Nog2p, a putative GTPase associated with pre-60S subunits and required for late 60S maturation steps
2001; Springer Nature; Volume: 20; Issue: 22 Linguagem: Inglês
10.1093/emboj/20.22.6475
ISSN1460-2075
AutoresCosmin Saveanu, David Bienvenu, Abdelkader Namane, Pierre‐Emmanuel Gleizes, Nicole Gas, Alain Jacquier, Micheline Fromont‐Racine,
Tópico(s)Genomics and Chromatin Dynamics
ResumoArticle15 November 2001free access Nog2p, a putative GTPase associated with pre-60S subunits and required for late 60S maturation steps Cosmin Saveanu Cosmin Saveanu Génétique des Interactions Macromoléculaires, Institut Pasteur (CNRS-URA2171), 25–28 rue du Dr Roux, 75724 Paris, Cedex 15 Search for more papers by this author David Bienvenu David Bienvenu Génétique des Interactions Macromoléculaires, Institut Pasteur (CNRS-URA2171), 25–28 rue du Dr Roux, 75724 Paris, Cedex 15 Search for more papers by this author Abdelkader Namane Abdelkader Namane PT 'Proteomique', Institut Pasteur (CNRS-URA2185), 25–28 rue du Dr Roux, 75724 Paris, Cedex 15 Search for more papers by this author Pierre-Emmanuel Gleizes Pierre-Emmanuel Gleizes Laboratoire de Biologie Moléculaire Eucaryote (LBME-CNRS), 118 route de Narbonne, 31062 Toulouse, Cedex, France Search for more papers by this author Nicole Gas Nicole Gas Laboratoire de Biologie Moléculaire Eucaryote (LBME-CNRS), 118 route de Narbonne, 31062 Toulouse, Cedex, France Search for more papers by this author Alain Jacquier Alain Jacquier Génétique des Interactions Macromoléculaires, Institut Pasteur (CNRS-URA2171), 25–28 rue du Dr Roux, 75724 Paris, Cedex 15 Search for more papers by this author Micheline Fromont-Racine Corresponding Author Micheline Fromont-Racine Génétique des Interactions Macromoléculaires, Institut Pasteur (CNRS-URA2171), 25–28 rue du Dr Roux, 75724 Paris, Cedex 15 Search for more papers by this author Cosmin Saveanu Cosmin Saveanu Génétique des Interactions Macromoléculaires, Institut Pasteur (CNRS-URA2171), 25–28 rue du Dr Roux, 75724 Paris, Cedex 15 Search for more papers by this author David Bienvenu David Bienvenu Génétique des Interactions Macromoléculaires, Institut Pasteur (CNRS-URA2171), 25–28 rue du Dr Roux, 75724 Paris, Cedex 15 Search for more papers by this author Abdelkader Namane Abdelkader Namane PT 'Proteomique', Institut Pasteur (CNRS-URA2185), 25–28 rue du Dr Roux, 75724 Paris, Cedex 15 Search for more papers by this author Pierre-Emmanuel Gleizes Pierre-Emmanuel Gleizes Laboratoire de Biologie Moléculaire Eucaryote (LBME-CNRS), 118 route de Narbonne, 31062 Toulouse, Cedex, France Search for more papers by this author Nicole Gas Nicole Gas Laboratoire de Biologie Moléculaire Eucaryote (LBME-CNRS), 118 route de Narbonne, 31062 Toulouse, Cedex, France Search for more papers by this author Alain Jacquier Alain Jacquier Génétique des Interactions Macromoléculaires, Institut Pasteur (CNRS-URA2171), 25–28 rue du Dr Roux, 75724 Paris, Cedex 15 Search for more papers by this author Micheline Fromont-Racine Corresponding Author Micheline Fromont-Racine Génétique des Interactions Macromoléculaires, Institut Pasteur (CNRS-URA2171), 25–28 rue du Dr Roux, 75724 Paris, Cedex 15 Search for more papers by this author Author Information Cosmin Saveanu1, David Bienvenu1, Abdelkader Namane2, Pierre-Emmanuel Gleizes3, Nicole Gas3, Alain Jacquier1 and Micheline Fromont-Racine 1 1Génétique des Interactions Macromoléculaires, Institut Pasteur (CNRS-URA2171), 25–28 rue du Dr Roux, 75724 Paris, Cedex 15 2PT 'Proteomique', Institut Pasteur (CNRS-URA2185), 25–28 rue du Dr Roux, 75724 Paris, Cedex 15 3Laboratoire de Biologie Moléculaire Eucaryote (LBME-CNRS), 118 route de Narbonne, 31062 Toulouse, Cedex, France *Corresponding author. E-mail: [email protected] The EMBO Journal (2001)20:6475-6484https://doi.org/10.1093/emboj/20.22.6475 PDFDownload PDF of article text and main figures. ToolsAdd to favoritesDownload CitationsTrack CitationsPermissions ShareFacebookTwitterLinked InMendeleyWechatReddit Figures & Info Eukaryotic ribosome maturation depends on a set of well ordered processing steps. Here we describe the functional characterization of yeast Nog2p (Ynr053cp), a highly conserved nuclear protein. Nog2p contains a putative GTP-binding