Collagen XII Interacts with Avian Tenascin-X through Its NC3 Domain
2006; Elsevier BV; Volume: 281; Issue: 37 Linguagem: Inglês
10.1074/jbc.m603147200
ISSN1083-351X
AutoresGuido Veit, Uwe Hansen, Douglas R. Keene, Peter Brückner, Ruth Chiquet‐Ehrismann, Matthias Chiquet, Manuel Koch,
Tópico(s)Platelet Disorders and Treatments
ResumoLarge oligomeric proteins often contain several binding sites for different molecules and can therefore induce formation of larger protein complexes. Collagen XII, a multidomain protein with a small collagenous region, interacts with fibrillar collagens through its C-terminal region. However, no interactions to other extracellular proteins have been identified involving the non-collagenous N-terminal NC3 domain. To further elucidate the components of protein complexes present close to collagen fibrils, different extracellular matrix proteins were tested for interaction in a solid phase assay. Binding to the NC3 domain of collagen XII was found for the avian homologue of tenascin-X that in humans is linked to Ehlers-Danlos disease. The binding was further characterized by surface plasmon resonance spectroscopy and supported by immunohistochemical co-localization in chick and mouse tissue. On the ultrastructural level, detection of collagen XII and tenascin-X by immunogold labeling confirmed this finding. Large oligomeric proteins often contain several binding sites for different molecules and can therefore induce formation of larger protein complexes. Collagen XII, a multidomain protein with a small collagenous region, interacts with fibrillar collagens through its C-terminal region. However, no interactions to other extracellular proteins have been identified involving the non-collagenous N-terminal NC3 domain. To further elucidate the components of protein complexes present close to collagen fibrils, different extracellular matrix proteins were tested for interaction in a solid phase assay. Binding to the NC3 domain of collagen XII was found for the avian homologue of tenascin-X that in humans is linked to Ehlers-Danlos disease. The binding was further characterized by surface plasmon resonance spectroscopy and supported by immunohistochemical co-localization in chick and mouse tissue. On the ultrastructural level, detection of collagen XII and tenascin-X by immunogold labeling confirmed this finding. The integrity of extracellular matrix is maintained by supramolecular networks assembled by a large variety of matrix macromolecules. Among those is the group of 28 different collagen types so far described in the literature. Collagens are further subdivided into several families reflecting their assembly-forming properties (1Myllyharju J. Kivirikko K.I. Trends. Genet. 2004; 20: 33-43Abstract Full Text Full Text PDF PubMed Scopus (894) Google Scholar). As a common feature, fibril-associated collagens with interrupted triple helices (FACITs) 2The abbreviations used are: FACIT, fibril-associated collagen with interrupted triple helices; Col, collagenous domain; NC, non-collagenous domain; TBS, Tris-buffered saline; TN, tenascin; DMEM, Dulbecco's modified Eagle's medium. comprise at least two collagenous domains interrupted by non-collagenous domains. Collagen XII is a member of the FACIT subfamily, and its three chains are encoded by a single gene. The two collagenous domains (Col1 and Col2) are interrupted and flanked by three non-collagenous domains (NC1-NC3), of which the large trimeric NC3 domain contains up to 90% of the molecular mass of collagen XII. The N-terminal NC3 part of each polypeptide chain consists of two to four von Willebrand factor type A domains, several fibronectin type III repeats, and a thrombospondin N-terminal domain (2Gordon M.K. Gerecke D.R. Olsen B.R. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 6040-6044Crossref PubMed Scopus (98) Google Scholar, 3Yamagata M. Yamada K.M. Yamada S.S. Shinomura T. Tanaka H. Nishida Y. Obara M. Kimata K. J. Cell Biol. 1991; 115: 209-221Crossref PubMed Scopus (95) Google Scholar). The size of the protein is variable due to two alternative splice sites located at the 5′- and 3′-ends of the collagen XII mRNA. Especially remarkable is the splicing mechanism that produces mRNA encoding for NC3 domains that differ ∼100 kDa in mass, denoted as XIIA for the large form and as XIIB for the small form (4Koch M. Bernasconi C. Chiquet M. Eur. J. Biochem. 