Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

The Neuronal Ca2+ Sensor Protein Visinin-like Protein-1 Is Expressed in Pancreatic Islets and Regulates Insulin Secretion

2006; Elsevier BV; Volume: 281; Issue: 31 Linguagem: Inglês

10.1074/jbc.m512924200

ISSN

1083-351X

Autores

Feihan F. Dai, Yi Zhang, Youhou Kang, Qinghua Wang, Herbert Y. Gaisano, Karl‐Heinz Braunewell, Catherine B. Chan, Michael B. Wheeler,

Tópico(s)

Calcium signaling and nucleotide metabolism

Resumo

Visinin-like protein-1 (VILIP-1) is a member of the neuronal Ca2+ sensor protein family that modulates Ca2+-dependent cell signaling events. VILIP-1, which is expressed primarily in the brain, increases cAMP formation in neural cells by modulating adenylyl cyclase, but its functional role in other tissues remains largely unknown. In this study, we demonstrate that VILIP-1 is expressed in murine pancreatic islets and β-cells. To gain insight into the functions of VILIP-1 in β-cells, we used both overexpression and small interfering RNA knockdown strategies. Overexpression of VILIP-1 in the MIN6β-cell line or isolated mouse islets had no effect on basal insulin secretion but significantly increased glucose-stimulated insulin secretion. cAMP accumulation was elevated in VILIP-1-overexpressing cells, and the protein kinase A inhibitor H-89 attenuated increased glucose-stimulated insulin secretion. Overexpression of VILIP-1 in isolated mouse β-cells increased cAMP content accompanied by increased cAMP-responsive element-binding protein gene expression and enhanced exocytosis as detected by cell capacitance measurements. Conversely, VILIP-1 knockdown by small interfering RNA caused a reduction in cAMP accumulation and produced a dramatic increase in preproinsulin mRNA, basal insulin secretion, and total cellular insulin content. The increase in preproinsulin mRNA in these cells was attributed to enhanced insulin gene transcription. Taken together, we have shown that VILIP-1 is expressed in pancreatic β-cells and modulates insulin secretion. Increased VILIP-1 enhanced insulin secretion in a cAMP-associated manner. Down-regulation of VILIP-1 was accompanied by decreased cAMP accumulation but increased insulin gene transcription. Visinin-like protein-1 (VILIP-1) is a member of the neuronal Ca2+ sensor protein family that modulates Ca2+-dependent cell signaling events. VILIP-1, which is expressed primarily in the brain, increases cAMP formation in neural cells by modulating adenylyl cyclase, but its functional role in other tissues remains largely unknown. In this study, we demonstrate that VILIP-1 is expressed in murine pancreatic islets and β-cells. To gain insight into the functions of VILIP-1 in β-cells, we used both overexpression and small interfering RNA knockdown strategies. Overexpression of VILIP-1 in the MIN6β-cell line or isolated mouse islets had no effect on basal insulin secretion but significantly increased glucose-stimulated insulin secretion. cAMP accumulation was elevated in VILIP-1-overexpressing cells, and the protein kinase A inhibitor H-89 attenuated increased glucose-stimulated insulin secretion. Overexpression of VILIP-1 in isolated mouse β-cells increased cAMP content accompanied by increased cAMP-responsive element-binding protein gene expression and enhanced exocytosis as detected by cell capacitance measurements. Conversely, VILIP-1 knockdown by small interfering RNA caused a reduction in cAMP accumulation and produced a dramatic increase in preproinsulin mRNA, basal insulin secretion, and total cellular insulin content. The increase in preproinsulin mRNA in these cells was attributed to enhanced insulin gene transcription. Taken together, we have shown that VILIP-1 is expressed in pancreatic β-cells and modulates insulin