site, which is essential in vivo. Kinetic and steady-state measurements of the levels of pre-rRNAs in Nog2p-depleted cells showed a defect in 5.8S and 25S maturation and a concomitant increase in the levels of both 27SBS and 7SS precursors. We found Nog2p physically associated with large pre-60S complexes highly enriched in the 27SB and 7S rRNA precursors. These complexes contained, besides a subset of ribosomal proteins, at least two additional factors, Nog1p, another putative GTP-binding protein, and Rlp24p (Ylr009wp), which belongs to the Rpl24e family of archaeal and eukaryotic ribosomal proteins. In the absence of Nog2p, the pre-60S ribosomal complexes left the nucleolus, but were retained in the nucleoplasm. These results suggest that transient, possibly GTP-dependent association of Nog2p with the pre-ribosomes might trigger late rRNA maturation steps in ribosomal large subunit biogenesis. Introduction The yeast ribosome is a large ribonucleoprotein particle dynamically assembled during translation initiation from a small (40S) and a large (60S) subunit. The 40S particle is structured around an 18S rRNA whereas the mature 60S subunit contains the 25S, 5.8S and 5S rRNAs. Three of the four rRNAs (18S, 5.8S and 25S) are processed from a large single 35S pre-rRNA precursor transcribed by RNA polymerase I, whereas the 5S rRNA is synthesized by RNA polymerase III from another gene within the same rDNA unit. The 35S pre-rRNA includes two external transcribed sequences (5′-ETS and 3′-ETS) and two internal transcribed spacers (ITS1 and ITS2). The maturation of this precursor involves numerous processing steps, including nucleotide modification steps as well as different endo- and exonucleolytic cleavages that sequentially remove the ETS and ITS sequences. This maturation pathway is summarized in Figure 1 and has been reviewed extensively (Kressler et al., 1999b; Venema and Tollervey, 1999; Geerlings et al., 2000). Figure 1.Simplified maturation scheme for rRNA in yeast, adapted from Venema and Tollervey (1999). (A) Schematic representation of the large 35S primary pre-rRNA transcript. The relative position of the oligonucleotides used as probes in the study is also shown. (B) Processing of the 35S precursor to the mature rRNA species in yeast. Download figure Download PowerPoint In addition to early associating ribosomal proteins, endonucleases, exonucleases and putative RNA helicases, other trans-acting factors such as Nip7p, Nop8p, Nop2p, Rsa1p (see Kressler et al., 1999b and references therein), Ebp2p (Huber et al., 2000) and Rlp7p (Dunbar et al., 2000) preferentially impair the biogenesis of 60S subunits. While most of the factors involved in the biogenesis of 60S subunits are localized mainly to the nucleolus, nucleoplasmic maturation steps of pre-60S particles are likely. The late steps of rRNA processing are followed by export of the nascent ribosomal particles into the cytoplasm. The export of pre-60S particles is dependent on the abundant shuttling protein Nmd3p, which associates with the ribosomal protein Rpl10p and plays an adaptor role for the karyopherin Crm1p (Ho et al., 2000; Gadal et al., 2001). The association of Rpl10 with the ribosome might be a relatively late event in the nuclear maturation of the large ribosomal particle since depletion of the exclusively nucleoplasmic protein Rsa1p affects association of Rpl10 with 60S particles (Kressler et al., 1999a). Little information about the nature of the stable components associated with pre-ribosomal subunits, the dynamics of the assembly, the compartments where successive steps are taking place and the transport of these particles is available currently. Here we describe the analysis of the previously uncharacterized YNR053C gene, which hereafter is referred to as NOG2 (nuclear–nucleolar GTP-binding protein 2). The Nog2p protein is highly conserved and its human homologue was described previously as the nucleolar breast tumour-associated autoantigen NGP-1 (Racevskis et al., 1996). We show that Nog2p is an essential nuclear protein required for the processing of the 27S ribosomal precursor to mature 25S and 5.8S rRNAs. To explore further the role of this protein, we have purified and characterized its associated