Portal de Periódicos da CAPES

Transplantation of target site specificity by swapping the endonuclease domains of two LINEs

2002; Springer Nature; Volume: 21; Issue: 3 Linguagem: Inglês

10.1093/emboj/21.3.408

1460-2075

Hidekazu Takahashi, Haruhiko Fujiwara,

Plant Virus Research Studies

Article1 February 2002free access Transplantation of target site specificity by swapping the endonuclease domains of two LINEs Hidekazu Takahashi Hidekazu Takahashi Present address: Department of Molecular Biology and Genetics, Johns Hopkins School of Medicine, Baltimore, MD, 21205 USA Search for more papers by this author Haruhiko Fujiwara Corresponding Author Haruhiko Fujiwara Department of Integrated Biosciences, Graduate School of Frontier Sciences, University of Tokyo, Bioscience Building 501, Kashiwa, Chiba, 277-8562 Japan Search for more papers by this author Hidekazu Takahashi Hidekazu Takahashi Present address: Department of Molecular Biology and Genetics, Johns Hopkins School of Medicine, Baltimore, MD, 21205 USA Search for more papers by this author Haruhiko Fujiwara Corresponding Author Haruhiko Fujiwara Department of Integrated Biosciences, Graduate School of Frontier Sciences, University of Tokyo, Bioscience Building 501, Kashiwa, Chiba, 277-8562 Japan Search for more papers by this author Author Information Hidekazu Takahashi2 and Haruhiko Fujiwara 1 1Department of Integrated Biosciences, Graduate School of Frontier Sciences, University of Tokyo, Bioscience Building 501, Kashiwa, Chiba, 277-8562 Japan 2Present address: Department of Molecular Biology and Genetics, Johns Hopkins School of Medicine, Baltimore, MD, 21205 USA *Corresponding author. E-mail: [email protected] The EMBO Journal (2002)21:408-417https://doi.org/10.1093/emboj/21.3.408 PDFDownload PDF of article text and main figures. ToolsAdd to favoritesDownload CitationsTrack CitationsPermissions ShareFacebookTwitterLinked InMendeleyWechatReddit Figures & Info Long interspersed elements (LINEs) are ubiquitous genomic elements in higher eukaryotes. Here we develop a novel assay to analyze in vivo LINE retrotransposition using the telomeric repeat-specific elements SART1 and TRAS1. We demonstrate by PCR that silkworm SART1, which is expressed from a recombinant baculovirus, transposes in Sf9 cells into the chromosomal (TTAGG)n sequences, at the same specific nucleotide position as in the silkworm genome. Thus authentic retrotransposition by complete reverse transcription of the entire RNA transcription unit and occasional 5′ truncation is observed. The retrotransposition requires conserved domains in both open reading frames (ORFs), including the ORF1 cysteine– histidine motifs. In contrast to human L1, recognition of the 3′ untranslated region sequence is crucial for SART1 retrotransposition, which results in efficient trans-complementation. Swapping the endonuclease domain from TRAS1 into SART1 converts insertion specificity to that of TRAS1. Thus the primary determinant of in vivo target selection is the endonuclease domain, suggesting that modified LINEs could be used as gene therapy vectors, which deliver only genes of interest but not retrotransposons themselves in trans to specific genomic locations. Introduction The recent progress of genome projects has revealed an abundance of transposable elements in higher eukaryotic genomes. In humans, ∼45% of the genome is comprised of transposable elements (Lander et al., 2001). Among these elements, DNA transposons account for only 3%. The most abundant group is long interspersed elements (LINEs), which make up 21% of the genome (Weiner et al., 1986; Smit et al., 1999). LINEs are a major class of retrotransposable elements, which transpose through the RNA intermediates by self-encoding reverse transcriptase (RT) activity. LINEs shape mammalian genomes through de novo disease formation, exon shuffling and mobilization of short interspersed elements (SINEs) and processed pseudogenes (Kazazian et al., 1988; Moran et al., 1999; Esnault et al., 2000). LINEs, also called non-long terminal repeat (non-LTR) retrotransposons, use a less characterized transposition mechanism than LTR retrotransposons and retroviruses, which use LTRs as essential cis elements for reverse transcription (Boeke and Stoye, 