Identification of the cis-Acting Endoplasmic Reticulum Stress Response Element Responsible for Transcriptional Induction of Mammalian Glucose-regulated Proteins
1998; Elsevier BV; Volume: 273; Issue: 50 Linguagem: Inglês
10.1074/jbc.273.50.33741
ISSN1083-351X
AutoresHiderou Yoshida, Kyosuke Haze, Hideki Yanagi, Takashi Yura, Kazutoshi Mori,
Tópico(s)Fungal and yeast genetics research
ResumoWhen unfolded proteins accumulate in the endoplasmic reticulum (ER), transcription of glucose-regulated proteins (GRPs) representing ER-resident molecular chaperones is markedly induced via the unfolded protein response (UPR) pathway. In contrast to recent progress in the analysis of yeast UPR, bothcis-acting elements and transactivators responsible for mammalian UPR have remained obscure. Here, we analyzed the promoter regions of human GRP78, GRP94, and calreticulin genes and identified a novel element designated the ER stress response element (ERSE). ERSE, with a consensus of CCAATN9CCACG, was shown to be necessary and sufficient for induction of these GRPs. Using yeast one-hybrid screening, we isolated a human cDNA encoding a basic leucine zipper (bZIP) protein, ATF6, as a putative ERSE-binding protein. When overexpressed in HeLa cells, ATF6 enhanced transcription of GRP genes in an ERSE-dependent manner, whereas CREB-RP, another bZIP protein closely related to ATF6, specifically inhibited GRP induction. Endogenous ATF6 constitutively expressed as a 90-kDa protein was converted to a 50-kDa protein in ER-stressed cells, which appeared to be important for the cellular response to ER stress. These results suggest that, as in yeast, bZIP proteins are involved in mammalian UPR, acting through newly defined ERSE. When unfolded proteins accumulate in the endoplasmic reticulum (ER), transcription of glucose-regulated proteins (GRPs) representing ER-resident molecular chaperones is markedly induced via the unfolded protein response (UPR) pathway. In contrast to recent progress in the analysis of yeast UPR, bothcis-acting elements and transactivators responsible for mammalian UPR have remained obscure. Here, we analyzed the promoter regions of human GRP78, GRP94, and calreticulin genes and identified a novel element designated the ER stress response element (ERSE). ERSE, with a consensus of CCAATN9CCACG, was shown to be necessary and sufficient for induction of these GRPs. Using yeast one-hybrid screening, we isolated a human cDNA encoding a basic leucine zipper (bZIP) protein, ATF6, as a putative ERSE-binding protein. When overexpressed in HeLa cells, ATF6 enhanced transcription of GRP genes in an ERSE-dependent manner, whereas CREB-RP, another bZIP protein closely related to ATF6, specifically inhibited GRP induction. Endogenous ATF6 constitutively expressed as a 90-kDa protein was converted to a 50-kDa protein in ER-stressed cells, which appeared to be important for the cellular response to ER stress. These results suggest that, as in yeast, bZIP proteins are involved in mammalian UPR, acting through newly defined ERSE. Glucose-regulated proteins (GRPs) 1The abbreviations used are: GRP, glucose-regulated protein; ER, endoplasmic reticulum; ERSE, ER stress response element; UPR, unfolded protein response; UPRE, unfolded protein response element; GAL4AD, transactivation domain of GAL4 protein; TM, tunicamycin; SRF, serum response factor; SRE, serum response element; bZIP, basic leucine zipper; bp, base pair(s); CREB, cAMP response element-binding protein; CREB-RP, CREB-related protein. 