DNA Ligase I and Proliferating Cell Nuclear Antigen Form a Functional Complex
2001; Elsevier BV; Volume: 276; Issue: 27 Linguagem: Inglês
10.1074/jbc.m101673200
ISSN1083-351X
AutoresSamson Tom, Leigh A. Henricksen, Min S. Park, Robert A. Bambara,
Tópico(s)Genomics and Chromatin Dynamics
ResumoDNA ligase I is responsible for joining Okazaki fragments during DNA replication. An additional proposed role for DNA ligase I is sealing nicks generated during excision repair. Previous studies have shown that there is a physical interaction between DNA ligase I and proliferating cell nuclear antigen (PCNA), another important component of DNA replication and repair. The results shown here indicate that human PCNA enhances the reaction rate of human DNA ligase I up to 5-fold. The stimulation is specific to DNA ligase I because T4 DNA ligase is not affected. Electrophoretic mobility shift assays indicate that PCNA improves the binding of DNA ligase I to the ligation site. Increasing the DNA ligase I concentration leads to a reduction in PCNA stimulation, consistent with PCNA-directed improvement of DNA ligase I binding to its DNA substrate. Two experiments show that PCNA is required to encircle duplex DNA to enhance DNA ligase I activity. Biotin-streptavidin conjugations at the ends of a linear substrate inhibit PCNA stimulation. PCNA cannot enhance ligation on a circular substrate without the addition of replication factor C, which is the protein responsible for loading PCNA onto duplex DNA. These results show that PCNA is responsible for the stable association of DNA ligase I to nicked duplex DNA. DNA ligase I is responsible for joining Okazaki fragments during DNA replication. An additional proposed role for DNA ligase I is sealing nicks generated during excision repair. Previous studies have shown that there is a physical interaction between DNA ligase I and proliferating cell nuclear antigen (PCNA), another important component of DNA replication and repair. The results shown here indicate that human PCNA enhances the reaction rate of human DNA ligase I up to 5-fold. The stimulation is specific to DNA ligase I because T4 DNA ligase is not affected. Electrophoretic mobility shift assays indicate that PCNA improves the binding of DNA ligase I to the ligation site. Increasing the DNA ligase I concentration leads to a reduction in PCNA stimulation, consistent with PCNA-directed improvement of DNA ligase I binding to its DNA substrate. Two experiments show that PCNA is required to encircle duplex DNA to enhance DNA ligase I activity. Biotin-streptavidin conjugations at the ends of a linear substrate inhibit PCNA stimulation. PCNA cannot enhance ligation on a circular substrate without the addition of replication factor C, which is the protein responsible for loading PCNA onto duplex DNA. These results show that PCNA is responsible for the stable association of DNA ligase I to nicked duplex DNA. flap endonuclease 1 proliferating cell nuclear antigen replication factor C DNA metabolism requires the coordinated activity of a multitude of enzymes and enzyme complexes. Although the initiation of DNA replication and DNA repair are regulated through different mechanisms, the reactions performed to complete these pathways are similar. In particular, Okazaki fragment processing (1Bambara R.A. Murante R.S. Henricksen L.A. J. Biol. Chem. 1997; 272: 4647-4650Abstract Full Text Full Text PDF PubMed Scopus (298) Google Scholar) and long patch base excision repair (2Matsumoto Y. Kim K. Hurwitz J. Gary R. Levin D.S. Tomkinson A.E. Park M.S. J. Biol. Chem. 1999; 274: 33703-33708Abstract Full Text Full Text PDF PubMed Scopus (157) Google Scholar, 3Pascucci B. Stucki M. Jonsson Z.O. Dogliotti E. Hubscher U. J. Biol. Chem. 1999; 