1997). LINEs can be classified into two subtypes (Malik et al., 1999). One subtype is characterized by the existence of a restriction enzyme-like endonuclease domain 3′ to the RT domain, and a single open reading frame (ORF) in most cases. This group has an evolutionarily ancient origin and in all cases retrotransposition is directed to specific target sequences. In vitro biochemical analysis of such an element, R2, led to the current model for non-LTR retrotransposition. The R2 ORF protein could make a specific nick on the target site of 28S rDNA and use this nick to prime reverse transcription of the RNA (Luan et al., 1993). This mechanism is termed target-primed reverse transcription (TPRT). The other type of LINEs is hallmarked by the existence of an apurinic/apyrimidinic-like endonuclease (APE) domain 5′ to the RT domain, and two ORFs in most cases. This group shows a broader range of distribution among eukaryotes, and contains human L1, Drosophila I factor and silkworm R1 (Fawcett et al., 1986; Hattori et al., 1986; Xiong and Eickbush, 1988). This type of LINE encodes two poorly characterized ORF proteins. The ORF1 protein has been shown to form a cytoplasmic multimeric ribonucleoprotein complex (Hohjoh and Singer, 1996; Dawson et al., 1997; Pont-Kingdon et al., 1997) and to possess nucleic acid chaperone activity (Martin and Bushman, 2001). The second ORF encodes a protein with an N-terminal APE domain (Feng et al., 1996), a central RT domain (Mathias et al., 1991) and a C-terminal cysteine–histidine motif. An in vivo retrotransposition assay using a drug resistance marker was developed for human L1 to identify several ORF amino acid residues crucial for retrotransposition (Moran et al., 1996). However, the lack of insertion site specificity in L1 has hindered further analysis of the retrotransposition mechanism. The TRAS/SART families have structures typical of the latter subtype of LINEs (Okazaki et al., 1995; Takahashi et al., 1997). They are highly transcribed in many tissues, driven by an internal promoter in the case of TRAS1 (Takahashi and Fujiwara, 1999). They are 6–8 kb in length with two overlapping ORFs and a 3′ poly(A) tail. TRAS1 and SART1 are 29.3% identical in the amino acid sequence of the RT domain. Although their gene organization is similar to that of human L1, TRAS1 and SART1 are unique in that they insert at specific nucleotide positions into the telomeric repeats, (TTAGG)n, of the silkworm, Bombyx mori (Okazaki et al., 1993; Sasaki and Fujiwara, 2000). The TRAS/SART families therefore offer a good model system to characterize the retrotransposition of the latter subtype of LINEs such as L1. In this paper, we develop a novel assay to analyze in vivo LINE retrotransposition, using SART1 and TRAS1. We express the B.mori SART1 element under the control of the polyhedrin promoter from Autographa californica nuclear polyhedrosis virus (AcNPV) in Spodoptera frugiperda 9 (Sf9) cells. Since S.frugiperda belongs to the same order, Lepidoptera, as B.mori and has the (TTAGG)n repeats at telomeres (Maeshima et al., 2001), the retrotransposition into the host cell (Sf9) chromosomal telomeric repeats is expected to occur. Using this heterologous expression system, we demonstrate by PCR that SART1 actually transposes into the telomeric repeats. The retrotransposition exhibits several features expected for SART1, such as insertion position specificity and 5′ truncation. Mutagenesis analysis shows the requirement of conserved motifs in both two ORFs for the retrotransposition. In contrast to human L1, SART1 retrotransposes by efficient trans-complementation through specific recognition of the 3′ untranslated region (UTR). We further show, using a SART1/TRAS1 chimeric element, that the APE domain exchange alters the insertion position in the manner predicted. The implications of these data for transposition mechanism, LINE and SINE evolution, and development of new gene delivery vectors will be discussed. Results A PCR assay to detect in vivo SART1 retrotransposition To detect in vivo SART1 retrotransposition, we expressed SART1 from AcNPV in Sf9 cells and monitored, using PCR, whether the silkworm SART1 transposed into the Sf9 chromosomal telomeric repeats (Figure 1A). In this heterologous