1The abbreviations used are: GRP, glucose-regulated protein; ER, endoplasmic reticulum; ERSE, ER stress response element; UPR, unfolded protein response; UPRE, unfolded protein response element; GAL4AD, transactivation domain of GAL4 protein; TM, tunicamycin; SRF, serum response factor; SRE, serum response element; bZIP, basic leucine zipper; bp, base pair(s); CREB, cAMP response element-binding protein; CREB-RP, CREB-related protein. represent a set of molecular chaperones or folding enzymes localized in the endoplasmic reticulum (ER) (Ref. 1Gething M.-J. Guidebook to Molecular Chaperones and Protein-Folding Catalysts. Oxford University Press, Oxford1997Google Scholar and references therein). Accumulation of unfolded or misfolded proteins in the ER is sensed as "ER stress" and triggers activation of interorganelle signaling from the ER to the nucleus, leading to enhanced transcription of GRP genes (2Lee A.S. Trends Biochem. Sci. 1987; 12: 20-23Abstract Full Text PDF Scopus (390) Google Scholar, 3Kozutsumi Y. Segal M. Normington K. Gething M.J. Sambrook J. Nature. 1988; 332: 462-464Crossref PubMed Scopus (963) Google Scholar). This stress response system, called the unfolded protein response (UPR) or the ER stress response, is thought to be conserved from yeast to mammals (4McMillan D.R. Gething M.J. Sambrook J. Curr. Opin. Biotechnol. 1994; 5: 540-545Crossref PubMed Scopus (70) Google Scholar, 5Shamu C. Cox J. Walter P. Trends Cell Biol. 1994; 4: 56-60Abstract Full Text PDF PubMed Scopus (130) Google Scholar). Understanding of the molecular mechanisms of UPR has progressed usingSaccharomyces cerevisiae as a model system. Identification of the cis-acting UPR element (UPRE) present in yeast GRP promoters (6Mori K. Sant A. Kohno K. Normington K. Gething M.J. Sambrook J.F. EMBO J. 1992; 11: 2583-2593Crossref PubMed Scopus (308) Google Scholar) has led to the isolation of four genes required for the yeast UPR, namely IRE1/ERN1, HAC1/ERN4,RLG1, and PTC2. Ire1p is a transmembrane protein kinase localized in the ER and is thought to act as a sensor of ER stress (7Mori K. Ma W. Gething M.J. Sambrook J. Cell. 1993; 74: 743-756Abstract Full Text PDF PubMed Scopus (644) Google Scholar, 8Cox J.S. Shamu C.E. Walter P. Cell. 1993; 73: 1197-1206Abstract Full Text PDF PubMed Scopus (914) Google Scholar), which appears to be negatively regulated by protein serine/threonine phosphatase Ptc2p (9Welihinda A.A. Tirasophon W. Green S.R. Kaufman R.J. Mol. Cell. Biol. 1998; 18: 1967-1977Crossref PubMed Scopus (96) Google Scholar). The yeast UPR-specific transcription factor Hac1p is a basic leucine zipper (bZIP) protein that specifically binds to UPRE (10Mori K. Kawahara T. Yoshida H. Yanagi H. Yura T. Genes Cells. 1996; 1: 803-817Crossref PubMed Scopus (301) Google Scholar, 11Cox J.S. Walter P. Cell. 1996; 87: 391-404Abstract Full Text Full Text PDF PubMed Scopus (783) Google Scholar). Yeast has developed a unique system to produce Hac1p only when required (11Cox J.S. Walter P. Cell. 1996; 87: 391-404Abstract Full Text Full Text PDF PubMed Scopus (783) Google Scholar, 12Sidrauski C. Cox J.S. Walter P. Cell. 1996; 87: 405-413Abstract Full Text Full Text PDF PubMed Scopus (354) Google Scholar, 13Sidrauski C. Walter P. Cell. 1997; 90: 1031-1039Abstract Full Text Full Text PDF PubMed Scopus (655) Google Scholar, 14Kawahara T. Yanagi H. Yura T. Mori K. Mol. Biol. Cell. 1997; 8: 1845-1862Crossref PubMed Scopus (231) Google Scholar, 15Chapman R.E. Walter P. Curr. Biol. 1997; 7: 850-859Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar, 16Kawahara T. Yanagi H. Yura T. Mori K. J. Biol. Chem. 1998; 273: 1802-1807Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar). HAC1mRNA is constitutively expressed but not translated under normal conditions due to the presence of an intron located inside the Hac1p-coding