secretion. Increased VILIP-1 enhanced insulin secretion in a cAMP-associated manner. Down-regulation of VILIP-1 was accompanied by decreased cAMP accumulation but increased insulin gene transcription. Visinin-like protein-1 (VILIP-1) 3The abbreviations used are: VILIP-1, visinin-like protein-1; NCS, neuronal Ca2+ sensor; siRNA, small interfering RNA; EGFP, enhanced green fluorescent protein; Ad, adenovirus; GSIS, glucose-stimulated insulin secretion; GST, glutathione S-transferase; PKA, protein kinase A; RRP, readily releasable pool; RP, reserve pool; fF, femtofarads; CREB, cAMP-responsive element-binding protein.3The abbreviations used are: VILIP-1, visinin-like protein-1; NCS, neuronal Ca2+ sensor; siRNA, small interfering RNA; EGFP, enhanced green fluorescent protein; Ad, adenovirus; GSIS, glucose-stimulated insulin secretion; GST, glutathione S-transferase; PKA, protein kinase A; RRP, readily releasable pool; RP, reserve pool; fF, femtofarads; CREB, cAMP-responsive element-binding protein. belongs to a family of neuronal Ca2+ sensor (NCS) proteins, which are conserved from yeast to human (1Braunewell K.-H. Gundelfinger E.D. Cell Tissue Res. 1999; 295: 1-12Crossref PubMed Scopus (235) Google Scholar). The NCS family consists of ∼40 members in different species divided into five subfamilies (1Braunewell K.-H. Gundelfinger E.D. Cell Tissue Res. 1999; 295: 1-12Crossref PubMed Scopus (235) Google Scholar). Group III, the VILIP family, includes VILIP-1, VILIP-2, VILIP-3, hippocalcin, and neurocalcin-δ (1Braunewell K.-H. Gundelfinger E.D. Cell Tissue Res. 1999; 295: 1-12Crossref PubMed Scopus (235) Google Scholar). NCS family members possess four EF-hand Ca2+-binding motifs. Calcium binding leads to a conformational change in the proteins, a mechanism termed the Ca2+-myristoyl switch, which facilitates their association with lipid bilayers (2Ames J.B. Ishima R. Tanaka T. Gordon J.I. Stryer L. Ikura M. Nature. 1997; 389: 198-202Crossref PubMed Scopus (428) Google Scholar). The NCS proteins are reported to have a variety of biological functions. These include involvement in the modulation of voltage-gated Ca2+ and A-type K+ channels (3An W.F. Bowlby M.R. Betty M. Cao J. Ling H.P. Mendoza G. Hinson J.W. Mattsson K.I. Strassle B.W. Trimmer J.S. Rhodes K.J. Nature. 2000; 403: 553-556Crossref PubMed Scopus (835) Google Scholar, 4Weiss J.L. Archer D.A. Burgoyne R.D. J. Biol. Chem. 2000; 275: 40082-40087Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar), transcriptional repression (5Carrion A.M. Link W.A. Ledo F. Mellstrom B. Naranjo J.R. Nature. 1999; 398: 80-84Crossref PubMed Scopus (488) Google Scholar), kinase modulation (6Hendricks K.B. Wang B.Q. Schnieders E.A. Thorner J. Nat. Cell Biol. 1999; 1: 234-241Crossref PubMed Scopus (217) Google Scholar), and neurotransmitter release (7Rajebhosale M. Greenwood S. Vidugiriene J. Jeromin A. Hilfiker S. J. Biol. Chem. 2003; 278: 6075-6084Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar, 8Zheng Q. Bobich J.A. Vidugiriene J. McFadden S.C. Thomas F. Roder J. Jeromin A. J. Neurochem. 2005; 92: 442-451Crossref PubMed Scopus (39) Google Scholar). VILIP-1 was first cloned from a rat brain cDNA library (9Kuno T. Kajimoto Y. Hashimoto T. Mukai H. Shirai Y. Saheki S. Tanaka C. Biochem. Biophys. Res. Commun. 1992; 184: 1219-1225Crossref PubMed Scopus (64) Google Scholar), and at the protein level, it was shown to have 100% homology to human visinin-like peptide-1 (10Polymeropoulos M.H. Ide S. Soares M.B. Lennon G.G. Genomics. 1995; 29: 273-275Crossref PubMed Scopus (22) Google Scholar). To date, studies on VILIP-1 have focused primarily on its role in neurons. Some of these studies have demonstrated Ca2+-dependent association with plasma membranes (11Lin L. Braunewell K.