expression system, we placed the SART1 ORF1/ORF2/3′UTR portion under the control of the AcNPV polyhedrin promoter (Figure 1B, top). For future biochemical analysis, the SART1 ORF1 was fused C-terminal to glutathione S-transferase (GST)–X5-(His)6-X31 (X denotes the vector-derived amino acid) with the position of ORF2/3′UTR kept native relative to ORF1. The SART1 poly(A) was followed by AcNPV-derived polyhedrin 3′UTR. Therefore, the SART1 transcript contains foreign sequences at the 5′ end and possibly at the 3′ end. We confirmed by SDS–PAGE of the Sf9 total proteins that each virus expressed the putative GST–His6-SART1 ORF1 fused protein (mol. wt ∼110 kDa; data not shown). Figure 1.A PCR assay for in vivo SART1 retrotransposition. (A) Schematic overview of the PCR assay. The hexagon represents the SART1-expressing AcNPV, which was infected into Sf9 cells. As illustrated, SART1 is expected to retrotranspose into the telomeric repeat of the Sf9 chromosomes. Black arrows indicate primers used in PCR to detect the junction between the transposed SART1 and the telomeric repeat. (B) Detailed scheme of the assay. The Sf9 telomeric repeat, (TTAGG/CCTAA)n, is shown in the middle. The schematic structure of SART1 expressed from AcNPV is shown at the top. The ORF1/ORF2/3′UTR is shaded in gray (not proportional to scale). APE and RT denote the endonuclease and reverse transcriptase domains, respectively. Vertical lines represent cysteine–histidine motifs near the C-termini of both ORFs. Note that the ORF1 is fused in-frame with the vector-derived GST–(His)6 gene for future biochemical analysis. The black rectangle represents the polyhedrin promoter that drives transcription. The SART1 3′UTR was followed by polyhedrin 3′UTR. Nucleotide position is numbered with the transcription initiation site (A of TAAG) defined as +1. White arrows denote a pair of primers, +6276 and (CCTAA)6, which were used in the experiment shown in Figure 2 to amplify the junction between the SART1 3′ ends and the telomeric repeats. Thick black arrows indicate a pair of primers, +590 and (TTAGG)6, which were used for the 5′ junction amplification in the experiment shown in Figure 3. The structure of TRAS1 expressed from AcNPV that was assayed in the experiment shown in Figure 6 is also shown at the bottom. RH denotes the RNase H domain. As indicated by dotted arrows, SART1 and TRAS1 insert between TT and AGG nucleotides with opposite orientations to each other relative to the telomeric repeat. Note that correct insertion positions have a one base uncertainty and that target site duplications have not been determined due to the repetitive nature of the poly(A) tail and the telomeric repeat. Download figure Download PowerPoint The recombinant SART1–AcNPV was infected into the Sf9 cells. Seven, 24, 48 and 72 h post-infection, cells were pelleted, washed and the Sf9 total genomic DNAs were extracted. The purified DNA was subject to PCR to amplify the junctions between transposed SART1 elements and the Sf9 telomeric repeats. To amplify the 3′ junction, we used the +6276 primer complementary to the SART1 3′UTR (Table I), and the (CCTAA)6 primer (Figure 1B, top and middle). For the 5′ junction, likewise, the +590 primer complementary to the GST gene coding strand and the (TTAGG)6 primer were used. Table 1. List of primers Name Sequence (5′→3′) +6276 TGCCTACCTCACGAAGAAGTTGCGGTCA +590 ATTTTGGGAACGCATCCAGGCACATTGGGT +6096 AGAAAGAGAGTGCGACCCAAACTCAGTT +5616 AAGTGTGCCCCGTCTGTCTGTC TRAS1 +6022 GTAGTTAAGTATAGCGTAAGATATAGTCAGTAAG SART1 S880 AAAAAACCATGGGCAGTTATAAAGAAGAATTACCCCAG SAX 3p Not1 AAGGAAAAAAGCGGCCGCTTTTTTTTTTTTTTTTTTGG SART1 S5995 AGTCACTCGTCGCGGTG SART1 A6221 AAAAAAAAAAGCGGCCGCTACGGGAGCTGAGCG SART1 1H626P CACGCACTGGGCCCCGTGAGTGCCCG SART1 2H228V GGAGACGCTCTCCGACGTCCGCTACATTGGTTTC SART1 2D699V GGTCATCTGCTACGCCGTCGACACGCTGGTGACG SART1 2C1007G GCCCTCGAAGCGGGCCCGAGGTGGG TRAS1 S2395 AAAAAACCATGGGACGCGTCCTCACTGCAA TRAS1 A7870 AATAATAATAGCGGCCGCTTTTTTTTTTTTTTTTTTTTAAGTCACTCTTTTCTCTGC SART1 A3029 TTTTTGCGGCCGCGCTGCTGGTCATTATTCGTCGTCCATTGGTGT SART1 S3668 AAAAAAAAGATCTGGAGTCTTCTTCGGTAACGACTTTGCCCTTTG TRAS1 S3848 AAAAAAAAAAGCGGCCGCCCCCTACAGAGTTTTGCAAG TRAS1 A4527 AAAAAAAGATCTTGGAGTCTAATATTGAATACCATACCG Underlined letters indicate restriction sites used for