274: 33696-33702Abstract Full Text Full Text PDF PubMed Scopus (169) Google Scholar) share many enzymes needed for completion of these pathways. These include flap endonuclease 1 (FEN1),1 proliferating cell nuclear antigen (PCNA), and DNA ligase I. During lagging strand DNA synthesis, numerous initiator RNA primers must be removed. The resulting gaps are filled in and sealed by ligation to complete DNA synthesis. Two nucleases, Dna2 and FEN1, are responsible for excising the RNA primer (4Budd M.E. Campbell J.L. Mol. Cell. Biol. 1997; 17: 2136-2142Crossref PubMed Scopus (193) Google Scholar, 5Bae S.H. Choi E. Lee K.H. Park J.S. Lee S.H. Seo Y.S. J. Biol. Chem. 1998; 273: 26880-26890Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar, 6Kang H.Y. Choi E. Bae S.H. Lee K.H. Gim B.S. Kim H.D. Park C. MacNeill S.A. Seo Y.S. Genetics. 2000; 155: 1055-1067Crossref PubMed Google Scholar, 7Lee K.H. Kim D.W. Bae S.H. Kim J.A. Ryu G.H. Kwon Y.N. Kim K.A. Koo H.S. Seo Y.S. Nucleic Acids Res. 2000; 28: 2873-2881Crossref PubMed Scopus (71) Google Scholar, 8Liu Q. Choe W. Campbell J.L. J. Biol. Chem. 2000; 275: 1615-1624Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar). Both of these enzymes are unique structure-specific endonucleases. The preferred substrate contains a flap structure in which the RNA primer has been displaced to form a single-stranded tail (1Bambara R.A. Murante R.S. Henricksen L.A. J. Biol. Chem. 1997; 272: 4647-4650Abstract Full Text Full Text PDF PubMed Scopus (298) Google Scholar, 9Harrington J.J. Lieber M.R. EMBO J. 1994; 13: 1235-1246Crossref PubMed Scopus (373) Google Scholar, 10Harrington J.J. Lieber M.R. J. Biol. Chem. 1995; 270: 4503-4508Abstract Full Text Full Text PDF PubMed Scopus (81) Google Scholar, 11Murante R.S. Rust L. Bambara R.A. J. Biol. Chem. 1995; 270: 30377-30383Crossref PubMed Scopus (186) Google Scholar, 12Wu X. Li J. Li X. Hsieh C.L. Burgers P.M. Lieber M.R. Nucleic Acids Res. 1996; 24: 2036-2043Crossref PubMed Scopus (198) Google Scholar, 13Tom S. Henricksen L.A. Bambara R.A. J. Biol. Chem. 2000; 275: 10498-10505Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar). The flap structure probably arises as a result of displacement synthesis from an upstream Okazaki fragment by a complex of DNA polymerase δ and its accessory factors, PCNA and replication factor C (RFC) (14Mossi R. Ferrari E. Hubscher U. J. Biol. Chem. 1998; 273: 14322-14330Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). Dna2 is thought to cleave beyond the RNA segment within the tail, and the remaining displaced DNA is removed by FEN1 (5Bae S.H. Choi E. Lee K.H. Park J.S. Lee S.H. Seo Y.S. J. Biol. Chem. 1998; 273: 26880-26890Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar, 6Kang H.Y. Choi E. Bae S.H. Lee K.H. Gim B.S. Kim H.D. Park C. MacNeill S.A. Seo Y.S. Genetics. 2000; 155: 1055-1067Crossref PubMed Google Scholar, 7Lee K.H. Kim D.W. Bae S.H. Kim J.A. Ryu G.H. Kwon Y.N. Kim K.A. Koo H.S. Seo Y.S. Nucleic Acids Res. 2000; 28: 2873-2881Crossref PubMed Scopus (71) Google Scholar). Finally, the two fragments are joined through ligation by DNA ligase I (1Bambara R.A. Murante R.S. Henricksen L.A. J. Biol. Chem. 1997; 272: 4647-4650Abstract Full Text Full Text PDF PubMed Scopus (298) Google Scholar, 15Turchi J.J. Bambara R.A. J. Biol. Chem. 1993; 268: 15136-15141Abstract Full Text PDF PubMed Google Scholar). Long patch base excision repair utilizes several components common to Okazaki fragment processing to remove bases altered by ionizing radiation, oxidation, or alkylating agents (2Matsumoto Y. Kim K. Hurwitz J. Gary R. Levin D.S. Tomkinson A.E. Park M.S. J. Biol. Chem. 1999; 274: 33703-33708Abstract Full Text Full Text PDF PubMed Scopus (157) Google Scholar, 3Pascucci