1992; 207: 847-856Crossref PubMed Scopus (40) Google Scholar, 5Trueb J. Trueb B. Biochim. Biophys. Acta. 1992; 1171: 97-98Crossref PubMed Scopus (33) Google Scholar). The other alternative splicing generates two NC1 domains of similar size, termed -1 or -2, which results in the nomenclature of the four different collagen XII isoforms: XIIA-1, XIIA-2, XIIB-1 and XIIB-2 (for overview of the domain structure please refer to Fig. 2A) (6Kania A.M. Reichenberger E. Baur S.T. Karimbux N.Y. Taylor R.W. Olsen B.R. Nishimura I. J. Biol. Chem. 1999; 274: 22053-22059Abstract Full Text Full Text PDF PubMed Scopus (30) Google Scholar). The isoforms differ in their histological and developmental distribution: the large forms XIIA-1 and XIIA-2 are preferably expressed during embryonic stages, whereas the expression of the small forms persists in adult tissues (7Bohme K. Li Y. Oh P.S. Olsen B.R. Dev. Dyn. 1995; 204: 432-445Crossref PubMed Scopus (52) Google Scholar). Furthermore, the small isoform XIIB-1 predominantly occurs in ligaments and tendons, whereas the XIIB-2 shows a more widespread expression (6Kania A.M. Reichenberger E. Baur S.T. Karimbux N.Y. Taylor R.W. Olsen B.R. Nishimura I. J. Biol. Chem. 1999; 274: 22053-22059Abstract Full Text Full Text PDF PubMed Scopus (30) Google Scholar). The isoforms also differ in their biochemical properties. The large forms contain an additional heparin binding site in the 7th fibronectin type III domain; in addition, covalently linked glycosaminoglycan chains are attached to them (4Koch M. Bernasconi C. Chiquet M. Eur. J. Biochem. 1992; 207: 847-856Crossref PubMed Scopus (40) Google Scholar, 8Koch M. Bohrmann B. Matthison M. Hagios C. Trueb B. Chiquet M. J. Cell Biol. 1995; 130: 1005-1014Crossref PubMed Scopus (95) Google Scholar), whereas alternative splicing in the NC1 domain leads to an additional heparin binding site in the XIIA/B-1 form (9Aubert-Foucher E. Goldschmidt D. Jaquinod M. Mazzorana M. Biochem. Biophys. Res. Commun. 2001; 286: 1131-1139Crossref PubMed Scopus (2) Google Scholar). Collagen XII also interacts with decorin (10Font B. Eichenberger D. Goldschmidt D. Boutillon M.M. Hulmes D.J. Eur. J. Biochem. 1998; 254: 580-587Crossref PubMed Scopus (50) Google Scholar) and is a component of collagen I-containing fibrils (8Koch M. Bohrmann B. Matthison M. Hagios C. Trueb B. Chiquet M. J. Cell Biol. 1995; 130: 1005-1014Crossref PubMed Scopus (95) Google Scholar, 11Keene D.R. Lunstrum G.P. Morris N.P. Stoddard D.W. Burgeson R.E. J. Cell Biol. 1991; 113: 971-978Crossref PubMed Scopus (147) Google Scholar). Tenascins are a distinct family of extracellular matrix proteins with four members in vertebrates (TN-C, TN-R, TN-W, and TN-X). They all exhibit a similar domain structure with an N-terminal oligomerization domain, a series of epidermal growth factor modules followed by several fibronectin type III domains and a large globular fibrinogen-related domain (for review see Ref. 12Jones F.S. Jones P.L. Dev. Dyn. 2000; 218: 235-259Crossref PubMed Scopus (557) Google Scholar). Mammalian tenascin-X can associate with collagen I-containing fibrils through binding to the glycosaminoglycan chains of the small fibril-associated proteoglycan, decorin (13Lethias C. Descollonges Y. Boutillon M.M. Garrone R. Matrix Biol. 1996; 15: 11-19Crossref PubMed Scopus (45) Google Scholar, 14Lethias C. Elefteriou F. Parsiegla G. Exposito J.Y. Garrone R. J. Biol. Chem. 2001; 276: 16432-16438Abstract Full Text Full Text PDF PubMed Scopus (34) Google Scholar, 15Elefteriou F. Exposito J.Y. Garrone R. Lethias C. FEBS Lett. 2001; 495: 44-47Crossref PubMed Scopus (92) Google Scholar). In addition, cells in culture adhere to tenascin-X through interaction with integrin receptors (16Elefteriou F. Exposito J.Y. Garrone R. Lethias C. Eur. J. Biochem. 