subcloning. Mutagenized nucleotides are boxed. The 3′ junction between retrotransposed SART1 elements and the telomeric repeats is identical to that found in the Bombyx genome To our surprise, after only 35 cycles of the 3′ junction PCR, we observed an intense band 24–72 h post-infection, suggesting highly efficient transposition in this system (Figure 2A). This time course accurately reflects the polyhedrin promoter expression, because the promoter is activated at 20–24 h post-infection (O'Reilly et al., 1992). The size, 400 bp, is in good accordance with that of the putative retrotransposed 3′ junction, 392 bp plus telomeric repeat length. We cloned total PCR products in lane 4 into a plasmid vector, and sequenced 29 clones (Figure 2B). All 29 clones were amplified correctly by the +6276 and (CCTAA)6 primers. Among them, 27 contained full-length 3′UTRs with poly(A) tails connected with the telomeric repeats. Importantly, the poly(A) tails of these 27 clones were directly adjoined to the AGG of the telomeric repeats, identical to the junction sequences found in the Bombyx genome (Takahashi et al., 1997). Similar results were produced in additional infection/PCR experiments. These results suggest that most of the SART1 clones arose by retrotransposition. Figure 2.3′ junction analysis for retrotransposed SART1 elements. (A) A PCR amplification of the boundaries between the transposed SART1 3′ ends and the telomeric repeats. Sf9 genomic DNAs were extracted 7, 24, 48 and 72 h post-infection (Hpi) with AcNPV expressing wild-type SART1 or 2D699V. The purified DNAs were used as templates for PCR with a pair of primers, +6276 and (CCTAA)6, described in Figure 1B. The PCR products were subject to 3% agarose electrophoresis and stained with ethidium bromide. A molecular size marker was run in the righthand lane; some of the base-pair sizes are indicated. (B) Nucleotide sequences of 29 clones from the 3′ junction PCR products shown in lane 4 of (A). The number of each type is shown on the right. Nucleotide positions are indicated with the polyhedrin transcription initiation site defined as +1. The octa nucleotide with homology to the telomeric repeat is underlined. Download figure Download PowerPoint The other two clones, however, contained only the 5′-half 152 bp of the SART1 3′UTR. They were joined to the telomeric repeats at an octanucleotide, GTTGGGTT (underlined letters in Figure 2B). Since this octamer sequence is only one base different from the telomeric repeat, GTTAGGTT, these two SART1 clones may have arisen by recombinational events with endogenous Sf9 telomeric repeats. Transduction of 3′ flanking sequences was not observed, which has often been found for human L1 (Moran et al., 1999). As a negative control, the Sf9 cells were infected with the SART1 2D699V–AcNPV, a mutant of the putative SART1 reverse transcriptase C motif, YADD, which is essential for catalytic activity. In this mutant, the aspartic acid residue at the ORF2 amino acid position 699 was substituted to a valine residue (see Figure 4A). The PCR assay for this mutant never detected retrotransposition (Figure 2A, lane 5). This result indicates that the transposition we detected was not mediated by endogenous Sf9 SART-like elements, but by authentic retrotransposition of the B.mori SART1 by its own RT activity. Figure 3.5′ junction analysis for retrotransposed SART1 elements. (A) A PCR amplification of the boundaries between the transposed SART1 5′ ends and the telomeric repeats. The AcNPV-infected Sf9 genomic DNAs were amplified with a pair of primers, +590 and (TTAGG)6, depicted in Figure 1B. The PCR products were subject to 3% agarose electrophoresis and stained with ethidium bromide. A molecular size marker was run in the righthand lane; some of the base-pair sizes are indicated. (B) SART1 retrotransposes with frequent 5′ truncation. Nucleotide sequences of 24 clones from the whole 5′ junction PCR products in lane 4 of (A) are shown. The number of each type is shown on the right. Nucleotide positions are indicated with the polyhedrin transcription initiation site defined as +1. (C) SART1 retrotransposes with 5′ aberration. The full-length 5′ junction PCR product that is indicated by an arrow in lane 4 of (A) was purified and cloned, and 