B. Stucki M. Jonsson Z.O. Dogliotti E. Hubscher U. J. Biol. Chem. 1999; 274: 33696-33702Abstract Full Text Full Text PDF PubMed Scopus (169) Google Scholar, 16Frosina G. Fortini P. Rossi O. Carrozzino F. Raspaglio G. Cox L.S. Lane D.P. Abbondandolo A. Dogliotti E. J. Biol. Chem. 1996; 271: 9573-9578Abstract Full Text Full Text PDF PubMed Scopus (449) Google Scholar, 17Klungland A. Lindahl T. EMBO J. 1997; 16: 3341-3348Crossref PubMed Scopus (666) Google Scholar, 18Biade S. Sobol R.W. Wilson S.H. Matsumoto Y. J. Biol. Chem. 1998; 273: 898-902Abstract Full Text Full Text PDF PubMed Scopus (179) Google Scholar, 19DeMott M.S. Zigman S. Bambara R.A. J. Biol. Chem. 1998; 273: 27492-27498Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar, 20Fortini P. Pascucci B. Parlanti E. Sobol R.W. Wilson S.H. Dogliotti E. Biochemistry. 1998; 37: 3575-3580Crossref PubMed Scopus (200) Google Scholar, 21Kim K. Biade S. Matsumoto Y. J. Biol. Chem. 1998; 273: 8842-8848Abstract Full Text Full Text PDF PubMed Scopus (188) Google Scholar). During the repair process, an abasic site is generated after removal of a damaged base by a DNA N-glycosylase. An apurinic/apyrimidinic endonuclease subsequently cleaves on the 5′-side of the abasic sugar to create a nick within the DNA. Similar to the removal of initiator RNA primers, synthesis by a DNA polymerase lifts the damaged residue and a few additional downstream nucleotides to form a flap. As during replication, this structure is removed endonucleolytically by FEN1 followed by ligation of the resulting nick by DNA ligase I (2Matsumoto Y. Kim K. Hurwitz J. Gary R. Levin D.S. Tomkinson A.E. Park M.S. J. Biol. Chem. 1999; 274: 33703-33708Abstract Full Text Full Text PDF PubMed Scopus (157) Google Scholar, 3Pascucci B. Stucki M. Jonsson Z.O. Dogliotti E. Hubscher U. J. Biol. Chem. 1999; 274: 33696-33702Abstract Full Text Full Text PDF PubMed Scopus (169) Google Scholar, 17Klungland A. Lindahl T. EMBO J. 1997; 16: 3341-3348Crossref PubMed Scopus (666) Google Scholar,19DeMott M.S. Zigman S. Bambara R.A. J. Biol. Chem. 1998; 273: 27492-27498Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar, 21Kim K. Biade S. Matsumoto Y. J. Biol. Chem. 1998; 273: 8842-8848Abstract Full Text Full Text PDF PubMed Scopus (188) Google Scholar). This entire process is stimulated in the presence of PCNA (22Gary R. Kim K. Cornelius H.L. Park M.S. Matsumoto Y. J. Biol. Chem. 1999; 274: 4354-4363Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar). PCNA is a toroidal homotrimer that is assembled around double-stranded DNA to form a sliding clamp (23Kelman Z. Oncogene. 1997; 14: 629-640Crossref PubMed Scopus (727) Google Scholar, 24Warbrick E. Bioessays. 2000; 22: 997-1006Crossref PubMed Scopus (353) Google Scholar). It has long been known to act as a processivity factor for DNA polymerases by tethering the polymerase to its template (25Bambara R.A. Jessee C.B. Biochim. Biophys. Acta. 1991; 1088: 11-24Crossref PubMed Scopus (83) Google Scholar). However, PCNA also interacts with other replication proteins and appears to be responsible for recruiting these proteins to replication foci in vivo (26Cardoso M.C. Joseph C. Rahn H.P. Reusch R. Nadal-Ginard B. Leonhardt H. J. Cell Biol. 1997; 139: 579-587Crossref PubMed Scopus (83) Google Scholar, 27Montecucco A. Rossi R. Levin D.S. Gary R. Park M.S. Motycka T.A. Ciarrocchi G. Villa A. Biamonti G. Tomkinson A.E. EMBO J. 1998; 17: 3786-3795Crossref PubMed Scopus (174) Google Scholar, 28Rossi R. Villa A. Negri C. Scovassi I. Ciarrocchi G. Biamonti G. Montecucco A. EMBO J. 1999; 18: 5745-5754Crossref PubMed Scopus (69) Google Scholar). The interaction of PCNA and FEN1 has been examined extensively (12Wu X. Li J. Li X. Hsieh C.L. Burgers P.M. Lieber M.R. Nucleic