region. Upon ER stress, it becomes spliced immediately by endonuclease activity present in the C-terminal tail region of Ire1p and RNA ligase activity of Rlg1p. Spliced HAC1 mRNA is effectively translated, and synthesized Hac1p activates transcription of yeast GRP genes in a UPRE-dependent manner. In contrast, the mammalian UPR system seemed to be more complex. Lee and co-workers (17Resendez Jr., E. Wooden S.K. Lee A.S. Mol. Cell. Biol. 1988; 8: 4579-4584Crossref PubMed Scopus (64) Google Scholar, 18Ting J. Lee A.S. DNA. 1988; 7: 275-286Crossref PubMed Scopus (183) Google Scholar, 19Wooden S.K. Li L.J. Navarro D. Qadri I. Pereira L. Lee A.S. Mol. Cell. Biol. 1991; 11: 5612-5623Crossref PubMed Scopus (128) Google Scholar, 20Li W.W. Sistonen L. Morimoto R.I. Lee A.S. Mol. Cell. Biol. 1994; 14: 5533-5546Crossref PubMed Google Scholar) reported that transcriptional induction of mammalian GRP78 is mediated by multiple redundant cis-acting elements and that among these the two most critical regulatory regions are CORE and C1 (see Fig. 1). The zinc finger-type transcription factor YY1 was reported to bind CORE (21Li W.W. Hsiung Y. Zhou Y. Roy B. Lee A.S. Mol. Cell. Biol. 1997; 17: 54-60Crossref PubMed Scopus (82) Google Scholar, 22Li W.W. Hsiung Y. Wong V. Galvin K. Zhou Y. Shi Y. Lee A.S. Mol. Cell. Biol. 1997; 17: 61-68Crossref PubMed Scopus (68) Google Scholar), whereas the histone fold motif-type transcription factor NF-Y/CBF bound to C1 (23Roy B. Lee A.S. Mol. Cell. Biol. 1995; 15: 2263-2274Crossref PubMed Scopus (86) Google Scholar, 24Roy B. Li W.W. Lee A.S. J. Biol. Chem. 1996; 271: 28995-29002Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar). However, such ubiquitous factors alone provided little basis for specific induction of GRP genes, and the available evidence suggested little similarity in cis-acting elements and transcription factors involved between yeast and mammal: neither CORE nor C1 is similar to UPRE, and Hac1p shows no homology to either YY1 or NF-Y. Moreover, the consensus sequence of the cis-element remained undetermined. We report here that the mammalian UPR system is more sophisticated than was previously thought; a newly identified 19-nt motif CCAATN9CCACG, designated ER stress response element (ERSE), was found to be a cis-element critical for transcriptional induction of human GRP78, GRP94, and calreticulin. Using ERSE as a probe, we cloned the human bZIP transcription factor ATF6, containing a DNA-binding domain similar to that of Hac1p. Thus, the mammalian UPR system seems to share a certain basic feature with that in yeast. HeLa cells were grown in Dulbecco's modified Eagle's medium (glucose at 4.5 g/liter) supplemented with 10% fetal calf serum, 2 mm glutamine and antibiotics, 100 units/ml penicillin, and 100 μg/ml streptomycin. Cells were maintained at 37 °C in a humidified 5% CO2, 95% air atmosphere. Recombinant DNA techniques were performed according to standard procedures (25Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). Based on the published sequence of the human GRP78 gene (18Ting J. Lee A.S. DNA. 1988; 7: 275-286Crossref PubMed Scopus (183) Google Scholar), a 311-bp fragment of the GRP78 promoter (−304 to +7 region; numbers indicate the nucleotide position relative to the transcription start site) was amplified by polymerase chain reaction from HeLa genomic DNA and cloned into theKpnI–XhoI sites of the pGL3-Basic vector (Promega, Madison, WI), which contains the firefly luciferase coding sequence but lacks eukaryotic promoter or enhancer elements. For construction of point mutants of the −65 to −43 and −65 to −38 regions, synthetic oligonucleotides harboring appropriate nucleotide