Molecular Dissection of the Functional Domains of a Unique, Tartrate-resistant, Surface Membrane Acid Phosphatase in the Primitive Human Pathogen Leishmania donovani
2002; Elsevier BV; Volume: 277; Issue: 20 Linguagem: Inglês
10.1074/jbc.m200114200
ISSN1083-351X
AutoresAlison M. Shakarian, Manju B. Joshi, Elodie Ghedin, Dennis M. Dwyer,
Tópico(s)Lysosomal Storage Disorders Research
ResumoThe primitive trypanosomatid pathogen of humans,Leishmania donovani, constitutively expresses a unique externally oriented, tartrate-resistant, acid phosphatase on its surface membrane. This is of interest because these organisms are obligate intracellular protozoan parasites that reside and multiply within the hydrolytic milieu of mammalian macrophage phago-lysosomes. Here we report the identification of the gene encoding this novel L. donovani enzyme. In addition, we characterized its structure, demonstrated its constitutive expression in both parasite developmental forms, and determined the cell surface membrane localization of its translated protein product. Further, we used a variety of green fluorescent protein chimeric constructs as reporters in a homologous leishmanial expression system to dissect the functional domains of this unique, tartrate-resistant, surface membrane enzyme. The primitive trypanosomatid pathogen of humans,Leishmania donovani, constitutively expresses a unique externally oriented, tartrate-resistant, acid phosphatase on its surface membrane. This is of interest because these organisms are obligate intracellular protozoan parasites that reside and multiply within the hydrolytic milieu of mammalian macrophage phago-lysosomes. Here we report the identification of the gene encoding this novel L. donovani enzyme. In addition, we characterized its structure, demonstrated its constitutive expression in both parasite developmental forms, and determined the cell surface membrane localization of its translated protein product. Further, we used a variety of green fluorescent protein chimeric constructs as reporters in a homologous leishmanial expression system to dissect the functional domains of this unique, tartrate-resistant, surface membrane enzyme. Leishmania donovani is an important protozoan pathogen of humans that causes severe and most often fatal visceral disease in the tropics and subtropics worldwide (1UNDP/World Bank/World Health OrganizationTropical Disease Research: Progress 1997-1998: Fourteenth Programme Report of the UNDP/World Bank/WHO Special Programme for Research and Training in Tropical Diseases. World Health Organization, Geneva, Switzerland1999Google Scholar). This organism has a digenetic life cycle that consists of two major developmental forms: 1) extracellular flagellated promastigotes that reside and multiply in the alimentary tract of their sandfly vectors and 2) obligate intracellular nonflagellated amastigotes that reside and multiply within the phago-lysosomal system of infected human macrophages. Acid phosphatases (AcPs) 1The abbreviations used are: AcPacid phosphatase(s)aaamino acid(s)Abantibody(ies)DIGdigoxigeningDNAgenomic DNAGFPgreen fluorescent proteinNRSnormal rabbit serumoligooligodeoxyribonucleotide(s)ORFopen reading frameRTreverse transcriptionSAcPsecretory AcP of L. donovaniSPsignal peptideTMtransmembrane are phosphomonoesterases that hydrolyze substrates under low pH conditions and are generally considered to be typical marker enzymes of lysosomes (2Lamp E.C. Drexler H.G. Leuk. Lymphoma. 2000; 39: 477-484Crossref PubMed Scopus (30) Google Scholar, 3Oddie G.W. Schenk N.Z. Angel N.Z. Walsh N. Guddat L.W., De Jersey J. Cassady A.I. Hamilton S.E. Hume D.A. Bone. 2000; 27: 575-584Crossref PubMed Scopus (181) Google Scholar). Previously, it was shown that L. donovani promastigotes (4Gottlieb M. Dwyer D.M. Science. 