1999; 263: 840-848Crossref PubMed Scopus (47) Google Scholar). The first indication for the function of tenascin-X in vivo was derived from the finding that human patients lacking the protein develop a connective tissue disorder, Ehlers-Danlos syndrome (17Burch G.H. Gong Y. Liu W. Dettman R.W. Curry C.J. Smith L. Miller W.L. Bristow J. Nat. Genet. 1997; 17: 104-108Crossref PubMed Scopus (279) Google Scholar). Today, the suggestion is widely accepted that tenascin-X is a regulator of collagen deposition in vivo, consistent with a reduced density of collagen fibrils in the skin of tenascin-X null mice (18Mao J.R. Taylor G. Dean W.B. Wagner D.R. Afzal V. Lotz J.C. Rubin E.M. Bristow J. Nat. Genet. 2002; 30: 421-425Crossref PubMed Scopus (206) Google Scholar). However, the molecular mechanism behind these findings still remains elusive (19Bristow J. Carey W. Egging D. Schalkwijk J. Am. J. Med. Genet. C Semin. Med. Genet. 2005; 139: 24-30Crossref Scopus (85) Google Scholar). A closely related gene and protein have been identified in the chick (20Hagios C. Brown-Luedi M. Chiquet-Ehrismann R. Exp. Cell Res. 1999; 253: 607-617Crossref PubMed Scopus (19) Google Scholar, 21Hagios C. Koch M. Spring J. Chiquet M. Chiquet-Ehrismann R. J. Cell Biol. 1996; 134: 1499-1512Crossref PubMed Scopus (82) Google Scholar). The avian protein is most homologous to mammalian tenascin-X in its C-terminal region and shares with it a serine/proline-rich domain but has smaller subunits with only one (instead of 18) complete epidermal growth factor repeats and with fibronectin type III modules not related in sequence to any other avian or vertebrate tenascin. At the time of discovery, these considerable differences justified a new name, tenascin-Y, for the avian protein (20Hagios C. Brown-Luedi M. Chiquet-Ehrismann R. Exp. Cell Res. 1999; 253: 607-617Crossref PubMed Scopus (19) Google Scholar, 21Hagios C. Koch M. Spring J. Chiquet M. Chiquet-Ehrismann R. J. Cell Biol. 1996; 134: 1499-1512Crossref PubMed Scopus (82) Google Scholar, 22Fluck M. Tunc-Civelek V. Chiquet M. J. Cell Sci. 2000; 113: 3583-3591PubMed Google Scholar). However, recent phylogenetic studies of the tenascin gene family in chordates revealed that chick tenascin-Y belongs to the tenascin-X branch and that it is more closely related to mammalian than to Xenopus tenascin-X. 3Tucker, R. P., Drabikowski, K., Hess, J. F., Ferralli, J., Chiquet-Ehrismann, R., and Adams, J. C., BMC Evol. Biol., in press. The human tenascin-X gene is located in the human MHCIII locus on chromosome 6q21.3, a locus that, according to comparative mapping information corresponds to chicken chromosome 16 (23Groenen M.A. Cheng H.H. Bumstead N. Benkel B.F. Briles W.E. Burke T. Burt D.W. Crittenden L.B. Dodgson J. Hillel J. Lamont S. de Leon A.P. Soller M. Takahashi H. Vignal A. Genome Res. 2000; 10: 137-147PubMed Google Scholar). At this location, the chicken tenascin-Xgene is in immediate synteny with the complement C4, TAP1, TAP2, and MHC-II-like genes that represent orthologues of the genes present in the human MHCIII locus next to the human tenascin-X gene, proving a common evolutionary origin for this genomic region. 3Tucker, R. P., Drabikowski, K., Hess, J. F., Ferralli, J., Chiquet-Ehrismann, R., and Adams, J. C., BMC Evol. Biol., in press. For these reasons, it is justified to abandon the former name tenascin-Y and to call the protein “avian tenascin-X” instead. For collagen XII, the function as a modulator of tissue biomechanical properties by bridging collagen I-containing fibrils to other extracellular matrix components has been suggested (24Nishiyama T. McDonough A.M. Bruns R.R. Burgeson R.E. J. Biol. Chem. 1994; 269: 28193-28199Abstract Full Text PDF PubMed Google Scholar, 25Shaw L.M. Olsen B.R. Trends Biochem. Sci. 1991; 16: 191-194Abstract Full Text PDF PubMed Scopus (252) Google Scholar). Our findings reported here support this concept. Avian tenascin-X interacts with the NC3 domain of avian collagen XII, thereby establishing a mechanical coherence of banded collagen fibrils with their extrafibrillar environment. Antibodies and Antibody Production—Antibodies against mouse collagen XII