complex. In addition to components of the large ribosomal subunit, we identified new essential factors that are likely to participate in ribosomal biogenesis: Rlp24p (Ylr009wp), a conserved protein similar to archaeal and eukaryotic Rpl24e proteins; and Nog1p, a nucleolar putative GTP-binding protein conserved in eukaryotes (Park et al., 2001). Results Nog2p is an essential protein required for the maintenance of normal rRNA levels The NOG2 gene is essential for yeast viability (Fromont-Racine et al., 1997). We constructed a yeast strain (LMA148) in which the galactose-inducible promoter GAL1 replaced the endogenous NOG2 promoter. In the LMA159 strain, the protein A-containing TAP tag (Rigaut et al., 1999) was inserted in-frame at the 3′ end of the GAL1-NOG2 coding sequence (Table I). In order to deplete the Nog2p protein, the cells were shifted from galactose medium (YPGal) to glucose medium (YPGlu). We observed a severe reduction in the growth rate of the LMA148/159 strains after 10 h of culture in the presence of glucose (Figure 2A). An immunoblot, which revealed the protein A tag, confirmed that Nog2-TAP rapidly decreases and becomes undetectable in the LMA159 strain after 24 h in YPGlu (data not shown). However, by comparison with the LMA78 strain, which expressed Nog2-TAP under its own promoter (Table I), Nog2-TAP was overexpressed in the LMA159 strain in YPGal and its level remained higher than or equal to the natural level of Nog2-TAP for ∼6 h after the shift to glucose (Figure 2B). Figure 2.Depletion of Nog2p (Ynr053cp) causes growth arrest and reduction of mature rRNA levels. (A) A conditionally lethal GAL::NOG2-TAP strain (LMA159) and a wild-type strain were grown at 30°C in YPGal and shifted to YPGlu medium. Optical densities were measured at various times of culture in glucose-containing medium. (B) Analysis of the Nog2p level in LMA159 cells at different times after the shift to glucose-containing medium. Proteins were extracted from the same number of cells and loaded on an 8% polyacrylamide gel. Immunoblotting with peroxidase–anti-peroxidase-soluble complexes revealed the protein A component of the tagged Nog2p. These levels were compared with the level measured for Nog2-TAP under the control of its own promoter (LMA78 strain) (horizontal dashed line). (C) Total RNAs were purified from either LMA159 or wild-type strains after growth in YPGlu for up to 40 h. RNAs were separated on a 1% agarose–formaldehyde gel and stained with ethidium bromide. (D) The levels of 25S and 18S mature rRNAs were normalized to the amount of U2 RNA; 100% corresponds to the galactose growth conditions. Download figure Download PowerPoint Table 1. Yeast strains used in this study Strain Genotype Reference MGD353-13D MATa, trp1-289, ura3-52, ade2, leu2-3,-112, Arg4 Rigaut et al. (1999) BMA64 MATa/α, ura3-1/ura3-1,Δtrp1/Δtrp1, ade2-1/ade2-1, leu2-3,-112/leu2-3,-112, his3-11,15/his3-11,15 Baudin et al. (1993) LMA51-2 MATα, ura3-1, Δtrp1, ade2-1, leu2-3,-112, his3-11,15, Nog2-GFP::HIS this study LMA78 MATa, trp1-289, ura3-52, ade2, leu2-3,-112, Arg4, Nog2-TAP/TRP1 this study LMA148 MATa, ura3-1, Δtrp1, ade2-1, leu2-3,-112, his3-11,15, GAL::NOG2/KanMX6 this study LMA158 MATa, trp1-289, ura3-52, ade2, leu2-3,-112, Arg4, Nog1-TAP/TRP1 this study LMA159 MATa, ura3-1, Δtrp1, ade2-1, leu2-3,-112, his3-11,15, GAL::Nog2-TAP/KanMX6/TRP1 this study LMA160 MATa, trp1-289, ura3-52, ade2, leu2-3,-112, Arg4, Rlp24-TAP/TRP1 this study LMA173 MATa, trp1-289, ura3-52, ade2, leu2-3,-112, Arg4, Rpl10-TAP/TRP1 this study A severe decrease in the cellular levels of 18S and 25S rRNAs was observed from cells collected at different times after a shift to glucose (Figure 2C and D). The level of 25S rRNA was more affected than that of 18S rRNA (Figure 2D). Consistent with these findings, polysome fractionation by sucrose gradient ultracentrifugation revealed that, in Nog2p-depleted cells, the free 60S subunit level was more affected than that of the 40S subunit (Figure 3A). After 15 h of NOG2 repression, the polysome level was severely reduced, consistent with the dramatic reduction of the growth rate (Figure 2A). Altogether, these data suggested that Nog2p is involved in pre-rRNA processing and