1981; 212: 939-941Crossref PubMed Scopus (84) Google Scholar, 5Gottlieb M. Dwyer D.M. Exp. Parasitol. 1981; 52: 117-128Crossref PubMed Scopus (88) Google Scholar) and tissue-derived amastigotes possess a unique, externally oriented, surface membrane, tartrate-resistant acid phosphatase. 2D. M. Dwyer, unpublished observation. The presence of this enzyme on the parasite cell surface is an interesting observation considering that amastigotes of all pathogenic leishmanial species reside and multiply within host cell phago-lysosomes. Moreover, to date, no other tartrate-resistant surface membrane AcP from any source has been reported in the literature. acid phosphatase(s) amino acid(s) antibody(ies) digoxigenin genomic DNA green fluorescent protein normal rabbit serum oligodeoxyribonucleotide(s) open reading frame reverse transcription secretory AcP of L. donovani signal peptide transmembrane The tartrate-resistant surface membrane AcP of L. donovani(MAcP) has a broad substrate specificity hydrolyzing glycerol phosphates and mono- and di-phosphorylated sugars (5Gottlieb M. Dwyer D.M. Exp. Parasitol. 1981; 52: 117-128Crossref PubMed Scopus (88) Google Scholar), inositol phosphates, and phosphorylated proteins (6Das S. Saha A.K. Glew R.H. Dowling J.N. Kajiyoshi M. Gottlieb M. Mol. Biochem. Parastiol. 1986; 20: 143-153Crossref PubMed Scopus (34) Google Scholar). Although the biochemical properties of this enzyme have been partially characterized, its biological function(s), as with virtually all acid phosphatases (3Oddie G.W. Schenk N.Z. Angel N.Z. Walsh N. Guddat L.W., De Jersey J. Cassady A.I. Hamilton S.E. Hume D.A. Bone. 2000; 27: 575-584Crossref PubMed Scopus (181) Google Scholar), remain to be elucidated. Understanding and investigating the role(s) that this AcP plays in parasite growth and survival would be facilitated by the characterization of the gene(s) that encodes this unique enzyme. To date, however, no such leishmanial genes have been reported. Thus, in the current study we identified the gene encoding this novel L. donovani enzyme and characterized its structure, expression, and localization in both developmental forms of the parasite. Further, a variety of green fluorescent protein (GFP) chimeric constructs was used as reporters in a homologous leishmanial expression system to dissect the functional domains of this unique, tartrate-resistant, surface membrane enzyme. All chemicals used, unless otherwise noted, were of analytical grade and were purchased from Sigma. Similarly, enzymes and DNA molecular mass standards were purchased from Roche Molecular Biochemicals. Protein molecular mass standards were purchased from Amersham Biosciences. L. donovani promastigotes ([1S, clone 2D]from the 1S strain World Health Organization designation: (MHOM/SD/62/1S-CL2D) were grown at 26 °C in chemically defined 199(+) medium as described by McCarthy-Burke et al. (7McCarthy-Burke C. Bates P.A. Dwyer D.M. Exp. Parasitol. 1991; 73: 385-387Crossref PubMed Scopus (48) Google Scholar). Axenic amastigotes forms of this L. donovani clone were grown at 37 °C as described by Joshi et al. (8Joshi M. Dwyer D.M. Nakhasi H.L. Mol. Biochem. Parasitol. 1993; 58: 345-354Crossref PubMed Scopus (97) Google Scholar). All of the cultures were harvested at log phase (2–3 × 107 cells ml−1) by centrifugation as described (9Shakarian A.M. Dwyer D.M. Gene (Amst.). 1998; 208: 315-322Crossref PubMed Scopus (33) Google Scholar). The cell pellets were resuspended in the appropriate buffers for isolation of nucleic acids, for preparation of surface membrane fractions, or for transfection experiments. Tissue-derived amastigotes of this L. donovani strain were isolated from spleens of infected hamsters (Mesocricetus auratus; LVG strain, Charles River Laboratories, Inc., Wilmington, MA) as described previously (10Dwyer D.M. Langreth S.G. Dwyer N.K. Z. Parasitenk. 