ± 3.0NDNDPMN (×103/μl)2.1 ± 2.52.3 ± 2.0NDNDLymphocyte (×103/μl)5.5 ± 2.27.0 ± 2.2NDNDMonocyte (×103/μl)0.6 ± 0.40.9 ± 0.5NDNDPlatelet (×103/μl)490 ± 150670 ± 280772 ± 149851 ± 111Plasma cholesterol (mg/dl)393 ± 67417 ± 29463 ± 71489 ± 104ND, not determined. Open table in a new tab ND, not determined. Blockade of PDGF ligands or infusion of PDGF in vivo in acute balloon injury models of the normal carotid artery has demonstrated a role for PDGF in the stimulation of SMC migration and proliferation responsible for SMC-rich neointimal formation.17Ferns GA Raines EW Sprugel KH Motani AS Reidy MA Ross R Inhibition of neointimal smooth muscle accumulation after angioplasty by an antibody to PDGF.Science. 1991; 253: 1129-1132Crossref PubMed Scopus (939) Google Scholar, 18Jawien A Bowen-Pope DF Lindner V Schwartz SM Clowes AW Platelet-derived growth factor promotes smooth muscle migrati
Referência(s)