specifically affects the biogenesis of the 60S subunit. Figure 3.Nog2p-depleted cells display a decrease in the abundance of free 60S ribosomal subunits. (A) Polysome profiles were analysed for the LMA159 strain by sedimentation through 10–50% sucrose gradients. Cells were either grown on YPGal (0 h) or shifted to glucose for 8.5 or 15 h. (B) Cellular proteins were extracted from various fractions of the sucrose gradient and analysed by immunoblotting using antibodies that revealed specifically either the Rpl1p (1:20 000 dilution) (Petitjean et al., 1995) or the Nog2-TAP proteins (peroxidase–anti-peroxidase 1:10 000 dilution). Download figure Download PowerPoint 27S rRNA processing is affected in Nog2p-depleted cells To identify the pre-rRNA processing steps at which Nog2p is involved, we first studied the kinetics of rRNA maturation using L-[methyl-3H]methionine pulse–chase labelling in vivo. In galactose medium, the 35S precursor was processed into 27S and 20S intermediate species in 12 min after the chase. We also detected an aberrant 23S form. In contrast, the time course of conversion of the 20S into 18S rRNAs was not affected. Moreover, the accumulation of the 18S rRNA was only modestly inhibited by comparison with the appearance of the 25S rRNA, which was very much delayed. These early step effects are commonly observed for mutations impaired primarily in late steps of 5.8S/25S synthesis, and it has been proposed that they result from a feedback mechanism exerted on early processing steps at A0–A2 (Venema and Tollervey, 1999). Nog2p thus seems to be involved primarily in the processing of the 27S rRNA intermediate to 25S rRNA. Figure 4.Nog2p depletion leads to reduced synthesis of 25S rRNA. Pulse–chase labelling with [methyl-3H]methionine was performed with the LMA159 strain (GAL::NOG2) grown in galactose medium (NOG2 induced) or shifted to glucose medium (NOG2 repressed) for 16 h. Cells were pulse-labelled for 2 min and then chased for the indicated times with an excess of cold methionine. Total labelled RNAs were purified, separated on a denaturing agarose gel and autoradiographed. The position of the intermediate and mature rRNAs is indicated. Download figure Download PowerPoint The 27S species consist of several distinct intermediates (see Figure 1). The 27SA2 intermediate that results from cleavage of the 32S molecule at site A2 may follow two distinct routes to generate the mature 5.8S and 25S products. The minor pathway generates the 27SBL intermediate, while, in the major pathway, the 27SA2 molecule is first cleaved by the RNase MRP at site A3 and then trimmed by Rat1 to generate the 27SBS RNA. This results in the minor pathway giving rise to the 5.8SL mature RNA, while the major pathway produces the 5.8SS transcript, which represents 85% of the mature 5.8S molecules (Henry et al., 1994). To pinpoint the precise steps at which Nog2p is involved, we analysed the steady-state levels of each pre-rRNA intermediate and mature rRNA by northern blotting and primer extension experiments using a set of specific oligonucleotide probes (Table II; the locations of the primers are shown in Figure 1). The main results are summarized in Figure 5. When Nog2p was depleted, we observed an accumulation of the 27SBS intermediate, whereas the level of the 27SA2 intermediate remained constant. We also noted that the level of the 27SBL intermediate-specific product (6–8 nucleotides longer than 27SBS) remained essentially unchanged (Figure 5A). We observed a similar accumulation of the reverse transcription products whose 5′ ends correspond to the BS site both with primer CS8, which hybridizes within the 25S mature sequence region (see Figure 1), and with primer CS3, which hybridizes within the 7S intermediate region (data not shown). Figure 5B shows that the 7SS intermediate accumulated in mutant cells shifted to glucose, whereas the level of the 7SL intermediate remained unchanged. In contrast, northern blot analysis revealed that the 5.8SS and 5.8SL levels were equally affected upon NOG2 repression (Figure 5C). The only additional major effects observed upon Nog2p depletion were the accumulation of the 35S species and the appearance of the 23S species (Figure 4 and data not