1974; 43: 227-249Crossref PubMed Scopus (47) Google Scholar). Cell lysates of both promastigotes and axenic amastigotes were prepared from washed cell pellets by the addition of lysis buffer (10 mm Tris-HCl, 2 mm EDTA, 25 μg ml−1 leupeptin, pH 8.0) to a final concentration of 5 × 108 cells ml−1 and disruption in a prechilled, tightly fitting Dounce homogenizer (5Gottlieb M. Dwyer D.M. Exp. Parasitol. 1981; 52: 117-128Crossref PubMed Scopus (88) Google Scholar). The lysates were centrifuged at 8000 × g for 30 min at 4 °C to obtain parasite surface membrane-enriched fractions (8K pellets). The supernatant was removed, and the 8K pellets were washed twice with buffer (10 mm HEPES, 145 mm NaCl, pH, 7.4) by centrifugation as above. The washed 8K pellets were solubilized (at ∼5 × 108 cell equivalents ml−1) in the same buffer containing 1.0% Triton X-100 (Surfact-Amps® X-100; Pierce), 1.0% octyl-β-d-glucopyranoside (Calbiochem, La Jolla, CA) by stirring at 4 °C for ∼12 h (11Gbenle G.O. Dwyer D.M. Biochem. J. 1992; 285: 41-46Crossref PubMed Scopus (25) Google Scholar). The samples were centrifuged at 48,000 × g for 30 min at 4 °C, and the supernatants, which contained the detergent-solubilized parasite surface membrane components, were assayed for enzyme activity or used in immunoprecipitations and Western blot analyses. The protein concentrations were determined using the bicinchoninic acid (microBCA; Pierce) method (12Smith P.K. Krohn R.I. Hermanson G.T. Mallia A.K. Gartner F.H. Provenzano M.D. Fujimoto E.K. Goeke N.M. Olson B.J. Klenk D.C. Anal. Biochem. 1985; 150: 76-85Crossref PubMed Scopus (18643) Google Scholar). Total genomic DNA (gDNA) was isolated from promastigotes using the GNome DNA isolation kit from Bio 101 (La Jolla, CA). Total RNA was isolated from promastigotes, axenic amastigotes, and tissue-derived amastigotes using the RNeasy method (Qiagen, Chatsworth, CA) as described previously (13Shakarian A.M. Ellis S.L. Mallinson D.J. Olafson R.W. Dwyer D.M. Gene (Amst.). 1997; 196: 127-137Crossref PubMed Scopus (26) Google Scholar). A probe common to the 5′-ends of the L. donovani AcP gene family (13Shakarian A.M. Ellis S.L. Mallinson D.J. Olafson R.W. Dwyer D.M. Gene (Amst.). 1997; 196: 127-137Crossref PubMed Scopus (26) Google Scholar) was generated by PCR amplification with Taq polymerase and digoxygenin-dUTP according to the manufacturer's instructions (Roche Molecular Biochemicals). The conditions for amplification were 95 °C for 1 min, 42 °C for 1 min, 72 °C for 1 min (40 cycles), and 72 °C for 6 min. This 300-bp probe was generated with oligo primers forward 1, 5′-CAGAACGACCGACATGC, and reverse 2, 5′-GACATACTTGAACCAGG using the previously described pAcP396(13Shakarian A.M. Ellis S.L. Mallinson D.J. Olafson R.W. Dwyer D.M. Gene (Amst.). 1997; 196: 127-137Crossref PubMed Scopus (26) Google Scholar) as a template. The resulting digoxygenin-labeled fragment (DIG-300) was used in hybridization studies. In addition, an oligo unique to MAcP, forward 111, 5′-CGCGAAATGCATGAAGGGCGCAATCGCGTCTTCGATATGG, was labeled with digoxygenin-dUTP by tailing with terminal transferase according to the Genius Labeling kit 6 manufacturer's instructions (Roche Molecular Biochemicals). The resulting MAcP specific oligo probe (DIG-111) was used in hybridization studies. gDNA was digested in independent reactions with several restriction endonucleases, and the restriction fragments were separated by 0.8% agarose gel electrophoresis. These gels were prepared for blotting as described previously (13Shakarian A.M. Ellis S.L. Mallinson D.J. Olafson R.W. Dwyer D.M. Gene (Amst.). 