-H. Gundelfinger E.D. Anand R. Biochem. Biophys. Res. Commun. 2002; 296: 827-832Crossref PubMed Scopus (18) Google Scholar, 12Spilker C. Dresbach T. Braunewell K.-H. J. Neurosci. 2002; 22: 7331-7339Crossref PubMed Google Scholar) and Golgi membranes (12Spilker C. Dresbach T. Braunewell K.-H. J. Neurosci. 2002; 22: 7331-7339Crossref PubMed Google Scholar), which might be a mechanism for the coordinated regulation of signaling cascades. Furthermore, in a human embryonic kidney cell line (tsA201), VILIP-1 has been shown to increase cell-surface expression of α4- and β2-subunits of the neuronal nicotinic acetylcholine receptor, which belongs to a superfamily of ligand-gated ion channels (13Lin L. Jeanclos E.M. Treuil M. Braunewell K.-H. Gundelfinger E.D. Anand R. J. Biol. Chem. 2002; 277: 41872-41878Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar). In addition, VILIP-1 has modulatory effects on signaling of cAMP and cGMP in neuronal and peripheral cells (11Lin L. Braunewell K.-H. Gundelfinger E.D. Anand R. Biochem. Biophys. Res. Commun. 2002; 296: 827-832Crossref PubMed Scopus (18) Google Scholar, 14Brackmann M. Schuchmann S. Anand R. Braunewell K.-H. J. Cell Sci. 2005; 118: 2495-2505Crossref PubMed Scopus (58) Google Scholar, 15Braunewell K.-H. Spilker C. Behnisch T. Gundelfinger E.D. J. Neurochem. 1997; 68: 2129-2139Crossref PubMed Scopus (56) Google Scholar, 16Mahloogi H. Gonzalez-Guerrico A.M. Lopez D.C. Bassi D.E. Goodrow T. Braunewell K.-H. Klein-Szanto A.J. Cancer Res. 2003; 63: 4997-5004PubMed Google Scholar, 17Braunewell K.-H. Brackmann M. Schaupp M. Spilker C. Anand R. Gundelfinger E.D. J. Neurochem. 2001; 78: 1277-1286Crossref PubMed Scopus (56) Google Scholar, 18Boekhoff I. Braunewell K.-H. Andreini I. Breer H. Gundelfinger E. Eur. J. Cell Biol. 1997; 72: 151-158PubMed Google Scholar). VILIP-1 has also been shown to increase cGMP levels in transfected C6 and PC12 cells by directly acting on guanylyl cyclase (17Braunewell K.-H. Brackmann M. Schaupp M. Spilker C. Anand R. Gundelfinger E.D. J. Neurochem. 2001; 78: 1277-1286Crossref PubMed Scopus (56) Google Scholar). Recent studies indicate that VILIP-1 modulates the activity of the receptor, guanylyl cyclase B, through clathrin-dependent receptor cycling, supporting a general physiological role for VILIP-1 in membrane trafficking within the central nervous system (14Brackmann M. Schuchmann S. Anand R. Braunewell K.-H. J. Cell Sci. 2005; 118: 2495-2505Crossref PubMed Scopus (58) Google Scholar). In addition, VILIP-1 has been shown to bind double-stranded RNA as a protein-RNA complex for regulating the stability and localization of specific mRNAs, implicating its role in the regulation of gene expression (19Mathisen P.M. Johnson J.M. Kawczak J.A. Tuohy V.K. J. Biol. Chem. 1999; 274: 31571-31576Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar). VILIP-1 is expressed primarily in the brain, but lower expression has also been found in some peripheral organs, including the heart, testes, ovaries, and colon (20Gierke P. Zhao C. Brackmann M. Linke B. Heinemann U. Braunewell K.-H. Biochem. Biophys. Res. Commun. 2004; 323: 38-43Crossref PubMed Scopus (34) Google Scholar). Although many studies have reported on the biological functions of VILIP-1 in neurons, very little information is available regarding physiological roles in other tissues. In MIN6 cells, however, expression profiling of fatty acid-responsive genes has shown that oleic acid can significantly induce expression of VILIP-1 (21Wang X. Li H. De Leo D. Guo W. Koshkin V. Fantus I.G. Giacca A. Chan C.B. Der S. Wheeler M.B. Diabetes. 