were produced as described previously (26Veit G. Kobbe B. Keene D.R. Paulsson M. Koch M. Wagener R. J. Biol. Chem. 2006; 281: 3494-3504Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar). Briefly, cDNA coding for the fibronectin type III domains 14-18 of the mouse collagen XII was amplified by PCR using primers that introduced a NheI restriction site at the 5′-end and a BamHI site at the 3′-end (M193, forward, CACGCTAGCAGAGGACTGTCAAGAAACATCC and M194, reverse, TTGGGATCCTTAGGTCTGTTCTTTGATGGGGACA). The cDNA was cloned into a modified pPET (EMD Biosciences) vector carrying a His6 tag with a thrombin cleavage site. Upon transformation with the recombinant plasmid, Escherichia coli cells (Bl21; EMD Biosciences) were induced with 1 mm isopropyl-1-thio-β-d-galactopyranoside and grown for 16 h at 30 °C. The cells were harvested (15 min, 5000 × g, 4 °C) and resuspended in Tris-buffered saline, pH 8.0, containing 7 m urea. The bacteria were sonicated, followed by removal of insoluble cell debris by centrifugation (30 min, 20000 × g, 4 °C). After 2-fold dilution with H2O the supernatant was applied to a nickel-chelating Sepharose column (GE Healthcare) and eluted with binding buffer containing 40-80 mm imidazole. Following removal of urea by dialysis, thrombin cleavage was performed overnight at room temperature (5 mm CaCl2, 1 unit/mg thrombin; Sigma-Aldrich), and the cleaved His6 tag was removed by passing the solution again over a nickel-chelating Sepharose column. The recombinant protein was used to immunize a rabbit from which the antiserum was purified by affinity chromatography on a column with antigen coupled to CNBr-activated Sepharose (GE Healthcare). The specific antibody, termed KR33, was eluted with 150 mm NaCl, 0.1 m triethylamine, pH 11.5, and the eluate neutralized with 1 m Tris-HCl, pH 6.8. Polyclonal rabbit antibody against chick collagen XII (522) (8Koch M. Bohrmann B. Matthison M. Hagios C. Trueb B. Chiquet M. J. Cell Biol. 1995; 130: 1005-1014Crossref PubMed Scopus (95) Google Scholar), polyclonal chick antibody against mouse tenascin-X (KX3), polyclonal rabbit antibody against chick tenascin-X (KX8) (21Hagios C. Koch M. Spring J. Chiquet M. Chiquet-Ehrismann R. J. Cell Biol. 1996; 134: 1499-1512Crossref PubMed Scopus (82) Google Scholar, 27Matsumoto K. Saga Y. Ikemura T. Sakakura T. Chiquet-Ehrismann R. J. Cell Biol. 1994; 125: 483-493Crossref PubMed Scopus (148) Google Scholar), and polyclonal rabbit antibody against chick tenascin-C (TN474) (28Chiquet M. Fambrough D.M. J. Cell Biol. 1984; 98: 1926-1936Crossref PubMed Scopus (343) Google Scholar) have been characterized before. SDS-Polyacrylamide Gel Electrophoresis and Determination of Protein Concentration—SDS-polyacrylamid gel electrophoresis (SDSPAGE) was performed as described by Laemmli (29Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207537) Google Scholar). 1.3 μg of protein/lane was separated on 3-10% SDSPAGE gradient gels under either reducing or non-reducing conditions and visualized with a silver staining kit (Invitrogen) according to the manufacturer's instructions. Protein concentrations were determined using a binicotinic acid assay kit (Uptima) following the manufacturer's instructions. Solid Phase Binding Assay—The production of recombinant avian tenascin-X (formerly tenascin-Y) has been described previously (20Hagios C. Brown-Luedi M. Chiquet-Ehrismann R. Exp. Cell Res. 1999; 253: 607-617Crossref PubMed Scopus (19) Google Scholar). Tenascin-C and collagen XII were purified from chick embryo fibroblast-conditioned medium by monoclonal antibody affinity chromatography following established procedures (8Koch M. Bohrmann B. Matthison M. Hagios C. Trueb B. Chiquet M. J. Cell Biol. 1995; 130: 1005-1014Crossref PubMed Scopus (95) Google Scholar, 30Chiquet M. Fambrough D.M. J. Cell Biol. 1984; 98: 1937-1946Crossref PubMed Scopus (228) Google Scholar). To calculate the molar concentrations of the proteins utilized for titration measurements, the molecular masses of the monomeric forms of avian tenascin-X (205 kDa), avian tenascin-C (200 kDa), and the mean value of the small and large