16 clones were sequenced. Boxed nucleotides are not part of either the recombinant SART1 or the telomeric repeats. Download figure Download PowerPoint SART1 retrotransposes with frequent 5′ truncation and aberration The amplification of the 5′ junction through 40 cycles of PCR gave rise to visible bands 72 h post-infection (Figure 3A). In striking contrast to the 3′ junction, several bands appeared. The size of the largest band (arrow in lane 4), ∼600 bp, was in good accordance with the putative full-length 5′ transposed product length, 590 bp plus the telomeric repeat (Figure 1B). We therefore suspected that this band represents full-length retrotransposition and that smaller bands are 5′ truncations arising from abortive reverse transcription. Cloning and subsequent sequencing of the whole PCR products in lane 4 confirmed our prediction (Figure 3B). All 24 clones sequenced were amplified by the (TTAGG)6 and +590 primers. All the clones were connected 3′ to the TT of (TTAGG)n, which is the same insertion position as in the Bombyx genome. In the largest clone, the telomeric repeat was adjoined precisely with the polyhedrin RNA 5′ end sequence, AAG (Figure 1B; Possee and Howard, 1987). This result strongly implies that the recombinant SART1 transposed through RNA. All the other 23 clones turned out to be variably 5′ truncated SART1 elements connected with the telomeric repeats. None of the 5′ bands was detected from the cells infected with SART1 2D699V–AcNPV (Figure 3A, lane 5). Figure 4.Requirement of the ORFs and 3′UTR for SART1 retrotransposition. (A) Schematic explanation of various mutant SART1–AcNPVs. The amino acid position of each missense mutant is shown (named so that, in the 1H626P mutant, for example, the histidine residue at the 626th amino acid position in ORF1 is substituted to proline). This position corresponds to the first histidine residue of the three continuous CCHC motifs in ORF1. The first methionine of the SART1 ORF1 is defined as the first, whereas in the case of ORF2 the amino acid residues preceding the first methionine in the overlapping ORF region are also counted in the number. The mutant that lacks the entire the 3′UTR and poly(A) sequence but still contains the following polyhedrin 3′UTR is denoted as Δ3′. The pair of primers, +6096 and (CCTAA)6, used for 3′ junction amplification are depicted as white arrows. (B) The 3′ junction PCR assay from the Sf9 cells infected with a single AcNPV containing the wild-type/mutant SART1 elements (lane 1–7) or co-infected simultaneously with two kinds of mutant SART1–AcNPVs (lane 8–14). The PCR products were subject to 2% agarose electrophoresis and stained with ethidium bromide. A molecular size marker was run in the lefthand lane. Download figure Download PowerPoint In the Bombyx genome, we have previously found examples of duplication and aberration at the SART1 DNA 5′ ends (see figure 4 in Takahashi et al., 1997). To examine whether similar aberrant 5′ sequences were observed, we characterized the full-length retrotransposition products by extracting the largest band in lane 4 of Figure 3A (indicated by an arrow). Subcloning and sequencing of the 16 clones showed that the polyhedrin RNA 5′ end sequence, AAG, was directly joined to TT of the telomeric repeats in four clones, representing the canonical full-length retrotransposition (Figure 3C). In another clone, SART1 retrotransposed into 10mer repeats, (TCAGGTTAGG)n, which is only one nucleotide different from the telomeric repeat unit. Of the other 10 clones, eight had an extra G between the recombinant SART1 elements and the telomeric repeats. There was one case each of an extra C or TC. The G may arise commonly as a result of reverse transcription of the 5′ G cap (Hirzmann et al., 1993; Volloch et al., 1995). Alternatively, these added nucleotides may represent terminal deoxynucleotidyl transferase activity of the SART1 RT. In the other clone, a 228 bp unknown sequence was added, which is difficult to explain. Although these variations were somewhat different from those found in the Bombyx genome, the existence of the 5′ truncation and aberration also supports the authentic retrotransposition of SART1 in this system. SART1 retrotransposition requires the 3′UTR and conserved