2004; 53: 129-140Crossref PubMed Scopus (83) Google Scholar). In this study, we identified VILIP-1 in mouse pancreatic islets, and using overexpression and small interfering RNA (siRNA) knockdown strategies, we determined that VILIP-1 can regulate insulin secretion and insulin gene transcription. This study provides the first evidence that VILIP-1 plays a functional role in pancreatic β-cells. Reagents—The polyclonal antibody to VILIP-1 (rabbit anti-serum) and the vector harboring the full-length cDNA of VILIP-1 or the fusion protein VILIP-1-enhanced green fluorescent protein (EGFP) have been described previously (12Spilker C. Dresbach T. Braunewell K.-H. J. Neurosci. 2002; 22: 7331-7339Crossref PubMed Google Scholar, 15Braunewell K.-H. Spilker C. Behnisch T. Gundelfinger E.D. J. Neurochem. 1997; 68: 2129-2139Crossref PubMed Scopus (56) Google Scholar). Vectors expressing SNAP25 (synaptosome-associated protein of 25 kDa) and syntaxin-1A in mammalian cells were described in previous studies (22Kang Y. Leung Y.M. Manning-Fox J.E. Xia F. Xie H. Sheu L. Tsushima R.G. Light P.E. Gaisano H.Y. J. Biol. Chem. 2004; 279: 47125-47131Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar, 23MacDonald P.E. Wang G. Tsuk S. Dodo C. Kang Y. Tang L. Wheeler M.B. Cattral M.S. Lakey J.R. Salapatek A.M. Lotan I. Gaisano H.Y. Mol. Endocrinol. 2002; 16: 2452-2461Crossref PubMed Scopus (70) Google Scholar). The constructs of firefly luciferase driven by the rat insulin I promoter and Renilla luciferase driven by the cytomegalovirus promoter were gifts from Dr. Donald Fleenor (Duke University). The vector expressing NCS-1 protein was kindly provided by Dr. John Roder (Samuel Lunenfeld Research Institute, Mount Sinai Hospital, Toronto). Bovine serum albumin, oleic acid, H-89, forskolin, ionomycin, collagenase V, dispase II, rabbit polyclonal antibody against β-actin, and mouse monoclonal antibodies against syntaxin-1A and SNAP25 were products of Sigma. Mouse monoclonal antibodies against cellular subfractionation marker proteins annexin II, caveolin-1, and lamin A/C were obtained from Clontech. Guinea pig anti-insulin and mouse anti-glucagon antibodies were from Dako. Fluorescein isothiocyanate- or Cy5-conjugated secondary antibody was from Jackson ImmunoResearch Laboratories, Inc. (West Grove, PA). Lipofectamine 2000, TRIzol, SuperScript II RNase H reverse transcriptase, ROX reference dye, SYBR Green dye, and Platinum Taq were purchased from Invitrogen. The cAMP assay kit was obtained from Biomedical Technologies, Inc. (Stoughton, MA). The Dual-Luciferase reporter assay kit was from Promega Corp. (Madison, WI). The siRNA duplex was designed using the program provided by Integrated DNA Technologies, Inc. (Coralville, IA), and the synthesis and high pressure liquid chromatography purification of the siRNAs were performed by the same company. The fluorescein-conjugated scrambled siRNA was from Dharmacon, Inc. (Lafayette, CO). The Qproteome compartment kit was purchased from Qiagen Inc. Cell Culture—MIN6 cells (a gift from Dr. S. Seino, Chiba University), α-TC6 cells (kindly provided by Dr. Y. Moriyama, Okayama University), and HEK293 cells (purchased from American Type Culture Collection, Manassas, VA) were grown in monolayers in Dulbecco's modified Eagle's medium containing 25 mm glucose supplemented with 10% fetal bovine serum, 100 units/ml penicillin, and 100 μg/ml streptomycin at 37 °C in a humidified atmosphere (5% CO2). Cells were passaged every 4-5 days at 80% confluence. Mouse Islet Isolation and Treatment—Mouse islets were isolated from male FVB/N mice (∼2 months of age) as described previously (24Joseph J.W. Koshkin V. Saleh M.C. Sivitz W.I. Zhang C.Y. Lowell B.B. Chan C.B. Wheeler M.B. J. Biol. Chem. 2004; 279: 51049-51056Abstract Full Text Full Text PDF PubMed Scopus (172) Google Scholar). To obtain single islet cells, these intact mouse islets were dispersed in dispase II solution (0.6-2.4 units/ml) for 5 min and loaded onto glass coverslips