Acids Res. 1996; 24: 2036-2043Crossref PubMed Scopus (198) Google Scholar, 13Tom S. Henricksen L.A. Bambara R.A. J. Biol. Chem. 2000; 275: 10498-10505Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar,29Li X. Li J. Harrington J. Lieber M.R. Burgers P.M. J. Biol. Chem. 1995; 270: 22109-22112Crossref PubMed Scopus (254) Google Scholar, 30Jonsson Z.O. Hindges R. Hubscher U. EMBO J. 1998; 17: 2412-2425Crossref PubMed Scopus (236) Google Scholar, 31Gomes X.V. Burgers P.M. EMBO J. 2000; 19: 3811-3821Crossref PubMed Scopus (126) Google Scholar). The FEN1 nuclease binds to the interdomain connecting loop region of PCNA (12Wu X. Li J. Li X. Hsieh C.L. Burgers P.M. Lieber M.R. Nucleic Acids Res. 1996; 24: 2036-2043Crossref PubMed Scopus (198) Google Scholar, 29Li X. Li J. Harrington J. Lieber M.R. Burgers P.M. J. Biol. Chem. 1995; 270: 22109-22112Crossref PubMed Scopus (254) Google Scholar, 30Jonsson Z.O. Hindges R. Hubscher U. EMBO J. 1998; 17: 2412-2425Crossref PubMed Scopus (236) Google Scholar, 32Chen U. Chen S. Saha P. Dutta A. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 11597-11602Crossref PubMed Scopus (116) Google Scholar), and this association leads to a potent stimulation of FEN1 cleavage activity (12Wu X. Li J. Li X. Hsieh C.L. Burgers P.M. Lieber M.R. Nucleic Acids Res. 1996; 24: 2036-2043Crossref PubMed Scopus (198) Google Scholar, 13Tom S. Henricksen L.A. Bambara R.A. J. Biol. Chem. 2000; 275: 10498-10505Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar, 29Li X. Li J. Harrington J. Lieber M.R. Burgers P.M. J. Biol. Chem. 1995; 270: 22109-22112Crossref PubMed Scopus (254) Google Scholar). The physical interaction between the PCNA toroid and FEN1 enhances the binding stability of FEN1 to cleavage sites (13Tom S. Henricksen L.A. Bambara R.A. J. Biol. Chem. 2000; 275: 10498-10505Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar). In this way, PCNA serves to clamp FEN1 to its substrate in much the same way as this protein clamps DNA polymerases to sites of DNA synthesis. The ability of PCNA to enhance cleavage by FEN1 leads to more efficient DNA replication and base excision repair. A physical interaction between PCNA and DNA ligase I has also been identified (27Montecucco A. Rossi R. Levin D.S. Gary R. Park M.S. Motycka T.A. Ciarrocchi G. Villa A. Biamonti G. Tomkinson A.E. EMBO J. 1998; 17: 3786-3795Crossref PubMed Scopus (174) Google Scholar, 30Jonsson Z.O. Hindges R. Hubscher U. EMBO J. 1998; 17: 2412-2425Crossref PubMed Scopus (236) Google Scholar, 33Levin D.S. Bai W. Yao N. O'Donnell M. Tomkinson A.E. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 12863-12868Crossref PubMed Scopus (200) Google Scholar). DNA ligases have essential roles in many important cellular pathways including DNA replication, recombination, and repair (34Tomkinson A.E. Levin D.S. Bioessays. 1997; 19: 893-901Crossref PubMed Scopus (100) Google Scholar, 35Tomkinson A.E. Mackey Z.B. Mutat. Res. 1998; 407: 1-9Crossref PubMed Scopus (175) Google Scholar). Of the four DNA ligases in mammalian cells, DNA ligase I has been linked to DNA replication (36Waga S. Bauer G. Stillman B. J. Biol. Chem. 1994; 269: 10923-10934Abstract Full Text PDF PubMed Google Scholar) and base excision repair (37Levin D.S. McKenna A.E. Motycka T.A. Matsumoto Y. Tomkinson A.E. Curr. Biol. 2000; 10: 919-922Abstract Full Text Full Text PDF PubMed Scopus (173) Google Scholar). This ligase has been identified as a component of a high molecular weight replication complex (38Li C. Goodchild J. Baril E.F. Nucleic Acids Res. 1994; 22: 632-638Crossref PubMed Scopus (33) Google Scholar, 39Wu Y. Hickey R. Lawlor K. Wills P., Yu, F. Ozer H. Starr R. Quan J.Y. Lee M. Malkas L. J. Cell. Biochem. 