motifs in both ORFs SART1 is a typical LINE with two ORFs. ORF1 contains three C-terminal cysteine–histidine motifs, and ORF2 comprises an APE, a RT domain and one C-terminal cysteine–histidine motif (Figure 1B). To examine whether these conserved motifs are crucial for SART1 to retrotranspose in vivo, we generated a series of SART1–AcNPV constructs containing missense mutations at these conserved motifs, and assayed to determine whether these elements could transpose into the telomeric repeats (Figure 4A). We also made a SART1 Δ3′–AcNPV construct, which lacks the entire SART1 3′UTR but retains a downstream polyhedrin 3′UTR. For these elements, we conducted a 3′ junction PCR assay using the (CCTAA)6 and +6096 primers complementary to the SART1 ORF2 (Table I). As shown in Figure 4B, none of these mutants could retrotranspose in vivo (lanes 2–5 and 7). This result indicates that the APE/RT domain plus the cysteine– histidine motif in the ORF2 is indispensable for in vivo SART1 retrotransposition, as was shown for human L1 (Moran et al., 1996). Disruption of the ORF1 cysteine– histidine motifs also abolished the retrotransposition. To our knowledge, this is the first evidence that the LINE ORF1 cysteine–histidine motifs, which are widely conserved from many (but not all) LINEs to retroviruses, are crucial for retrotransposition. The SART1 retrotransposition also required the 3′UTR, suggesting that the sequence-specific recognition of the RNA 3′ end by the ORF proteins is essential for SART1 to retrotranspose. It should be noted that the SART1 5′UTR, which was replaced by the polyhedrin 5′UTR in the construct, is dispensable for retrotransposition. These mutant SART1–AcNPVs were constructed by a two-step procedure: plasmid mutagenesis and virus generation. Although we confirmed that each mutant expressed a comparable amount of the putative SART1 ORF1 protein (data not shown), the mutant SART1 elements may have failed to retrotranspose because undesired deleterious mutations were introduced into other amino acid positions during the two steps. To exclude this possibility, we conducted two control experiments. First, as a control for plasmid mutagenesis, we re-mutated the valine residue in 2D699V–AcGHLTB to an aspartic acid (Figure 4A, 2V699D). The resulting plasmid should have the identical nucleotide sequence as wild-type SART1. The AcNPV made from this plasmid restored the wild-type level of retrotransposition (Figure 4B, lane 6), indicating that the retrotransposition deficiency in the 2D699V mutant is not due to any possible undesired mutations during plasmid mutagenesis. As another control, we simultaneously infected two of these mutant viruses and assayed to determine whether retrotransposition occurred. If these mutants do not have mutations other than those we introduced, the two infected mutants might supply the ORF proteins and the RNAs to each other, resulting in retrotransposition by trans-complementation. As anticipated, the co-infections enabled SART1 retrotransposition to occur (Figure 4B, lanes 8–14). Approximately wild-type levels of signals were detected from the Δ3′ mutant co-infected with each of the ORF mutants (Figure 4B, lanes 8–11). This result suggests that the Δ3′ mutant still expresses functional ORF proteins that could act efficiently on the RNA 3′ end derived from each ORF mutant. Similarly, a somewhat reduced level of retrotransposition was observed in the ORF1 mutant, 1H626P, co-infected with each of the ORF2 mutants (Figure 4B, lanes 12–14), suggesting that 1H626P correctly produced the functional ORF2 protein, which accomplishes retrotransposition by trans-complementation with the ORF1 protein supplied from each ORF2 mutant. These analyses suggest that the retrotransposition deficiency seen in each mutant was not caused by experimental errors during the mutant AcNPV construction, but by the effect of the mutations we introduced. SART1 can retrotranspose by trans-complementation The results presented above suggest that SART1 can retrotranspose by delivering its encoded proteins in trans to other SART1 RNA/protein molecules. There remains a less likely possibility, however, that the retrotransposition was subsequently caused by the wild-type SART1 element that had been generated