after being washed with culture medium. The intact islets and single islet cells were cultured in RPMI 1640 medium containing 11.1 mm glucose supplemented with 10% fetal bovine serum, 10 mm HEPES, 100 units/ml penicillin, and 100 μg/ml streptomycin for 24 h before being assayed. Construction and Expression of siRNAs, Viruses, and Plasmids—The sequences of the siRNA duplex targeted to VILIP-1 were 5′-GAACAAAGAUGACCAGAUUTT-3′ (sense) and 5′-AAUCUGGUCAUCUUUGUUCTT-3′ (antisense), corresponding to nucleotides 480-498 of mouse VILIP-1 cDNA (GenBank™ accession number D21165). The oligonucleotide sequences were subjected to a BLAST search, and no significant identity to other sequences was detected. The scrambled nonsense siRNA duplex sequences used as a negative control in MIN6 cells were 5′-UCAGAGUCUCGCAAUCACGTT-3′ (sense) and 5′-CGUGAUUGCGAGACUCUGATT-3′ (antisense) as described (25Mitchell K.J. Tsuboi T. Rutter G.A. Diabetes. 2004; 53: 393-400Crossref PubMed Scopus (69) Google Scholar). The control duplex showed no significant homology to any known protein as assessed using the BLAST and NCBI Databases. VILIP-1 down-regulation was obtained by transfecting cells with the siRNA duplex (referred to as V1-siRNA) using Lipofectamine 2000 according to the manufacturer's instructions. 100 pmol of siRNA complexed by 5 μl of Lipofectamine 2000 was used in 1 ml of medium. Fluorescein-conjugated siRNA duplex was used for cotransfection with V1-siRNA or scrambled siRNA to identify cells incorporated with the siRNA duplex. The full-length cDNA of VILIP-1-EGFP was subcloned into a cytomegalovirus promoter-driven adenoviral vector (AdLox.HTM) via HindIII and XbaI, yielding Ad-VILIP-1-EGFP. The virus was created according to the protocol described previously (26Chan C.B. MacDonald P.E. Saleh M.C. Johns D.C. Marban E. Wheeler M.B. Diabetes. 1999; 48: 1482-1486Crossref PubMed Scopus (229) Google Scholar). Recombinant adenovirus particles of Ad-VILIP-1-EGFP or the control virus (Ad-EGFP) produced after recombination were amplified by passage in CRE8 cells as described (26Chan C.B. MacDonald P.E. Saleh M.C. Johns D.C. Marban E. Wheeler M.B. Diabetes. 1999; 48: 1482-1486Crossref PubMed Scopus (229) Google Scholar). Recombinant adenovirus particles (∼1010 plaque-forming units/ml) were used to infect isolated mouse islets (multiplicity of infection of 104, assuming 103 β-cells/islet). Overexpression of VILIP-1 in MIN6 or single islet cells was achieved by transfection of VILIP-1-EGFP using Lipofectamine 2000 (27Gromada J. Bark C. Smidt K. Efanov A.M. Janson J. Mandic S.A. Webb D.L. Zhang W. Meister B. Jeromin A. Berggren P.O. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 10303-10308Crossref PubMed Scopus (45) Google Scholar), and that in intact mouse islets by adenoviral transduction. A pilot study with the control virus Ad-EGFP demonstrated that 70-80% of the cells in islets were infected as detected by confocal fluorescence microscopy. Evaluation of Insulin Secretion and Content in MIN6 Cells and Mouse Islets—MIN6 cells were seeded into 24-well plates and incubated for 48-72 h before glucose-stimulated insulin secretion (GSIS) studies. Cells were preincubated for 1 h in glucose-free Krebs-Ringer HEPES buffer (125 mm NaCl, 5.9 mm KCl, 1.28 mm CaCl2, 5.0 mm NaCO3, 25 mm HEPES, and 0.1% (w/v) bovine serum albumin) in a 37 °C humidified incubator. The cells were then incubated in the same buffer containing 2.8 mm (basal concentration) or 20 mm (stimulatory concentration) glucose for 1 h or 20 mm glucose with 20 mm arginine for 5 min. Islets (10/condition) were preincubated for two sequential 30-min periods in Krebs-Ringer HEPES buffer and for 2 h at the indicated glucose concentration (either 2.8 or 20 mm) (24Joseph J.W. Koshkin V. Saleh M.C. Sivitz W.I. Zhang C.Y. Lowell B.B. Chan C.B. Wheeler M.B. J. Biol. Chem. 2004; 279: 51049-51056Abstract Full Text Full Text PDF PubMed Scopus (172) Google Scholar). The supernatants of the cells were collected and centrifuged at 300 g × for 10 min to remove cell debris for insulin secretion assessment, and the cell pellets were lysed with acid ethanol (75% ethanol containing 1.5% (v/v) HCl) for DNA quantification or insulin content assessment (21Wang X. Li H. De Leo D. Guo W. Koshkin V. Fantus I.G. Giacca A. Chan C.B. Der S. Wheeler M.B. Diabetes. 