1994; 54: 32-46Crossref PubMed Scopus (52) Google Scholar). In addition, DNA ligase I has been shown to be responsible for a major part of ligation activity in proliferating cells (40Elder R.H. Rossignol J.M. Biochemistry. 1990; 29: 6009-6017Crossref PubMed Scopus (25) Google Scholar, 41Lindahl T. Barnes D.E. Annu. Rev. Biochem. 1992; 61: 251-281Crossref PubMed Scopus (188) Google Scholar, 42Montecucco A. Biamonti G. Savini E. Focher F. Spadari S. Ciarrocchi G. Nucleic Acids Res. 1992; 20: 6209-6214Crossref PubMed Scopus (45) Google Scholar, 43Wei Y.F. Robins P. Carter K. Caldecott K. Pappin D.J., Yu, G.L. Wang R.P. Shell B.K. Nash R.A. Schar P. Barnes D.E. Haseltine W.A. Lindahl T. Mol. Cell. Biol. 1995; 15: 3206-3216Crossref PubMed Scopus (236) Google Scholar). Cytostaining experiments with antibodies against DNA ligase I revealed that the enzyme co-localizes in the nucleus with DNA polymerase α, implicating DNA ligase I in DNA replication (44Lasko D.D. Tomkinson A.E. Lindahl T. J. Biol. Chem. 1990; 265: 12618-12622Abstract Full Text PDF PubMed Google Scholar). A DNA ligase I mutant human cell line, 46BR, exhibits abnormal joining of Okazaki fragments (45Henderson L.M. Arlett C.F. Harcourt S.A. Lehmann A.R. Broughton B.C. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 2044-2048Crossref PubMed Scopus (62) Google Scholar, 46Lonn U. Lonn S. Nylen U. Winblad G. Carcinogenesis. 1989; 10: 981-985Crossref PubMed Scopus (18) Google Scholar, 47Barnes D.E. Tomkinson A.E. Lehmann A.R. Webster A.D. Lindahl T. Cell. 1992; 69: 495-503Abstract Full Text PDF PubMed Scopus (232) Google Scholar, 48Prigent C. Satoh M.S. Daly G. Barnes D.E. Lindahl T. Mol. Cell. Biol. 1994; 14: 310-317Crossref PubMed Scopus (129) Google Scholar), but the replication defect in extracts from this cell line can be complemented by the addition of DNA ligase I (49Mackenney V.J. Barnes D.E. Lindahl T. J. Biol. Chem. 1997; 272: 11550-11556Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar). A recent study with the DNA ligase I mutant cell line 46BR.1G1 reveals that the interaction between PCNA and DNA ligase I is integral to coordinating the ligation steps that complete long patch base excision repair (37Levin D.S. McKenna A.E. Motycka T.A. Matsumoto Y. Tomkinson A.E. Curr. Biol. 2000; 10: 919-922Abstract Full Text Full Text PDF PubMed Scopus (173) Google Scholar). These observations imply an important role for DNA ligase I in DNA replication and repair. Human DNA ligase I is comprised of a C-terminal catalytic domain and a hydrophilic N-terminal domain. Although the N-terminal region is dispensable for catalytic activity in vitro (50Tomkinson A.E. Lasko D.D. Daly G. Lindahl T. J. Biol. Chem. 1990; 265: 12611-12617Abstract Full Text PDF PubMed Google Scholar, 51Prigent C. Lasko D.D. Kodama K. Woodgett J.R. Lindahl T. EMBO J. 1992; 11: 2925-2933Crossref PubMed Scopus (67) Google Scholar), this region is essential in vivo (52Petrini J.H. Xiao Y. Weaver D.T. Mol. Cell. Biol. 1995; 15: 4303-4308Crossref PubMed Scopus (73) Google Scholar). DNA ligase I is regulated by phosphorylation at the N-terminal region of the protein (28Rossi R. Villa A. Negri C. Scovassi I. Ciarrocchi G. Biamonti G. Montecucco A. EMBO J. 1999; 18: 5745-5754Crossref PubMed Scopus (69) Google Scholar). In addition, the nuclear localization site of the protein has been identified in the N-terminal domain (26Cardoso M.C. Joseph C. Rahn H.P. Reusch R. Nadal-Ginard B. Leonhardt H. J. Cell Biol. 1997; 139: 579-587Crossref PubMed Scopus (83) Google Scholar, 53Montecucco A. Savini E. Weighardt F. Rossi R. Ciarrocchi G. Villa A. Biamonti G. EMBO J. 1995; 14: 5379-5386Crossref PubMed Scopus (70) Google Scholar), and this region is also responsible for interaction with PCNA (27Montecucco A. Rossi R. Levin