through recombination between two mutant DNAs. To rule out this possibility, we characterized a 3′ PCR product derived from the co-infection of the Δ3′ and 2C1007G mutant (Figure 4B, lane 11). The size of the product suggests that only the wild-type length and not the Δ3′ element transposed. Upon the SART1 2C1007G–pAcGHLTB construction by plasmid mutagenesis, we introduced an ApaI restriction site in the 2C1007G mutant. If retrotransposition occurred through reverse transcription of the 2C1007G RNA by trans-complementation, the transposed DNA 3′ end should have an additional ApaI site at the mutagenized position in addition to one in the 3′UTR (Figure 5A). On the other hand, if the retrotransposition was subsequently caused by the wild-type SART1 generated by homologous recombination, the retrotransposed DNA product would have only one ApaI site in the 3′UTR (Figure 5B). We conducted a 3′ junction PCR using the (CCTAA)6 and +5616 primer complementary to ORF2 (Figure 5C). A 1.1 kb band was detected from the Sf9 cells infected with the wild-type SART1 (Figure 5C, lane 1) or with both of the two mutants simultaneously (Figure 5C, lane 2). ApaI digestion of the wild-type PCR product gave rise to two ∼550 bp bands (Figure 5C, lane 4), whereas digestion of the PCR product from double infection mutants gave three bands, as expected from trans-complementation (Figure 5C, lane 5). The amplification from cells infected solely with Δ3′ did not produce the band that could be digested with ApaI (Figure 5C, lanes 3 and 6). These experiments suggest that the SART1 retrotransposition observed with co-infection of two mutants is not due to re-generation of a wild-type SART1 by DNA recombination, but to trans-complementation between the two mutant SART1 elements. The lack of a 3′ deleted product suggests that the Δ3′ mutant deletes a critical cis element required for transposition. Figure 5.Co-infected SART1 mutants, Δ3′ and C1007G, retrotranspose by trans-complementation. (A) The trans-complementation mechanism, in which the ORF proteins derived from Δ3′ act on C1007G SART1 RNA, gives rise to the retrotransposed C1007G DNA. (B) Alternative possibility that DNA recombination near the ORF2 C-terminus between the two mutants generates wild-type SART1, which could subsequently retrotranspose. In (A) and (B), schematic structures of Δ3′ and C1007G are shown. Note that 2C1007G lacks the cysteine–histidine motif (indicated by a vertical line in the wild type and Δ3′), instead containing an additional ApaI site, near the ORF2 C-terminus. The primers, +5616 and (CCTAA)6, used for 3′ junction PCR are depicted as white arrows. The theoretical ApaI digestion fragments from the PCR products are shown as horizontal lines above the primers. (C) 3′ junction PCR products uncut (lanes 1–3) or cut with ApaI (lanes 4–6). Molecular sizes are shown on the right. Download figure Download PowerPoint Exchange of the APE domain between TRAS1 and SART1 alters the insertion site specificity A critical step in LINE retrotransposition is the nicking of target site DNAs, which are thought to serve as primers for reverse transcription. Because the APE protein expressed in bacteria cleaves the oligonucleotides containing the target site sequences in vitro (Feng et al., 1996), this domain is thought to be responsible for the target cleavage. However, this proposed function of the APE domain has not been proved in the context of in vivo retrotransposition, although this domain was vital for in vivo retrotransposition (Feng et al., 1996). To this end, we developed a novel approach using our system. TRAS1 is another retrotransposon, which inserts at a specific nucleotide position with the opposite orientation to SART1 relative to the telomeric repeats (Figure 1B; Okazaki et al., 1995). Taking advantage of the insertion sequence difference of these two elements, we constructed a chimeric SART1–TRAS1 APE element, in which the SART1 APE domain was replaced by TRAS1 APE and with the other SART1 portions kept native (Figure 6A). If the TRAS1 APE domain determines the target site of this chimeric retrotransposon, this element would insert at the same nucleotide position as TRAS1 but not as SART1 within the telomeric repeats. Figure 6.Target site alteration i