splice variants of avian collagen XII, estimating a molar ratio of 1:1 (274.5 kDa), were used. Purified proteins were diluted in TBS, pH 7.4, and 5 μg/ml (250 ng/well) were coated onto 96-well plates (Nunc Maxisorb) at 4 °C overnight. After washing with TBS, unspecific binding sites were blocked at room temperature with 5% skimmed milk powder in TBS for 2 h. Ligands were diluted in blocking buffer to concentrations from 0.03 to 300 nm for the tenascins or 0.023 to 230 nm for collagen XII and incubated for 1.5 h. For competition experiments the competitor was added to the ligand solution before incubation. After removing excess ligand by washing twice with TBS, bound ligand was fixed with 2.5% (v/v) glutaraldehyde for 10 min. Bound ligands were detected with specific affinity-purified antibodies, rabbit against chick collagen XII (522), chick tenascin-X (KX8), or chick tenascin-C (TN474) followed by swine anti-rabbit horseradish peroxidase-coupled IgG (Dako Cytomation). For enzymatic reaction, wells were incubated with 50 μl of 0.25 mm tetramethylbenzidine and 0.005% (v/v) H2O2 in 0.1 m sodium acetate, pH 6.0, for 10 min. The reaction was stopped with 50 ml/well 2.5 m H2SO4, and the absorbance was measured at 450 nm using a microplate reader (Labsystems Multiscan MS). For analysis, measurements of wells treated equally, except for the addition of ligand, were subtracted as blank values. All buffers contained 2 mm CaCl2. Surface Plasmon Resonance Spectroscopy—Surface plasmon resonance spectroscopy was performed using a Biacore 2000 (BIAcore AB) system. Avian tenascin-X, fulllength avian collagen XII, and the purified collagen XII NC3 domain were coupled in 25 mm sodium acetate, pH 4.7, with a flow rate of 5 μl/min to a CM5 chip. The chip was previously activated with N-hydroxysuccinimide and 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride. After coupling the required amount of protein (∼1000 response units), unbound reactive groups were saturated with 1 m ethanolamine hydrochloride, pH 8.5. Experiments were carried out using different concentrations (3, 10, 30, and 100 nm) of avian tenascin-X and full-length collagen XII diluted in running buffer (20 mm Hepes, 150 mm NaCl, 2 mm CaCl2, 0.005% P20). The analyte was passed over the sensor chip with a constant flow rate of 30 μl/min for 120 s, and dissociation was measured over 350 s. Fittings of the data, overlay plots, and calculation of KD values were done with BIAevaluation software 3.2. Collagenase Digestion—To generate avian collagen XII molecules consisting only of the trimeric NC3 domain, i.e. lacking their collagenous parts as well as the NC1 and NC2 domains, the protein was subjected to collagenase digestion. A solution of 77 nm collagen XII was incubated with 100 units/ml highly purified collagenase (CLSPA; Worthington Biochemicals) in TBS containing 5 mm CaCl2 and 1 mm 4-(2-aminoethyl)benzylsulfonyl fluoride (Roche Applied Science) for 4 h at37°C. Collagenase-treated collagen XII was immediately used for SDS-PAGE and solid phase binding assay. Alternatively, the NC3 domain was separated from collagenase and digestion fragments by running the sample over a gel filtration column (Superose 12 HR 10/30; GE Healthcare). Immunohistochemistry—Immunohistochemistry was performed on cryosections of embryonic chick (E14.5) and newborn mouse (P1). The frozen sections were preincubated in ice-cold methanol for 2 min, blocked for 1 h with 5% normal goat serum in phosphate-buffered saline containing 0.2% Tween 20, and incubated with the primary antibodies against collagen XII (KR33 or 522) overnight at 4 °C followed by Cy™3-conjugated goat anti-rabbit IgG (Dako Cytomation). For co-staining of mouse sections a chick antibody against tenascin-X (KX3) was used followed by Cy™2-conjugated donkey anti-chick IgG (Dako Cytomation). For co-staining of chick sections, the 522 antibody was biotinylated using Biotin-X-NHS (Calbiochem) according to the manufacturer's instructions. Co-staining was accomplished using sequential incubation, first with KX8 antibody for detection of tenascin-X followed by incubation with