shown). Figure 5.Absence of Nog2p leads to an accumulation of the 27SBS and 7SS pre-rRNA. Total RNAs were extracted from the LMA159 strain after growth in YPGal or after shift to YPGlu for various times, as indicated. (A) Primer extensions were performed using primer CS10 (specific for the different 27S forms). The reaction products were resolved on a 5% acrylamide denaturing gel. (B) Northern blot analysis of 7S rRNA levels. The RNAs were separated on a 5% acrylamide denaturing gel, transferred to a nylon membrane and probed with oligonucleotide CS3, which hybridizes within the 7S region. (C) Quantification of the hybridization signals for the 5.8SS and 5.8SL mature rRNAs. The levels were normalized to the hybridization signals obtained with a U3 RNA-specific probe; 100% corresponds to the galactose-induced conditions. Download figure Download PowerPoint Table 2. Oligonucleotides used in this study Probe name Sequence CS1 TCGGGTCTCTCTGCTGC CS2 CGGTTTTAATTGTCCTA CS3 GGCCAGCAATTTCAAGTTA CS4 AATGATCCTTCCGCAGGTTCAC CS5 CGGAATTCTGCAATTCACATTACG CS6 ACGAGCCTCCACCAGAGTTTCC CS7 CCAGTTACGAAAATTCTTG CS8 CTCCGCTTATTGATATGC CS10 CGCCTAGACGCTCTCTTCTTA CS15 TGTTACCTCTGGGCCC MFR398-5′ GGTCAATCCAAACGTATTTGGAACG MFR399-3′ TCTCGTCTCGATAGCCGATAAACCCTACA MFR400-5′ TCTCGTCTCGCTATGTAAACACTGGTAAATCGTCC MFR402-3′ TCTCGTCTCATTTACCAGTGTTTGGATAGCC MFR403-5′ TCTCGTCTCGTAAAAATTCCATCATTAACACATTGAG MFR407-3′ TCCATCCTGAGATCTCGTAAGTTC Mutated bases are indicated in bold. We concluded that Nog2p is implicated both in the 27SB to 7S and the 7S to 5.8S processing steps (see Figure 1). More specifically, we observed that only the short forms of the 27SB and 7S intermediates accumulated. This might indicate that Nog2p is only involved in the major pathway. However, the 5.8SS and 5.8SL levels were equally affected upon NOG2 repression (see Discussion). Nog2p is associated with pre-60S particles The presence of Nog2-TAP and large subunit ribosomal protein Rpl1p/Ssm1p was examined in the different fractions of sucrose gradients by immunoblotting (Figure 3B). Nog2-TAP was found associated with a complex that had a sedimentation rate similar to that of the 60S particles. As expected, the ribosomal Rpl1p protein, used as a control, co-sedimented with the 60S subunits, 80S ribosomes and the polysomes. We noted that after 15 h of NOG2 repression, Nog2-TAP was still detectable in the gradient around the 60S position even if the total amount of the protein was reduced dramatically (Figure 2B). This was correlated with the presence at the top of the gradient of some free Rpl1p, suggesting that some of the ribosomal proteins became unbound. The detection of Nog2p around the position of the 60S subunit was consistent with this protein being part of a 66S pre-ribosomal subunit, a nuclear precursor of mature 60S particles (Trapman et al., 1975). In order to purify and characterize this complex, we used the LMA78 strain in which a TAP tag was introduced in-frame at the 3′ end of NOG2 under the control of its own promoter (see above and Table I). We purified this TAP-tagged version of Nog2p under native conditions by two successive affinity purification steps according to Rigaut et al. (1999). Figure 6 shows that Nog2p co-purified with a large complex, ∼30 bands being visible after Coomassie Blue staining. Since Nog2p co-sedimented with the large ribosomal subunit in ultracentrifugation experiments, we compared the profile of the complex purified with Nog2-TAP with the protein profile of the purified large and small ribosomal subunits (Figure 6A). The protein profile of the TAP-purified complex revealed extensive similarities with the profile of the large ribosomal subunit. Individual bands were analysed by mass spectrometry and the corresponding proteins identified (Figure 6A). As expected, this analysis revealed that the Nog2p-associated complex contained a number of large ribosomal subunit proteins. In addition, two novel proteins, Nog1p and Ylr009wp, were also identified. Nog1p, like Nog2p, harbours a GTP-binding site motif (see Discussion), has been shown previously to be essential for yeast viability and has a nucleolar localization (Park et al., 2001). An essential uncharacterized gene, YLR009W, encodes the second