D.S. Gary R. Park M.S. Motycka T.A. Ciarrocchi G. Villa A. Biamonti G. Tomkinson A.E. EMBO J. 1998; 17: 3786-3795Crossref PubMed Scopus (174) Google Scholar). The physical interaction between PCNA and DNA ligase I has been characterized as a potential means by which DNA ligase I is recruited to a replication site. Because the interaction of PCNA with FEN1 improves the catalytic rate of the nuclease, we considered here whether the binding of PCNA to DNA ligase I also improves the efficiency of catalysis. In this report, we initiate an investigation of the consequences of the interaction between DNA ligase I and PCNA using purified proteins in vitro. The advantage of this approach is that all of the observed changes in ligase function can be attributed exclusively to the presence of PCNA. Oligonucleotides were synthesized either by Integrated DNA Technologies (Coralville, IA) or by Genosys Biotechnologies (The Woodlands, TX). Radionucleotide [γ-32P]ATP (3000 Ci/mmol) was obtained from PerkinElmer Life Sciences. The T4 polynucleotide kinase and T4 DNA ligase were from Roche Diagnostics. Casein kinase II was obtained from Roche Molecular Biochemicals. Escherichia coli single-stranded DNA-binding protein was obtained from Promega. Micro Bio-Spin 30 chromatography columns were from Bio-Rad. All other reagents were the best available commercial grade. Recombinant human DNA ligase I (19DeMott M.S. Zigman S. Bambara R.A. J. Biol. Chem. 1998; 273: 27492-27498Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar) and recombinant human PCNA (13Tom S. Henricksen L.A. Bambara R.A. J. Biol. Chem. 2000; 275: 10498-10505Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar) were prepared as described previously. Purified DNA ligase I was dialyzed into a storage buffer (30 mm HEPES, pH 7.6, 10% glycerol, 15% sucrose, 25 mm KCl, 1 mm dithiothreitol, 0.01% Nonidet P-40, and 1 mm EDTA) and stored at −80 °C. Purified PCNA was dialyzed into a storage buffer (30 mm HEPES, pH 7.6, 20% glycerol, 30 mm KCl, 1 mm dithiothreitol, 0.01% Nonidet P-40, and 1 mm EDTA) and stored at −80 °C. Oligomer sequences are listed in Table I. The primer-template substrates were constructed as described in the figure legends. In all substrates, the 3′-end regions of the downstream primers share homology with the 5′-ends of their respective templates. Each upstream primer was annealed to the proper template to create a nick between the 3′-end of the upstream primer and the 5′-end of the downstream primer. Prior to annealing, the 5′-radiolabeled primers were generated utilizing [γ-32P]ATP and T4 polynucleotide kinase according to the manufacturer's instructions. Unincorporated radionucleotides were removed with Micro Bio-Spin 30 chromatography columns. All radiolabeled primers were purified by gel isolation from a 15% polyacrylamide, 7m urea denaturing gel prior to annealing. Substrates were annealed by mixing 2 pmol of the respective downstream primer with 5 pmol of the corresponding template in annealing buffer (10 mm Tris base, 50 mm KCl, and 1 mmEDTA, pH 8.0) to a final volume of 30 μl. The mixtures were heated to 95 °C for 5 min and allowed to cool to room temperature. A corresponding upstream primer (10 pmol) was subsequently added and annealed by incubating at 37 °C for 1 h. The circular substrate was generated by annealing the downstream primer (D2), the template (pBS(+)), and the upstream primer (U3) at a molar ratio of 1:2.5:5, respectively. The mixture was heated to 95 °C for 5 min and subsequently cooled to room temperature.Table IOligonucleotide sequences (5′–3′)Downstream primersD1(18-mer)GTAAAACGACGGCCAGTGD2(30-mer)GCTCACAATTCCACACAACATACGAGCCGGD3(37-mer)ACTAACAGGCGTGAAACGGGCGAATTCGAGCTCGGTAUpstream primers1-aThe underlined