replacements were synthesized, annealed, and ligated into theXhoI–BglII sites of the pGL2-Promoter vector (Promega), which contains the SV40 minimal promoter upstream of the luciferase coding sequence. ERSE sequences were eliminated from the GRP78 promoter by site-directed mutagenesis using the Exsite site-directed mutagenesis kit (Stratagene, La Jolla, CA), and the resultant fragments were inserted into theKpnI–XhoI sites of the pGL3-Basic vector (Promega). Similarly, a 397-bp fragment of the human GRP94 promoter (−363 to +34 region (26Chang S.C. Erwin A.E. Lee A.S. Mol. Cell. Biol. 1989; 9: 2153-2162Crossref PubMed Scopus (99) Google Scholar)), a 511-bp fragment of the human calreticulin promoter (−459 to +52 region (27McCauliffe D.P. Yang Y.S. Wilson J. Sontheimer R.D. Capra J.D. J. Biol. Chem. 1992; 267: 2557-2562Abstract Full Text PDF PubMed Google Scholar)), a 668-bp fragment of the murine ERp72 promoter (−647 to +21 region (28Srinivasan M. Lenny N. Green M. DNA Cell Biol. 1993; 12: 807-822Crossref PubMed Scopus (13) Google Scholar)), and a 1099-bp fragment of the human GRP58 promoter (−1081 to +18 region (29Koivunen P. Horelli-Kuitunen N. Helaakoski T. Karvonen P. Jaakkola M. Palotie A. Kivirikko K.I. Genomics. 1997; 42: 397-404Crossref PubMed Scopus (27) Google Scholar)) were amplified by polymerase chain reaction and cloned immediately upstream of the luciferase coding sequence. Some of them were used for the disruption experiments. DNA sequences of all constructs were confirmed by sequencing both strands for the relevant region. All plasmids used for transient transfection were purified by CsCl gradient centrifugation. Transfection was carried out by the standard calcium phosphate method (25Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). Briefly, HeLa cells were plated onto 24-well dishes at approximately 10% confluency the day before transfection. Reporter plasmid (1 μg) and reference plasmid (0.1 μg of pRL-SV40 vector, harboring SV40 enhancer and promoter just upstream ofRenilla luciferase; Promega) were mixed in 1× HEPES-buffered saline (50 mm HEPES, 280 mmNaCl, 1.5 mm Na2HPO4, pH 7.08) containing 250 mm CaCl2 to form CaPO4-DNA complex at room temperature. Cells were incubated with CaPO4-DNA complex for 16 h at 37 °C, washed with phosphate-buffered saline three times, and further incubated in fresh medium. After 48 h, cells were lysed in 100 μl of Passive Lysis Buffer (Promega). For induction of UPR, cells were treated with 2 μg/ml tunicamycin (TM) unless otherwise indicated for 16 h prior to harvesting. Firefly luciferase and Renilla luciferase activities were measured with 5 μl of cell lysate using the Dual-Luciferase Reporter Assay System (Promega). A Luminoskan luminometer (Labsystems, Helsinki, Finland) was used at a linear range. "Relative activity" is defined as the ratio of firefly luciferase activity to Renilla luciferase activity and was calculated by simply dividing luminescence intensity obtained with the assay for firefly luciferase by that for Renilla luciferase. "-Fold induction" is defined as the ratio of induced to basal levels of reporter activity and was calculated by dividing average value of relative activity in lysate of ER-stressed cells by that of unstressed cells (each value determined from at least four independent transfections). The reporter plasmid for one-hybrid screening was constructed essentially according to our previous report (10Mori K. Kawahara T. Yoshida H. Yanagi H. Yura T. Genes Cells. 