1997; 196: 127-137Crossref PubMed Scopus (26) Google Scholar). DNA was transferred under vacuum and UV cross-linked to nylon membranes (Hybond-N; Amersham Biosciences). The membranes were processed for hybridization with the DIG-300 or DIG-111 probes according to the Genius system user's guide (Roche Molecular Biochemicals), and the hybridized fragments were visualized using the Genius detection system (Roche Molecular Biochemicals) and fluorography. A cosmid library of L. donovani gDNA (kindly provided by Dr. B. Ullman, Oregon Health Sciences University, Portland, OR) was screened by hybridization using the DIG-300 probe. DNA isolated from positive cosmid clones (Magic Miniprep; Promega, Madison, WI) was analyzed by restriction endonuclease digestion and Southern hybridization analyses. Cosmids containing an ∼3.0-kb PstI AcP insert (Cos AcP-101, -102, and -103) were subjected to nucleotide sequence analysis. DNA was sequenced using the fluorescent dideoxy chain terminator cycle sequencing method (14McCombie W.R. Heiner C. Kelly J.M. Fitzgerald M.G. Gocayne J.D. DNA Seq. 1992; 2: 289-296Crossref PubMed Scopus (92) Google Scholar) at the Johns Hopkins University DNA Analysis Facility (Baltimore, MD) as described previously (9Shakarian A.M. Dwyer D.M. Gene (Amst.). 1998; 208: 315-322Crossref PubMed Scopus (33) Google Scholar). Sequence data from both strands were analyzed using the Genetic Computer Group software package (15Devereaux J. Haeberli P. Smithies O. Nucleic Acids Res. 1984; 12: 387-395Crossref PubMed Scopus (11536) Google Scholar) running on a National Institutes of Health Unix system and SequencerTM 3.0 software (Gene Codes Corp., Ann Arbor, MI). Signal sequence and protease cleavage sites were predicted using Analyze-Signalase 2.0.3 (16Mantei, N. (1992) electronic file available on internet via anonymous ftp from ftp://bio.indiana.edu.molbiolGoogle Scholar). Reverse transcription was carried out with total RNA from L. donovani promastigotes, axenic amastigotes, and tissue-derived amastigotes using Superscript II (Invitrogen Co., Carlsbad, CA) and oligo(dT) to generate cDNA according to the manufacturer's instructions. PCR amplification reactions contained the following oligo primer pair: primer pair 1, forward B, 5′-GCACCAGCTGCGTCCTCT, and reverse B, 5′-ATCACGCCAACTGCAGA. PCR amplification reactions contained primer pair 1, 2 μl of the cDNA generated above, dNTPs (Promega) Taq polymerase, and the appropriate buffer in a final volume of 50 μl. The conditions for amplification were 95 °C for 1 min, 42 °C for 1 min, 72 °C for 1 min (40 cycles), and 72 °C for 6 min. PCR products were analyzed by 3.0% NuSieve® agarose (FMC® Bioproducts, Rockland, ME) gel electrophoresis and ethidium bromide staining. Gel-purified PCR products (SephaglasTM Bandprep kit; Amersham Biosciences) were subjected to nucleotide sequence analysis. Two individual peptides unique to the MAcP-deduced protein were synthesized using 9-fluoromethyloxycarbonyl chemistry: peptide 1, Lys-Phe-Pro-Phe-Phe-Arg-Phe-Pro-Tyr-Arg-Arg-Arg-Asp-Cys-Ala-Leu-His (kindly provided by the Laboratory of Molecular Structure NIAID, National Institutes of Health), and peptide 2, Arg-Phe-Pro-Tyr-Arg-Arg-Arg-Asp-Cys-Ala-Leu (Genosys Biotechnologies Inc., The Woodlands, TX). These peptides were conjugated to maleimide-activated keyhole limpet hemocyanin (Imject-activated immunogen conjugation kit; Pierce). Anti-peptide antibodies (anti-MAcP peptide Ab) were produced in a New Zealand White rabbit (No. 1407) by Spring Valley Laboratories, Inc. (Woodbine, MD) by subscapular immunization with a mixture containing 1.25 mg of each of the conjugated peptides (2.5 mg total) as described previously (9Shakarian A.M. Dwyer D.M. Gene (Amst.). 