2004; 53: 129-140Crossref PubMed Scopus (83) Google Scholar). The insulin concentration in the supernatant or cell lysate was measured by radioimmunoassay as described previously (28Brubaker P.L. Lee Y.C. Drucker D.J. J. Biol. Chem. 1992; 267: 20728-20733Abstract Full Text PDF PubMed Google Scholar). The insulin secretion data were normalized by total DNA content. Measurement of Intracellular cAMP Content—Intracellular cAMP was measured as described previously (29Salapatek A.M. MacDonald P.E. Gaisano H.Y. Wheeler M.B. Mol. Endocrinol. 1999; 13: 1305-1317Crossref PubMed Scopus (36) Google Scholar). Briefly, the cells were washed with cold Krebs-Ringer HEPES buffer after removal of the supernatant. Intracellular cAMP was extracted with 80% ethanol and resuspended in cAMP assay buffer (0.05 mm sodium acetate (pH 6.2) and 0.01% sodium azide) and measured by radioimmunoassay using an intracellular cAMP assay kit. Quantitative Real-time PCR—Total RNA was extracted from MIN6 cells using TRIzol reagent and further purified with RNeasy kits according to the manufacturer's instructions. Purified RNA was converted to cDNA using SuperScript II reverse transcriptase, and real-time PCR was performed using an ABI PRISM 7900HT sequence detection system (Applied Biosystems, Foster City, CA) according to the same protocol described previously (21Wang X. Li H. De Leo D. Guo W. Koshkin V. Fantus I.G. Giacca A. Chan C.B. Der S. Wheeler M.B. Diabetes. 2004; 53: 129-140Crossref PubMed Scopus (83) Google Scholar). Primer Express Version 2.0 (Applied Biosystems) was used to design primers for real-time PCR. Platinum Taq DNA polymerase reagents were used to amplify target cDNA sequences, and SYBR Green was used to quantify PCR products. A standard curve was generated using mouse genomic DNA for quantification purposes. The measurements of gene expression were normalized by β-actin transcripts in the same sample. The sequences of the primers are shown in Table 1.TABLE 1Primers for real-time PCR PKB, protein kinase B; ERK, extracellular signal-regulated kinase; mTOR, mammalian target of rapamycin.Gene nameRoleNCBI accession no.Forward primer (5′-3′)Reverse primer (5′-3′)akt1/PKBβ-Cell proliferationNM_009652TGCATTGCCGAGTCCAGAACAGCGCATCCGAGAAACAAcdk4β-Cell proliferationNM_009870CTTTAACCCACATAAGCGAATCTCTGCTTTCCTCCTTGTGCAGGTAc-mycMAPK/ERK growth and differentiationNM_010849CGGTTCCTTCTGACAGAACTGACAGCCAAGGTTGTGAGGTTAGGCREBMAPK/ERK growth and differentiationNM_009952GCAGCAAGAGAATGTCGTAGAAAGCCTCAATCAATGTTTTGTTTTGGTCyclin A2DNA replicationNM_009828CCTTGCAGCTCTGAAAATTTGTAAAAGAGCATCCTGGCCTACATGTCCyclin D1β-Cell proliferationNM_007631AGGCTACAGAAGAGTATTTATGGGAAAGTGCGTTTGAATCAAGGGAGATCyclin D2β-Cell proliferationNM_009829GTGAATTTGGGCTTCTACTTCCAAGCGAATTCCCTCCATCAGAfoxo1β-Cell proliferationNM_019739GCGCATAGCACCAAGTCTTCAAGCGTGACACAGGGCATCAGlucokinaseGlucose sensingNM_028121AGGCCCCACAGCTTGTTCTCAAAAGGAACGAGTAGCAGTCTTGTglut2Glucose sensingNM_031197CACATTCAAACTGACTTTCTGTTACCTTGTACGCAAAACCCGAAGTCTgsk3bSurvivalNM_019827TCTGCTAAGGTGAGCTGATGACTAGAACCACCTGGAGGGCAAGAingapIslet neogenesisNM_013893GACAAAGGAGCGAGCATGATGCAGCAGAGATGAGATGAGGAATTCirs2β-Cell proliferationXM_357863CATCGACTTCCTGTCCCATCACCCATCCTCAAGGTCAAAGGmapk1MAPK/ERK growth and