1996; 1: 803-817Crossref PubMed Scopus (301) Google Scholar), and its structure is schematically depicted in Fig. 7 A. Briefly, six tandem repeats of the ERSE1 sequence from the human GRP78 promoter (CCTTCACCAATCGGCGGCCTCCACGACGG) were placed upstream of the IRE1 promoter, driving expression of the yeast HIS3 gene, while mutant ERSE repeats (CCTTCAgactaCGGCGGCCTgatgtACGG) were inserted upstream of theIRE1 promoter-Escherichia coli lacZ fusion gene (Fig. 7 A). The reporter plasmid harboring these two reporter genes was linearized at the NcoI site present in theURA3 gene and integrated into the ura3–52 locus of yeast strain KMY1015 (MATα leu2–3, 112 ura3–52 his3-Δ200 trp1-Δ901 lys2–801 ire1Δ::TRP1; Ref. 10Mori K. Kawahara T. Yoshida H. Yanagi H. Yura T. Genes Cells. 1996; 1: 803-817Crossref PubMed Scopus (301) Google Scholar) at one copy. The ire1Δ strain was used as the host to eliminate unexpected activation of the UPR pathway. The resultant reporter strain (KMY1015-ERSE) was unable to grow in the absence of histidine and expressed low β-galactosidase activity due to low basal activity of the IRE1 promoter. A human lymphocyte cDNA library constructed in a multicopy plasmid vector carrying the activation domain of yeast transcriptional activator Gal4p (GAL4AD) immediately upstream of the cDNA cloning site (30Durfee T. Becherer K. Chen P.L. Yeh S.H. Yang Y. Kilburn A.E. Lee W.H. Elledge S.J. Genes Dev. 1993; 7: 555-569Crossref PubMed Scopus (1295) Google Scholar) was kindly provided by S. J. Elledge (Baylor College of Medicine) through N. Hayashi (Kanazawa University). When fused with GAL4AD, putative ERSE-binding proteins were expected to activate transcription of HIS3constitutively through their binding to ERSE. From approximately 4.3 million transformants, we obtained eight clones that showed strong His+ phenotype. Among these, clones expressing high levels of β-galactosidase despite the absence of functional ERSE in the upstream region were discarded. We thus obtained two clones, clones 3 and 7, that enhanced transcription of a reporter gene in an ERSE-dependent manner. A portion of the 5′ region of ATF6 mRNA thought to be lacking in clone 3 was isolated by the rapid amplification of cDNA ends method (5′-RACE System; Life Technologies, Inc.) using HeLa cell RNA. The entire ATF6 cDNA thus obtained was 2509 bp long and encoded a protein of 670 amino acids (GenBankTM accession number AB015856). The predicted amino acid sequence differed from that reported by Zhu et al. (31Zhu C. Johansen F.E. Prywes R. Mol. Cell. Biol. 1997; 17: 4957-4966Crossref PubMed Scopus (138) Google Scholar) by 4 residues, possibly reflecting an allelic polymorphism. The full-length cDNAs of CREB-RP and G13 (a CREB-RP isoform) were cloned by polymerase chain reaction from HeLa cell RNA based on the published sequences (32Min J. Shukla H. Kozono H. Bronson S.K. Weissman S.M. Chaplin D.D. Genomics. 1995; 30: 149-156Crossref PubMed Scopus (23) Google Scholar, 33Khanna A. Campbell R.D. Biochem. J. 1996; 319: 81-89Crossref PubMed Scopus (15) Google Scholar). An effector plasmid to express ATF6 or CREB-RP was constructed by inserting the full-length cDNA into theHindIII–XhoI orBamHI–EcoRI sites of the pcDNA3.1(+) vector (Invitrogen, Carlsbad, CA), just downstream of the CMV promoter, respectively. Northern blotting was carried out according to the standard procedure (25Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). 