1998; 208: 315-322Crossref PubMed Scopus (33) Google Scholar). The resulting anti-MAcP peptide Ab was used in both Western blot analyses and immunoprecipitation activity assays. In addition, a rabbit monospecific (No. 172) Ab to the L. donovani SAcP (17Bates P.A. Dwyer D.M. Mol. Biochem. Parasitol. 1987; 26: 289-296Crossref PubMed Scopus (62) Google Scholar) and the appropriate control sera were used as positive controls in these assays. An anti-GFP mouse monoclonal antibody (CLONTECH Laboratories Inc., Palo Alto, CA) was also used in Western blots and in indirect immunofluorescence assays to detect GFP chimeric proteins. A rabbit anti-Bip antibody was a kind gift from Dr. James Bangs (University of Wisconsin, Madison, WI). Further, a goat anti-rabbit rhodamine-conjugated antibody (Jackson Immunoresearch Laboratories, West Grove, PA) and a goat anti-mouse fluorescein isothiocyanate-conjugated antibody (Sigma) were used as secondary antibodies for fluorescence microscopy. Solubilized promastigote and axenic amastigote surface membrane extracts (10 μg of total protein/lane), cell lysates of promastigotes and tissue-derived amastigotes (15 μg of total protein/lane), or culture supernatants (15 μl/lane) from transfectants were subjected to SDS-PAGE (10% precast Tris-Glycine Novex® gels, Invitrogen), and the proteins were transblotted (9Shakarian A.M. Dwyer D.M. Gene (Amst.). 1998; 208: 315-322Crossref PubMed Scopus (33) Google Scholar) onto nylon (polyvinylidene difluoride) membranes (Immobilon-P; Millipore Corp., Bedford, MA). The membranes were probed with the anti-MAcP peptide Ab, preimmune serum from this rabbit (i.e. normal rabbit serum (NRS)), the L. donovaniSAcP control antiserum, or anti-GFP Ab using the LumiGLOTMWestern blot kit reagents (Kirkegaard & Perry Laboratories, Gaithersburg, MD). Immunodetection was carried out using the chemiluminescent horseradish peroxidase system in the LumiGLOTM kit according to the manufacturer's instructions (Kirkegaard & Perry Laboratories). Solubilized surface membrane extracts from L. donovani promastigotes and axenic amastigotes were reacted with anti-MAcP peptide Ab or NRS in a protein A-Sepharose 4B/CL (AmershamBiosciences) bead-based assay as described previously (9Shakarian A.M. Dwyer D.M. Gene (Amst.). 1998; 208: 315-322Crossref PubMed Scopus (33) Google Scholar). Immunoprecipitates were subsequently assayed for AcP activity in the presence or absence of 5 mm sodium tartrate (L(+)-tartaric acid; ICN Pharmaceuticals Inc., Costa Mesa, CA), as described previously (18Ellis S.L. Shakarian A.M. Dwyer D.M. Exp. Parasitol. 1998; 89: 161-168Crossref PubMed Scopus (22) Google Scholar). All of the samples were assayed in triplicate, and these assays were repeated on multiple samples. One unit of enzyme activity (19Gottlieb M. Dwyer D.M. Mol. Cell. Biol. 1982; 2: 76-81Crossref PubMed Scopus (67) Google Scholar) reflects the hydrolysis of 1 nmol of p-nitrophenyl phosphate (U.S. Biochemical Corp., Cleveland, OH) to p-nitrophenol min−1 mg−1 of detergent-solubilized parasite surface membrane protein at 42 °C. The percentage of activity immunoprecipitated was determined using the following formula: (activity bound/[activity bound + activity unbound]) × 100. The results obtained from immunoprecipitations were normalized by subtracting the values obtained with NRS from those obtained with the anti-MAcP peptide Ab. The designations used in this report for proteins, genes, and plasmids follows the nomenclature for Trypanosoma and Leishmania as suggested by Clayton et al. (20Clayton C. Adams M. Almeida R. Baltz T. Barret M. Bastien P. Belli S. Beverley S. Biteau N. Blackwell J. Blaineau C. Boshart M. Bringaud F. Cross G. Cruz A. Degrave W. Donelson J., El- Sayed N., Fu, G. Ersfeld K. Gibson W. Gull K. Ivens A. Kelly J. Lawson D. Lebowitz J. Majiwa P. Matthews K. Melville S. Merlin G. Michels P. Myler P. Norrish A. Opperdoes F. Papadopoulou B. Parsons M. Seebeck T. Smith D. Stuart K. Turner M. Ullu E. Vanhamme L. Mol. Biochem. Parasitol. 