nucleotide indicates a biotin modification.U1(25-mer)CGCCAGGGTTTTCCCAGTCACGACCU2(25-mer)CGCCAGGGTTTTCCCAGTCACGACCU3(30-mer)ATAGCTGTTTCCTGTGTGAAATTGTTATCCU4(38-mer)CCCAGTCACGTCGTTGTAAAACGACGGCCAGTGAATTATemplates1-aThe underlined nucleotide indicates a biotin modification.T1(44-mer)GCACTGGCCGTCGTTTTACGGTCGTGACTGGGAAAACCCTGGCGT2(44-mer)GCACTGGCCGTCGTTTTACGGTCGTGACTGGGAAAACCCTGGCGT3(61-mer)TCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATT4(76-mer)GTACCGAGCTCGAATTCGCCCGTTTCACGCCTGTTAGTTAATTCACTGGCCGTCGTTTTACAACGACGTGACTGGG1-a The underlined nucleotide indicates a biotin modification. Open table in a new tab The reactions containing the indicated amounts of substrate, DNA ligase I or T4 DNA ligase, and PCNA were performed in reaction buffer (30 mm HEPES, pH 7.6, 40 mmKCl, 0.01% Nonidet P-40, 0.1 mg/ml bovine serum albumin, 8 mm MgCl2, and 0.1 mm ATP). The reactions were incubated at 37 °C, terminated with 20 μl of formamide dye (90% formamide (v/v) with bromphenol blue and xylene cyanole), and heated to 95 °C for 5 min. After separation on a 15% polyacrylamide, 7 m urea denaturing gel, products were detected by PhosphorImager (Molecular Dynamics) analysis. Phosphorylation of DNA ligase I was performed by incubating 10 fmol of DNA ligase I with 5 × 10−3 milliunits of casein kinase II at 30 °C for 10 min (0.1 mm ATP). For the biotin-streptavidin assay, the substrate was incubated with PCNA either before or after the addition of streptavidin. Conjugation of streptavidin (added in a 50-fold molar excess over substrate) to the biotinylated substrate was accomplished by placing the reactions at 4 °C for 10 min. These reactions contained 1 fmol of DNA ligase I. The reactions utilizing human RFC were performed in a buffer containing 30 mm Tris-HCl, pH 7.5, 100 mm NaCl, 0.01% Nonidet P-40, 0.1 mg/ml bovine serum albumin, 1 mmdithiothreitol, 8 mm MgCl2, and 0.1 mm ATP. All assays were performed at least in triplicate. Reactions were performed in binding buffer (30 mm HEPES, pH 7.6, 40 mm KCl, 0.01% Nonidet P-40, 0.1 mg/ml bovine serum albumin, and 0.1 mm ATP) in a final reaction volume of 20 μl. After incubation at 4 °C for 15 min, products were separated on a 1% agarose, 0.5% polyacrylamide gel in 0.25× TBE (8.9 mm Tris base, 8.9 mm boric acid, and 0.2 mm EDTA, pH 8.0) and visualized by PhosphorImager (Molecular Dynamics) analysis. The assays were performed at least in triplicate. We first examined whether the presence of PCNA influences catalysis by DNA ligase I (Fig.1 A). Lane 1 only contains PCNA, and lane 2 only contains DNA ligase I. Titration of PCNA into the reactions (lanes 3–7) results in a progressive stimulation of product formation. Because the only proteins in these reactions are DNA ligase I and PCNA, the observed enhancement of ligation activity must derive from PCNA. There is an approximate 5-fold enhancement of ligation activity at the highest concentration of PCNA. The addition of an unrelated protein, E. coli single-stranded DNA-binding protein, to the DNA ligase I reaction did not result in any stimulation of ligation activity (data not shown). All experiments were performed in excess bovine serum albumin. The presence of this added protein did not affect DNA ligase I activity (data not shown). It was also important to determine the specificity of the interaction between PCNA and DNA ligase I. Stimulation of other ligases would imply that the mechanism is nonspecific and does not depend on contacts between the two proteins. Therefore, PCNA was titrated into a T4 DNA ligase reaction (Fig. 1 B). The results (lanes 3–7) show no additional accumulation of ligation product. This observation illustrates the specificity of the interaction between PCNA and DNA ligase I. Fig. 2 A shows