10 μg of poly(A)+ RNA prepared from HeLa cells using oligo(dT) magnetic beads (Dynabead; Dynal, Oslo, Norway) were subjected to 1% agarose gel electrophoresis containing 2.2 m formaldehyde, transferred to a nylon membrane, and hybridized with radiolabeled cDNA probe specific to either ATF6 or GAPDH. We prepared two types of antisera against ATF6, anti-B03N and anti-ATF6 (21Li W.W. Hsiung Y. Zhou Y. Roy B. Lee A.S. Mol. Cell. Biol. 1997; 17: 54-60Crossref PubMed Scopus (82) Google Scholar, 22Li W.W. Hsiung Y. Wong V. Galvin K. Zhou Y. Shi Y. Lee A.S. Mol. Cell. Biol. 1997; 17: 61-68Crossref PubMed Scopus (68) Google Scholar, 23Roy B. Lee A.S. Mol. Cell. Biol. 1995; 15: 2263-2274Crossref PubMed Scopus (86) Google Scholar, 24Roy B. Li W.W. Lee A.S. J. Biol. Chem. 1996; 271: 28995-29002Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar, 25Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar, 26Chang S.C. Erwin A.E. Lee A.S. Mol. Cell. Biol. 1989; 9: 2153-2162Crossref PubMed Scopus (99) Google Scholar, 27McCauliffe D.P. Yang Y.S. Wilson J. Sontheimer R.D. Capra J.D. J. Biol. Chem. 1992; 267: 2557-2562Abstract Full Text PDF PubMed Google Scholar, 28Srinivasan M. Lenny N. Green M. DNA Cell Biol. 1993; 12: 807-822Crossref PubMed Scopus (13) Google Scholar, 29Koivunen P. Horelli-Kuitunen N. Helaakoski T. Karvonen P. Jaakkola M. Palotie A. Kivirikko K.I. Genomics. 1997; 42: 397-404Crossref PubMed Scopus (27) Google Scholar, 30Durfee T. Becherer K. Chen P.L. Yeh S.H. Yang Y. Kilburn A.E. Lee W.H. Elledge S.J. Genes Dev. 1993; 7: 555-569Crossref PubMed Scopus (1295) Google Scholar, 31Zhu C. Johansen F.E. Prywes R. Mol. Cell. Biol. 1997; 17: 4957-4966Crossref PubMed Scopus (138) Google Scholar, 32Min J. Shukla H. Kozono H. Bronson S.K. Weissman S.M. Chaplin D.D. Genomics. 1995; 30: 149-156Crossref PubMed Scopus (23) Google Scholar, 33Khanna A. Campbell R.D. Biochem. J. 1996; 319: 81-89Crossref PubMed Scopus (15) Google Scholar, 34Elbein A.D. Trends Biochem. Sci. 1981; 6: 219-221Abstract Full Text PDF Scopus (166) Google Scholar). Anti-B03N antiserum was raised by immunizing a fusion protein ofE. coli maltose-binding protein with a N-terminal portion of ATF6 (residues 6–307), which had been expressed and purified fromE. coli cells. Anti-ATF6 (21Li W.W. Hsiung Y. Zhou Y. Roy B. Lee A.S. Mol. Cell. Biol. 1997; 17: 54-60Crossref PubMed Scopus (82) Google Scholar, 22Li W.W. Hsiung Y. Wong V. Galvin K. Zhou Y. Shi Y. Lee A.S. Mol. Cell. Biol. 1997; 17: 61-68Crossref PubMed Scopus (68) Google Scholar, 23Roy B. Lee A.S. Mol. Cell. Biol. 1995; 15: 2263-2274Crossref PubMed Scopus (86) Google Scholar, 24Roy B. Li W.W. Lee A.S. J. Biol. Chem. 1996; 271: 28995-29002Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar, 25Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar, 26Chang S.C. Erwin A.E. Lee A.S. Mol. Cell. Biol. 1989; 9: 2153-2162Crossref PubMed Scopus (99) Google Scholar, 27McCauliffe D.P. Yang Y.S. Wilson J. Sontheimer R.D. Capra J.D. J. Biol. Chem. 1992; 267: 2557-2562Abstract Full Text PDF PubMed Google Scholar, 28Srinivasan M. Lenny N. Green M. DNA Cell Biol. 1993; 12: 807-822Crossref PubMed Scopus (13) Google Scholar, 29Koivunen P. Horelli-Kuitunen N. Helaakoski T. Karvonen P. Jaakkola M. Palotie A. Kivirikko K.I. Genomics. 1997; 42: 397-404Crossref PubMed Scopus (27) Google Scholar, 30Durfee T. Becherer K. Chen P.L. Yeh S.H. Yang Y. Kilburn A.E. Lee W.H. Elledge S.J. Genes Dev. 1993; 7: 555-569Crossref PubMed Scopus (1295) Google Scholar, 31Zhu C. Johansen F.E. Prywes R. Mol. Cell. Biol. 1997; 17: 4957-4966Crossref PubMed Scopus (138) Google Scholar, 32Min J. Shukla H. Kozono H. Bronson S.K. Weissman S.M. Chaplin D.D. Genomics. 