1998; 97: 221-224Crossref PubMed Scopus (79) Google Scholar) pKSNEO was used as the leishmanial vector (21Zang W.W. Charest H. Ghedin E. Matlashewski G. Mol. Biochem. Parasitol. 1996; 78: 79-90Crossref PubMed Scopus (120) Google Scholar) to express GFP-MAcP chimeras for studies of the functional domains of the MAcP. In a multi-step process, the potential signal peptide (SP) of MAcP, GFP, and the putative transmembrane anchor domain (TM) of MAcP were PCR-amplified and subcloned to generate pKS NEO MAcPSP::GFP::TM. First, PCR amplification of the TM domain of MAcP was performed using Cos AcP-101 as template with the primer pair, forward MAcPTM 5′-TGGTGGAGCGCT CCCGCCTTATATAAATTGATAGCTACGTGT (Eco47 restriction endonuclease site in bold type) and reverse MAcPTM 5′-TGGTGGACGCGT TGGACTAGT CCCTTAATACACGCGAAATGCATG (MluI and SpeI restriction endonuclease sites in bold type). The resulting PCR product was cloned into the pCR2.1 vector (TA Cloning System; Invitrogen) to generate the plasmid pCR2.1 MAcPTM. Second, the GFP gene was amplified from plasmid pEGFP-1 (CLONTECH) using primers forward GFP 5′-TGGTGGAGCGCT CCCACGCGT CCATGGTGAGCAAGGGCG (Eco47 and MluI restriction endonuclease sites in bold type) and reverse GFP 5′-CCAAGCGCT CTTGTACAGCTCGTCCATG (Eco47 restriction endonuclease site in bold type). The resulting PCR product was cloned into the pCR2.1 vector (Invitrogen), resulting in the plasmid construct pCR2.1 EGFP. Third, the MAcP signal peptide plus its peptidase cleavage site (Arg24) was PCR-amplified from Cos AcP-101 template with primers forward MAcPSP 5′-CATGACGTCACTAGT ATGGCCTCGAAGCTCATC (SpeI restriction endonuclease site in bold type) and reverse MAcPSP 5′-TGGTGGACGCGT CCATGCGCACGACAAGGC (MluI restriction endonuclease site in bold type). The resulting PCR product was cloned into the pCR2.1 vector (Invitrogen) to produce pCR2.1 MAcPSP. The first chimera that contained GFP and the putative TM domain of MAcP was constructed by subcloning the gel-purified Eco47-digested GFP fragment from pCR2.1 EGFP into the Eco47-linearized pCR2.1 MAcPTM construct, which resulted in the plasmid construct pCR2.1 GFP::TM. The orientation of the GFP fragment was verified using gel electrophoresis analysis with the appropriate restriction endonucleases. The second chimera containing the MAcP SP, GFP, and the putative MAcP TM domain was produced by subcloning the gel-purified MluI fragment of pCR2.1 GFP::TM into the MluI-linearized pCR2.1 MAcPSP, which resulted in the plasmid construct pCR2.1 MAcPSP::GFP::TM. The orientation of the GFP::TM fragment was verified using gel electrophoresis analysis with the appropriate restriction endonucleases. pCR2.1 MAcPSP::GFP::TM was digested with SpeI, and the gel-purified fragment was subcloned into the SpeI-linearized leishmanial expression vector pKS NEO, resulting in the plasmid construct pKS NEO MAcPSP::GFP::TM. Orientation of the subcloned fragment was verified using gel electrophoresis analysis with the appropriate restriction endonucleases. The final construct pKS NEO MAcPSP::GFP::TM was verified by sequence analysis as described above and was subsequently transfected into L. donovani promastigotes for functional domain analysis studies. Other MAcP-GFP chimeric expression plasmids including pKS NEO MAcPSP::GFP and pKS NEO GFP were constructed using the same multi-step PCR-based cloning strategy above as appropriate. For transfection experiments, harvested promastigote cells were resuspended in electroporation buffer to 108 cells ml−1 as described previously (22Debrabant A. Ghedin E. Dwyer D.M. J. Biol. Chem. 2000; 275: 16366-16372Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar). 