a time course illustrating the activity of DNA ligase I in the absence and the presence of PCNA. A fixed concentration of PCNA was utilized as determined by the experiment shown in Fig. 1 A. The presence of PCNA caused a substantial stimulation of ligation activity throughout the time course. Fig. 2 B shows a second time course demonstrating stimulation of ligation with a substrate of different sequence and different length upstream and downstream primers than the substrate in Fig. 2 A. In both cases, the rate of ligation was enhanced 3–4-fold. PCNA enhances the binding of various proteins to their corresponding substrates (24Warbrick E. Bioessays. 2000; 22: 997-1006Crossref PubMed Scopus (353) Google Scholar). Analysis of the interaction between PCNA and FEN1 reveals that PCNA enhances FEN1 binding stability, allowing for greater cleavage efficiency (13Tom S. Henricksen L.A. Bambara R.A. J. Biol. Chem. 2000; 275: 10498-10505Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar). Therefore, we considered the possibility that PCNA stimulates DNA ligase I by a similar mechanism. We examined the effect of PCNA on DNA ligase I interaction with its substrate using an electrophoretic mobility shift assay (Fig.3). Incubation of the substrate with a high concentration of DNA ligase I clearly results in the formation of a DNA-ligase complex (lane 7). Lane 7 of Fig. 3identifies the band corresponding to the DNA-ligase complex. Utilizing a lower concentration of DNA ligase I, the addition of progressively higher concentrations of PCNA increased the observed amount of the DNA-ligase complex (lanes 4–6). These results demonstrate that the binding of DNA ligase I to its substrate is enhanced by PCNA in a concentration-dependent manner. Furthermore, incubation of the substrate with a high level of PCNA alone failed to result in the formation of a protein complex with DNA (lane 2). These results suggest that greater ligation efficiency is the result of higher affinity binding of the ligase to DNA, which is achieved through an interaction with PCNA. DNA ligase I is a substrate for casein kinase II (51Prigent C. Lasko D.D. Kodama K. Woodgett J.R. Lindahl T. EMBO J. 1992; 11: 2925-2933Crossref PubMed Scopus (67) Google Scholar). The N-terminal region of DNA ligase I possesses several putative phosphorylation sites. This region contains seven casein kinase II consensus sites, and two of these sites (Ser66 and Ser141) have properties that are optimal for casein kinase II phosphorylation (28Rossi R. Villa A. Negri C. Scovassi I. Ciarrocchi G. Biamonti G. Montecucco A. EMBO J. 1999; 18: 5745-5754Crossref PubMed Scopus (69) Google Scholar). At the end of the S phase of the cell cycle, DNA ligase I is thought to be phosphorylated by casein kinase II (28Rossi R. Villa A. Negri C. Scovassi I. Ciarrocchi G. Biamonti G. Montecucco A. EMBO J. 1999; 18: 5745-5754Crossref PubMed Scopus (69) Google Scholar). Although phosphorylation does not inactivate DNA ligase I for catalysis, it prevents interaction of DNA ligase I with the DNA replication apparatus (24Warbrick E. Bioessays. 2000; 22: 997-1006Crossref PubMed Scopus (353) Google Scholar). Therefore, we were interested in determining whether phosphorylation of DNA ligase I affects PCNA stimulation of ligation activity. In Fig.4, the addition of PCNA to reactions with unphosphorylated DNA ligase I leads to enhanced formation of the product (lanes 3–4). Phosphorylation of DNA ligase I results in a slight reduction of catalytic activity (lane 6). This small reduction in activity is possibly a result of phosphorylation itself or of the presence of casein kinase II. Titration of PCNA into the reactions with phosphorylated DNA ligase I does not reveal any stimulat
Referência(s)