novel protein. Because of its strong similarity to both the yeast cytoplasmic and the archaeal/eukaryotic Rpl24e ribosomal proteins (see Discussion), we now refer to this protein as Rlp24p (ribosomal-like protein 24). Figure 6.Nog2p, Nog1p and Rlp24p are associated with similar pre-ribosomal complexes. (A) The protein composition of the affinity-purified Nog2p-associated complex (lane Nog2-TAP) was determined after electrophoresis on a gradient gel and Coomassie Blue staining. Proteins were identified using mass spectrometry and the pattern of protein bands was compared with the pattern of bands obtained with purified large (lane 60S) and small (lane 40S) ribosomal subunits. The tagged protein is marked Nog2T; a presumed Nog2p fragment is marked with *; a fragment of Rpl10p protein is marked Rpl10*. (B) Protein composition of the complexes obtained by tandem affinity purification using tagged versions of Nog1p (Nog1-TAP) and Rlp24p (Rlp24-TAP). Both Nog1p and Rlp24p were identified by mass spectrometry as components of the Rlp24p- and Nog1p-associated complexes, respectively. The tagged versions of the proteins are marked Nog1T and Rlp24T. For comparison, the proteins of the large ribosomal subunit were separated on the same gel (lane 60S). (C) Dot-blot quantitation of the different precursors of rRNAs in the Nog2p-associated complex. The RNAs were extracted from the purified complex, heat denatured, spotted on Hybond N+ membranes and probed with radiolabelled oligonucleotides specific for different rRNA precursors. The signal was quantified on a PhosphorImager system. The ratio of the signal obtained with the purified RNAs over the signal obtained with the total RNAs was calculated; these values were normalized by arbitrarily taking the ratio obtained with the 18S RNA probe (CS4) as a reference (equal to one on the figure). (D) Northern blot hybridization after polyacrylamide gel electrophoresis of total RNAs and RNAs purified in one step using TAP-tagged versions of Nog2p or ribosomal protein Rpl10-TAP used as a control. Radiolabelled oligonucleotide CS5, complementary to a region of the 5.8S mature rRNA, was used to probe the membrane. The positions of 5.8S and 7S RNAs are indicated. The enrichment for the 7S species in the Nog2p-associated RNAs can be observed by comparison with total RNAs or RNAs associated with Rpl10-TAP. Download figure Download PowerPoint To confirm that Nog2p, Nog1p and Rlp24p were part of the same complex, additional purifications were performed with both the Nog1-TAP and Rlp24-TAP tagged proteins. To this end, we constructed the LMA158 and LMA160 strains expressing Nog1-TAP and Rlp24-TAP under the control of their own promoters, respectively (Table I). The protein profiles of the three TAP-purified complexes were highly similar (see Figure 6B), with the exception of the bands that corresponded to the tagged versions of the proteins and which were identified by mass spectrometry. Their apparent mass was 5 kDa larger than that of the wild-type versions as a result of the remaining calmodulin-binding tag. We were able to identify both Nog1p and Rlp24p in the three complexes, whereas Nog2p was not detected in the Nog1p- and Rlp24-TAP-associated complexes (see Discussion). In addition, we observed that two ribosomal proteins, Rpl12p and Rpp0p, were absent from the three purified complexes (see Figure 6A and B). These results were consistent with other experiments showing that the Nog2p-associated complexes are confined to the nucleus (see Discussion). To analyse the transcripts present within the Nog2p-associated complex, successive hybridizations were performed with various probes on RNAs extracted from complexes purified independently twice (experiments 1 and 2). We observed a strong hybridization signal with the CS3 and CS10 probes. Since other probes (CS2 and CS7) hybridizing to 35S, 33S, 32S, 27SA2 and 27SA3 revealed no enrichment for these species, we concluded that the signal generated by probe CS10 results from an enrichment of 27SB forms (50- to 150-fold relative to 18S; see Figure 6C). Likewise, probe CS3 revealed a 380- to 480-fold enrichment over 18S for the 27SB plus 7S intermediates, hence an enrichment of >200-fold for 7S if the