500 μl of cell suspension was added to a 2-mm gap electroporation cuvette (BTX Inc., San Diego, CA). Immediately prior to electroporation, 20 μl of purified plasmid DNA (1 mg ml−1 in sterile 10 mm Tris, 2 mm EDTA (Quality Biological, Inc., Gaithersburg, MD), pH 8.0) was added to the cell suspension. The cells were electroporated using a BTX Inc. ECM-600 electroporation system. Electroporation conditions were a single pulse at 475 V, 800 microfarads, and 13 ohms. The electroporated cells were incubated on ice for 10 min and transferred into 5 ml of culture medium as described above and incubated at 26 °C for 24 h. The transfected cells were subsequently harvested by centrifugation as above and resuspended in culture medium containing 15 μg ml−1 G418 (Geneticin, Invitrogen). Transfected cells were selected for growth in increasing concentrations of G418 over a period of several weeks and maintained at 200 μg ml−1 drug. The drug-resistant cells were used in subsequent experiments. Transfected promastigotes were washed three times in phosphate-buffered saline by centrifugation as described above. Fluorescence images of such live cells were acquired using a Zeiss Axioplan microscope (Carl Zeiss, Inc., Thornwood, NY), which was equipped with epifluorescence, a cooled CCD camera (Photometrics, Tucson, AZ), and the appropriate fluorescein isothiocyanate excitation/barrier filters. Transfected parasites were also examined in indirect immunofluorescence assays using anti-Bip and anti-GFP antibodies essentially as described by Debrabant et al.(22Debrabant A. Ghedin E. Dwyer D.M. J. Biol. Chem. 2000; 275: 16366-16372Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar). Such cells were examined by confocal microscopy using a Zeiss LSM 410 system with fluorescein isothiocyanate and rhodamine excitation/barrier filters. The fluorescent images obtained in these channels were collected separately. All of the captured images were processed using Adobe Photoshop 5.5 (Adobe Systems, San Jose, CA). Previously we identified and characterized the genes that encode the 110- and 130-kDa isoforms of the L. donovani histidine secretory AcPs (SAcP-1 and SAcP-2) (13Shakarian A.M. Ellis S.L. Mallinson D.J. Olafson R.W. Dwyer D.M. Gene (Amst.). 1997; 196: 127-137Crossref PubMed Scopus (26) Google Scholar). In the current study, results of Southern analysis of L. donovani gDNA digested with PstI revealed three restriction fragments (5.2, 3.9, and 3.0 kb) that hybridized with an L. donovani AcP gene probe (DIG-300) (Fig. 1). The two larger PstI fragments, of 3.9 and 5.2 kb, contained the SAcP-1 and SAcP-2 genes described above (13Shakarian A.M. Ellis S.L. Mallinson D.J. Olafson R.W. Dwyer D.M. Gene (Amst.). 1997; 196: 127-137Crossref PubMed Scopus (26) Google Scholar). The third PstI fragment, of 3.0 kb, was subcloned, sequenced, and found to contain a partial ORF, very similar but not identical in sequence to either SAcP-1 or SAcP-2. To obtain a full-length ORF corresponding to the 3.0-kb PstI fragment, an L. donovani gDNA cosmid library was screened with the DIG-300 probe, which is common to all three PstI restriction fragments. Seventeen positive clones were identified and analyzed by restriction endonuclease digestion with PstI followed by Southern hybridization with the DIG-300 probe. Three of the 17 cosmid clones (Cos AcP-101, -102, and -103) contained a 3.0-kb PstI restriction fragment. Sequence analysis revealed that these cosmids contained a full-length (948 bp) ORF corresponding to the 3.0-kb PstI genomic fragment. Sequence analysis showed that the 948-bp ORF encoded a deduced protein with a calculated molecular mass of 35,192 Da and a predicted isoelectric point of 8.23. Analysis of the deduced aa sequence