differentiationNM_011949CAGTTCTTTACCCTGGTCCTGTCTCGCTCTGAAAGGCTCAAAGGmTORβ-Cell proliferationNM_020009CTAGAGCAGGTTGTGAGTTATAAGCAATTTACTCAGATACAACGTGGTGTCTAGApdx-1β-Cell proliferationNM_008814CGGCTGAGCAAGCTAAGGTTTGGAAGAAGCGCTCTCTTTGAInsulinNM_008386ATCAGAGACCATCAGCAAGCAGGTGGGACCACAAAGATGCTGTTTGACβ-ActinNM_007393AGATCTGGCACCACACCTTCTACATTTCACGGTTGGCCTTAGGGTTCA Open table in a new tab Luciferase Reporter Assay—24 h after siRNA duplex transfection, MIN6 cells were cotransfected with rat insulin I promoter-Renilla luciferase and cytomegalovirus promoter-Renilla luciferase (9:1 ratio); the latter was used for constitutive expression of Renilla luciferase as an internal control. 2 days after cotransfection, the cells were washed with cold phosphate-buffered saline and lysed with reporter buffer (Promega Corp.). The assay was performed using the Dual-Luciferase reporter assay system. The ratio of the activity of firefly to Renilla luciferase is presented as the relative luciferase activity. Luciferase expression without an upstream promoter was taken as the basal activity. Fractionation, Immunoblotting, and Immunoprecipitation— Tissues and MIN6 cells were homogenized in lysis buffer (20 mm Tris-HCl (pH 7.5), 150 mm NaCl, 1 mm Na2EDTA, 1 mm EGTA, 1% Triton, 2.5 mm sodium pyrophosphate, 1 mm β-glycerophosphate, 1 mm Na3VO4, 1 μg/ml leupeptin, and 1 mm phenylmethylsulfonyl fluoride). The subcellular fractionation of MIN6 cells was performed according to the protocol of the Qproteome compartment kit. Differential speed centrifugation of the lysate was implemented to obtain subcellular fractions. The supernatant from the 1000 × g centrifugation contained cytosolic proteins, that from the 6000 × g centrifugation contained membrane proteins, and that from the 6800 × g centrifugation contained nuclear proteins. The fractions or whole cell lysates were separated by 12% SDS-PAGE and transferred to polyvinylidene difluoride membranes. The rabbit polyclonal antibody against VILIP-1 used for immunoblotting has been described previously (30Braunewell K.-H. Gundelfinger E.D. Neurosci. Lett. 1997; 234: 139-142Crossref PubMed Scopus (21) Google Scholar). The intensity of the appropriate immunoreactive bands was measured by densitometry, and the data were normalized by β-actin content as described (21Wang X. Li H. De Leo D. Guo W. Koshkin V. Fantus I.G. Giacca A. Chan C.B. Der S. Wheeler M.B. Diabetes. 2004; 53: 129-140Crossref PubMed Scopus (83) Google Scholar) and analyzed using image analysis software (Scion Image Version 4.02, Scion Corp., Frederick, MD). Immunoprecipitation was performed as described previously (31Leung Y.M. Kang Y. Gao X. Xia F. Xie H. Sheu L. Tsuk S. Lotan I. Tsushima R.G. Gaisano H.Y. J. Biol. Chem. 2003; 278: 17532-17538Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar). Briefly, HEK293 cells transfected with the cDNA of VILIP-1, syntaxin-1, or SNAP25 were harvested in binding buffer (25 mm HEPES (pH 7.4), 100 mm KCl, 2 mm EDTA, 1% Triton X-100, 20 μm NaF, 1 mm phenylmethylsulfonyl fluoride, 2 μm pepstatin A, 1 μg/ml leupeptin, and 10 μg/ml aprotinin). After sonification and centrifugation to remove cell debris, the supernatant was incubated overnight with glutathione S-transferase (GST; negative control), GST-syntaxin-1A, or GST-SNAP25 at 4 °C with constant agitation. Fusion proteins GST-syntaxin-1A and GST-SNAP25 were prepared as described (22Kang Y. Leung Y.M. Manning-Fox J.E. Xia F. Xie H. Sheu L. Tsushima R.G. Light P.E. Gaisano H.Y. J. Biol. Chem. 2004; 279: 47125-47131Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar, 23MacDonald P.E. Wang G. Tsuk S. Dodo C. Kang Y. Tang L. Wheeler M.B. Cattral M.S. Lakey J.R. Salapatek A.M. Lotan I. Gaisano H.Y. Mol. Endocrinol. 