1995; 30: 149-156Crossref PubMed Scopus (23) Google Scholar, 33Khanna A. Campbell R.D. Biochem. J. 1996; 319: 81-89Crossref PubMed Scopus (15) Google Scholar, 34Elbein A.D. Trends Biochem. Sci. 1981; 6: 219-221Abstract Full Text PDF Scopus (166) Google Scholar) antiserum was raised against a keyhole-limpet hemocyanin-conjugated synthetic polypeptide of 14 amino acids, which corresponded to residues 21–34 of ATF6. Anti-GRP78 and anti-HSP70 antisera were obtained from Stressgen Biotechnologies Corp. (Victoria, Canada). In vitro translation of ATF6 was carried out using ATF6 cDNA and TNT T7 quick coupled transcription/translation system (Promega). Whole cell extracts were prepared by lysing 1 × 106 HeLa cells with 60 μl of 1× sample buffer (62.5 mm Tris/HCl (pH 6.8), 25% glycerol, 2% SDS, 350 mm dithiothreitol, and 0.01% bromphenol blue). Lysates were boiled, and portions (2 μl) were subjected to SDS-polyacrylamide gel electrophoresis using 10% gel, transferred onto a Hybond ECL filter (Amersham Pharmacia Biotech), and reacted with various antisera, according to the standard protocol (25Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). Prestained SDS-PAGE standards (Bio-Rad) were used as size markers. The ECL Western blotting detection kit (Amersham Pharmacia Biotech) was used to detect each antigen. It has been noted that the ER stress-responsive promoters of mammalian GRP genes contain multiple CCAAT motifs (26Chang S.C. Erwin A.E. Lee A.S. Mol. Cell. Biol. 1989; 9: 2153-2162Crossref PubMed Scopus (99) Google Scholar, 27McCauliffe D.P. Yang Y.S. Wilson J. Sontheimer R.D. Capra J.D. J. Biol. Chem. 1992; 267: 2557-2562Abstract Full Text PDF PubMed Google Scholar, 28Srinivasan M. Lenny N. Green M. DNA Cell Biol. 1993; 12: 807-822Crossref PubMed Scopus (13) Google Scholar). Aligning these CCAAT and neighboring sequences, we noticed that a structural motif of CCAAT-9 nucleotides-CCACG is present in promoters of GRP78, GRP94, and calreticulin (Fig. 2 A) and that promoters of all GRPs examined except for FKBP13 contain multiple copies of similar motifs (Fig. 2, B and C). Moreover, both CORE and C1 regions defined previously in the GRP78 promoter (17Resendez Jr., E. Wooden S.K. Lee A.S. Mol. Cell. Biol. 1988; 8: 4579-4584Crossref PubMed Scopus (64) Google Scholar, 19Wooden S.K. Li L.J. Navarro D. Qadri I. Pereira L. Lee A.S. Mol. Cell. Biol. 1991; 11: 5612-5623Crossref PubMed Scopus (128) Google Scholar) actually contain this motif (Fig. 1). Interestingly, the mammalian GRP78 promoters consist of three consecutive reiterated sequences, each of which contains this motif (Fig. 2 D), possibly resulting from duplication during evolution. These findings taken together suggested that the above motifs are specifically involved in mammalian UPR. We designated this motif the ERSE, since it is structurally distinct from the UPRE responsible for yeast UPR (6Mori K. Sant A. Kohno K. Normington K. Gething M.J. Sambrook J.F. EMBO J. 1992; 11: 2583-2593Crossref PubMed Scopus (308) Google Scholar, 10Mori K. Kawahara T. Yoshida H. Yanagi H. Yura T. Genes Cells. 1996; 1: 803-817Crossref PubMed Scopus (301) Google Scholar). To examine whether the ERSE motif is critical for induction of GRP78, GRP94, and calreticulin, each of the promoters was ligated to the reporter gene (firefly luciferase) and transfected into HeLa cells as described under "Experimental Procedures." We used TM, an inhibitor of proteinN-glycosylation (2Lee A.S. Trends Biochem. Sci. 1987; 12: 20-23Abstract Full Text PDF Scopus (390) Google Scholar, 3Kozutsumi Y. Segal M. Normington K. Gething M.J. Sambrook J. Nature. 