showed that it contained five potential N-linked glycosylation sites (Asn44, Asn96, Asn135, Asn219, and Asn245) (Fig. 2 A) and one predicted myristoylation site (Gly37). In addition, the deduced protein possessed five putative phosphorylation sites by several different mechanisms (i.e. casein kinase II: Ser83,Ser154, and Ser248 and protein kinase C: Thr107 and Thr247). Moreover, the most abundant residues of this deduced protein were alanine and leucine, which constitute 23% of its aa content. The deduced protein can be divided into three structural domains. Region I consists of a 23-aa putative signal peptide (Met1–Ala23) based on the Von Heijne algorithm (23Von Heijne G. J. Mol. Biol. 1985; 184: 99-105Crossref PubMed Scopus (1535) Google Scholar) (Fig. 2). The sequence of this putative signal peptide including its peptidase cleavage site is identical to those present at the N termini of the SAcP-1- and SAcP-2-deduced proteins (13Shakarian A.M. Ellis S.L. Mallinson D.J. Olafson R.W. Dwyer D.M. Gene (Amst.). 1997; 196: 127-137Crossref PubMed Scopus (26) Google Scholar). Therefore, cleavage at this site would result in Arg 24 as the N-terminal aa of the mature protein. In addition, the two SAcP-deduced proteins of L. donovani (SAcP-1 and SAcP-2) and the 948-bp ORF-deduced protein above are identical in aa sequence for 251 residues beyond the signal peptide (Region II) (Fig. 2 B). The presence of a conserved histidine AcP signature sequence (i.e. a catalytic site consensus sequence) within Region II (Val27–Arg39) (Fig. 2) indicates that the 948-bp ORF-deduced protein is a member of this highly conserved family of enzymes. However, the second histidine AcP signature sequence (Ala285–Thr296) present in SAcP-1 and SAcP-2 is absent in the 948-bp ORF-deduced protein. The third region consists of the C terminus of this deduced protein. Based on the Kyte-Doolittle algorithm (24Kyte J. Doolittle R.F. J. Mol. Biol. 1982; 157: 105-132Crossref PubMed Scopus (17215) Google Scholar), Region III of 948-bp ORF-deduced protein contains a stretch of 29 hydrophobic aa residues (Leu274–Tyr302) that could function as a transmembrane anchor domain (Fig. 2). This is followed by a short 13-aa putative cytoplasmic tail (Arg303–Tyr315). Cumulatively, these observations suggested that the 948-bp ORF represented a membrane-anchored member of the histidine acid phosphatase family; thus, this gene was designated as the L. donovani MAcP. Comparison of both nucleotide and deduced aa sequences revealed that the AcPs from L. donovani belong to a highly conserved multi-gene family. To determine whether MAcP constituted a distinct single gene or a multi-gene locus, we designed a specific oligo probe, DIG-111 (Fig. 3 A), that would only recognize MAcP and not SAcP-1 or SAcP-2. This oligo probe was used in Southern hybridization analysis of L. donovani gDNA. The results of these analyses with both single (AatII, NcoI, and NotI) and double restriction endonuclease (AatII and NcoI; AatII and NotI; and NcoI and NotI) digestions demonstrated that within an ∼6-kb region of L. donovani gDNA, only single restriction fragments were observed to hybridize with the DIG-111 probe (Fig. 3 B). One would expect that multiple restriction fragments would have hybridized with this probe, if the MAcP locus had been present in more than one copy. Thus, the hybridization results indicated that the 6 kb surrounding and including the MAcP locus were present only once within the L. donovani genome. These results were confirmed by Southern hybridization of the three cosmids clones, Cos AcP-101, -102, and -103, each of which was shown to contain a single MAcP ORF (data not shown). Transcription of MAcP was assayed in a two-step process involving RT and PCR amplification (Fi
Referência(s)