2002; 16: 2452-2461Crossref PubMed Scopus (70) Google Scholar). All GST fusion proteins were bound to glutathione-agarose beads. The beads were washed three times with binding buffer. The eluants from the beads were separated by 12% SDS-PAGE; transferred to polyvinylidene difluoride membranes; and identified with rabbit anti-VILIP-1 polyclonal antibody (1:5000), mouse anti-syntaxin-1A monoclonal antibody (1:1000), or mouse anti-SNAP25 monoclonal antibody (1:1000). Immunohistochemistry—Pancreases were fixed in 4% paraformaldehyde, dehydrated, and processed for paraffin embedding using routine procedures. Sections (5 μm) were adhered to glass slides, rehydrated, and blocked with 3% H2O2 for 10 min. After being washed with phosphate-buffered saline, sections were incubated in appropriate non-immune serum (5%) for 30 min (goat for VILIP and rabbit for insulin). Sections were blotted to remove excess serum prior to overnight application of anti-insulin (1:1000) or anti-VILIP-1 (1:800) primary antibody (32Bernstein H.G. Baumann B. Danos P. Diekmann S. Bogerts B. Gundelfinger E.D. Braunewell K.-H. J. Neurocytol. 1999; 28: 655-662Crossref PubMed Scopus (100) Google Scholar) at 4 °C. Positive immunostaining was detected by incubating sections with goat antirabbit or rabbit anti-guinea pig peroxidase (1:100) for VILIP-1 and insulin, respectively, for 60 min at room temperature, followed by application of diaminobenzidene/H2O2 for 8 min. Dispersed mouse islet cells on glass coverslips were fixed in 3.7% formaldehyde and permeabilized with 0.1% Triton X-100. After being washed with phosphate-buffered saline, the coverslips were blocked in 5% bovine serum albumin for 2 h before overnight application of primary antibody against VILIP-1, insulin, or glucagon at 4 °C. Cy5-conjugated donkey anti-rabbit secondary antibody was used to detect VILIP-1; fluorescein isothiocyanate (FITC)-conjugated rat anti-mouse and FITC donkey anti-guinea pig secondary antibodies were used to detect glucagon and insulin, respectively. The images were captured by confocal fluorescence microscopy. Capacitance Measurements—Cells expressing EGFP or exhibiting fluorescein fluorescence were selected and patch-clamped in the whole cell configuration at 33 °C. The capacitance measurements were performed using an EPC-9 amplifier and PULSE software from HEKA Elektronik (Lambrecht, Germany). Patch pipettes were pulled from 1.5-mm thin-walled borosilicate glass tubes using a two-stage Narishige micropipette puller and had typical resistances of 3-6 megaohms when fire polished and filled with an intracellular solution containing 120 mm CsCl, 20 mm tetraethylammonium chloride, 1 mm MgCl2, 0.05 mm EGTA, 10 mm HEPES, 0.1 mm cAMP, and 5 mm MgATP, pH 7.3, with CsOH. Extracellular solutions contained 118 mm NaCl, 20 mm triethylammonium chloride, 2.6 mm CaCl2, 5 mm HEPES, 5.6 mm KCl, 1.2 mm MgCl2, and 20 mm glucose, pH 7.4, with NaOH. Confocal Fluorescence Microscopy—Islets overexpressing VILIP-1-EGFP were analyzed using a Zeiss LSM-510 laser scanning confocal imaging system with a ×40 water immersion Plan Apochromat objective. Samples were subjected to optical sectioning by moving the focal plane along the vertical (z) axis. HEK293 cells transiently transfected with VILIP-1-EGFP were treated with 1 mm ionomycin in Krebs-Ringer HEPES buffer. Serial images of these cells were taken every 15 s with the same apparatus. Statistics—All data are presented as the means ± S.E. Statistical comparisons were performed using Student's t test. Patch clamp data were analyzed with IGOR Pro Version 3.12 software (WaveMetrics, Lake Oswego, OR). Differences were considered to be significant when p < 0.05. Expression of VILIP-1 in Cells and Tissues—Immunostaining of dispersed mouse islets showed that VILIP-1 localized to insulin-expressing β-cells

Referência(s)