1988; 332: 462-464Crossref PubMed Scopus (963) Google Scholar, 34Elbein A.D. Trends Biochem. Sci. 1981; 6: 219-221Abstract Full Text PDF Scopus (166) Google Scholar), to induce UPR. As expected, the intact GRP78 promoter enhanced luciferase expression by 5-fold in TM-treated cells (Fig. 3, line 2, closed bar) over the control (line 2, open bar). The extent of induction was comparable with those observed in previous studies (5–7-fold) (18Ting J. Lee A.S. DNA. 1988; 7: 275-286Crossref PubMed Scopus (183) Google Scholar, 19Wooden S.K. Li L.J. Navarro D. Qadri I. Pereira L. Lee A.S. Mol. Cell. Biol. 1991; 11: 5612-5623Crossref PubMed Scopus (128) Google Scholar), and that of endogenous GRP78 protein level (5–8-fold; see Fig. 11 C). The intact GRP94 and calreticulin promoters enhanced reporter expression upon TM treatment by 8- and 4-fold, respectively (lines 8 and12), which was also consistent with the previous reports (35Ramakrishnan M. Tugizov S. Pereira L. Lee A.S. DNA Cell Biol. 1995; 14: 373-384Crossref PubMed Scopus (44) Google Scholar, 36Waser M. Mesaeli N. Spencer C. Michalak M. J. Cell Biol. 1997; 138: 547-557Crossref PubMed Scopus (119) Google Scholar).Figure 11Regulation of ATF6 by ER stress. A, Northern blot hybridization analysis of ATF6 mRNA. HeLa cells were treated with 2 μg/ml TM for the indicated period. Poly(A)+ RNA was extracted and analyzed as described under "Experimental Procedures" using a probe specific to ATF6 or GAPDH.B, immunoblotting analysis of ATF6 protein. In vitro translation was carried out using reticulocyte lysate with a control vector (lane 1) or ATF6 cDNA (lane 2). Whole cell extracts were prepared from HeLa cells that had been untreated (lanes 3 and5) or treated with 2 μg/ml TM for 4 h (lanes 4 and 6) or that had been transfected with a control vector (lane 7) or an ATF6 expression plasmid (lane 8). Proteins were analyzed as described under "Experimental Procedures" using anti-B03N antiserum (lanes 1–4, 7, and 8) or anti-peptide (anti-ATF6 (21Li W.W. Hsiung Y. Zhou Y. Roy B. Lee A.S. Mol. Cell. Biol. 1997; 17: 54-60Crossref PubMed Scopus (82) Google Scholar, 22Li W.W. Hsiung Y. Wong V. Galvin K. Zhou Y. Shi Y. Lee A.S. Mol. Cell. Biol. 1997; 17: 61-68Crossref PubMed Scopus (68) Google Scholar, 23Roy B. Lee A.S. Mol. Cell. Biol. 1995; 15: 2263-2274Crossref PubMed Scopus (86) Google Scholar, 24Roy B. Li W.W. Lee A.S. J. Biol. Chem. 1996; 271: 28995-29002Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar, 25Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar, 26Chang S.C. Erwin A.E. Lee A.S. Mol. Cell. Biol. 1989; 9: 2153-2162Crossref PubMed Scopus (99) Google Scholar, 27McCauliffe D.P. Yang Y.S. Wilson J. Sontheimer R.D. Capra J.D. J. Biol. Chem. 1992; 267: 2557-2562Abstract Full Text PDF PubMed Google Scholar, 28Srinivasan M. Lenny N. Green M. DNA Cell Biol. 1993; 12: 807-822Crossref PubMed Scopus (13) Google Scholar, 29Koivunen P. Horelli-Kuitunen N. Helaakoski T. Karvonen P. Jaakkola M. Palotie A. Kivirikko K.I. Genomics. 1997; 42: 397-404Crossref PubMed Scopus (27) Google Scholar, 30Durfee T. Becherer K. Chen P.L. Yeh S.H. Yang Y. Kilburn A.E. Lee W.H. Elledge S.J. Genes Dev. 1993; 7: 555-569Crossref PubMed Scopus (1295) Google Scholar, 31Zhu C. Johansen F.E. Prywes R. Mol. Cell. Biol. 1997; 17: 4957-4966Crossref PubMed Scopus (138) Google Scholar, 32Min J. Shukla H. Kozono H. Bronson S.K. Weissman S.M. Chaplin D.D. Genomics. 1995; 30: 149-156Crossref PubMed Scopus (23) Google Scholar, 33Khanna A. Campbell R.D. Biochem. J. 1996; 319: 81-89Crossref PubMed Scopus (15) Google Scholar, 34Elbein A.D. Trends Biochem. Sci. 1981; 6: 219-221Abstract Full Text PDF Scopus (166) Google Scholar)) antiserum (lanes 5 and 6). The positions of the 90-kDa band (p90ATF6) and 50-kDa band (p50ATF6) are indicated by theopen and closed arrowheads, respectively. C, correlation of the appearance of p50ATF6 with the cellular UPR activity. HeLa cells were treated with 2 μg/ml TM, 7 μm A23187, or 300 nm thapsigargin (Tg) for the indicated period. Alternatively, HeLa cells were heat-shocked at 43 °C for 1 h and then recovered at 37 °C for the indicated period. Whole cel
Referência(s)