contribution of 27SB (as estimated with probe CS10) is subtracted. The high enrichment of the 7S RNA species was confirmed by northern blotting of RNAs co-purified with Nog2-TAP (see Figure 6D). A significant enrichment was also observed with probes CS5 and CS6-8, which hybridize within the 5.8S and 25S sequences, respectively. These probes also hybridize to rRNA intermediates, but the contribution of these transcripts to the observed signal can be neglected, as they are ∼500 times less abundant than the 25S mature transcripts. We thus concluded that the purified fractions contained significant amounts of mature 5.8S and 25S, which correspond to the products of the two reaction steps inhibited in the Nog2p-depleted cells. The same analyses performed on the RNAs present in the Nog1p- and Rlp24p-associated complexes revealed that these particles were also strongly enriched for the 27S and 7S intermediates (data not shown). In summary, Nog2p was found as part of large complexes involved in late steps of rRNA maturation that contain, in addition to nuclear associated 60S ribosomal proteins, two novel proteins, Nog1p and Rlp24p, as well as 27SB, 7S, 25S and 5.8S rRNAs. Nog2p is localized to the nucleolus and the nucleoplasm Most of the proteins involved in pre-rRNA processing are localized in the nucleolus. To obtain insight into the subcellular localization of Nog2p, we generated a strain where the sequence encoding the green fluorescent protein (GFP) was fused at the 3′ end of NOG2 on the chromosome (LMA51-2) (see Table I). We observed that Nog2–GFP was located to the nucleolus and to the nucleoplasm (Figure 7) while no cytoplasmic signal was detected. The subcellular localization of Nog2p is fully consistent with a role in pre-rRNA processing and ribosome biogenesis. Figure 7.Nog2p is located in the nucleolus and nucleoplasm. The LMA51-2 strain, containing the Nog2–GFP fusion under the control of its own promoter, was grown in SD-His medium. Cells were stained with Hoechst 33342 and photographed with filters specific for GFP fluorescence (A), Hoechst (B) or Nomarski (D). A merged image of (A) and (B) is shown in (C). Download figure Download PowerPoint Depletion of Nog2p results in the nuclear retention of pre-60S particles We next examined the effect of Nog2p depletion on the localization of the pre-60S ribosomal particles in situ. BMA64 (wild type) and LMA148 (GAL::NOG2) cells were first transformed with a plasmid encoding Rpl25p, a protein of the large ribosomal subunit, fused to GFP. This chimeric protein binds to pre-rRNA and allows monitoring of the localization of pre-60S and 60S particles by fluorescence microscopy (Hurt et al., 1999). As shown in Figure 8A, Rpl25–GFP was detected primarily in the cytoplasm of wild-type cells. In contrast, Rpl25–GFP was found to accumulate in the whole nucleus of GAL::NOG2 cells depleted of Nog2p after 16 h of shift to glucose. To refine these data, we directly localized pre-rRNA by in situ hybridization and electron microscopy (Figure 8B). As expected, in wild-type cells, a probe hybridizing to the 25S rRNA sequence labelled the nucleolus, the main site of ribosome biogenesis, and the cytoplasm, where ribosomes ensure translation. A lower signal was also observed in the nucleoplasm. In contrast, the whole nucleus of Nog2p-depleted GAL::NOG2 cells was found to be labelled with this probe, indicating the nuclear accumulation of pre-25S rRNA. In these cells, the nucleolus appeared to be dilated and loose. In addition, the strong labelling in the nucleoplasm was often associated with electron-dense material, consistent with the accumulation of pre-ribosomes in this nuclear compartment. That this material corresponded to accumulating pre-ribosomal particles was confirmed using a probe complementary to ITS2. Like the 25S probe, this probe was detected mostly in the nucleolus of wild-type cells, whereas it also labelled electron-dense domains in the nucleoplasm in GAL::NOG2 cells after 16 h in glucose (Figure 8B). These observations are consistent with the biochemical data presented above showing the accumulation of 27S and 7S pre-rRNAs upon depletion of Nog2p, and indicate that the pre-ribosomal complexes containing the
Referência(s)