Cy™2-conjugated affinity-purified Fab fragment goat anti-rabbit IgG (Dianova), and second with biotinylated 522 antibody followed by Cy™3-conjugated anti-biotin antibody (Sigma). Stained sections were analyzed, and pictures were taken with a confocal laser scanning microscope (Leica TCS SL) using two lasers in parallel with the excitation wavelengths 488 nm for Cy™2 and 543 nm for Cy™3. Immunoelectron Microscopy—Fragments of native collagen fibrils were isolated from newborn mouse skin, placed on grids, immunostained with KR33, KX3, and colloidal gold-labeled secondary antibodies, and analyzed by transmission electron microscopy as previously described (31Kassner A. Hansen U. Miosge N. Reinhardt D.P. Aigner T. Bruckner-Tuderman L. Bruckner P. Grassel S. Matrix Biol. 2003; 22: 131-143Crossref PubMed Scopus (91) Google Scholar). Pre-Embedding immunogold labeling of mouse skin was carried out as previously described (32Sakai L.Y. Keene D.R. Methods Enzymol. 1994; 245: 29-52Crossref PubMed Scopus (80) Google Scholar). 15-day embryonic chick skin was harvested fresh, rinsed briefly in Dulbecco's modification of Eagle's medium (DMEM), and then immersed in antibody diluted 1:5 in DMEM overnight at 4 °C. The tissues were rinsed for several hours in DMEM and then immersed in appropriate 10-nm gold secondary conjugate (GAR G10; Amersham Biosciences) overnight at 4 °C. Following an extensive rinse in DMEM the tissues were fixed in 1.5% glutaraldehyde/1.5% paraformaldehyde with 0.05% tannic acid, rinsed, and then post-fixed in 1% OsO4. Following dehydration in ethanol, the tissues were embedded in Spurr's epoxy and 80-nm-thick sections were contrasted with uranyl acetate and lead citrate and examined using a Philips 410 TEM. Adult mouse skin was rinsed extensively in DMEM and then immersed overnight in antibody diluted 1:10 in DMEM. Following a 4-h rinse in DMEM, tissues were immersed in appropriate 1-nm gold secondary conjugate (Amersham Biosciences GAR G1 for type XII antibody or Aurion GACh ultrasmall for TN-X) and then rinsed extensively in DMEM followed by a brief rinse in phosphate-buffered saline. Gold particles were then enhanced using the Nanoprobes GEEM gold enhance kit. Briefly, tissue in buffer is chilled on ice, incubated on ice for 15 min in complete enhance solution, and then warmed quickly to 25 °C and incubated for 5 min. Tissue is rinsed in ice-cold phosphate-buffered saline and then in 0.1 m cacodylate buffer. After gold enhancement, the tissue is fixed in 1.5% glutaraldehyde/1.5% paraformaldehyde containing 0.05% tannic acid and then dehydrated, embedded and stained, and observed as described above. Interaction between Collagen XII and Tenascin-X—In a solid phase binding screen for possible interaction partners of avian collagen XII, we discovered avian tenascin-X as a possible candidate. Titration experiments showed saturable binding using either collagen XII or tenascin-X as the soluble ligand. Because of its similar domain structure (33Jones F.S. Hoffman S. Cunningham B.A. Edelman G.M. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 1905-1909Crossref PubMed Scopus (152) Google Scholar), tenascin-C was used as a negative control (Fig. 1, A and B). To calculate the molar protein concentrations for the titration measurements, the molecular masses of the monomeric forms of avian tenascin-X (205 kDa) and a mean value of the small and large splice variants of avian collagen XII, estimating a molar ratio of 1:1, (274.5 kDa) were used. In the titration experiment, half-maximal saturation was reached at a concentration of soluble collagen XII of 2.5 ± 0.5 × 10-8 m. When tenascin-X was the soluble binding partner, half-maximal saturation was found at 1.5 ± 0.5 × 10-8 m, i.e. at a closely comparable concentration. The small discrepancy might originate from different avidities of the oligomeric forms of the two proteins. To validate the results, surface plasmon resonance spectroscopy was performed and the associations and dissociations of the obtained binding curves were analyzed in a Langmuir 1:1 binding model (Fig. 1, C and D). Apparent KD values for collagen XII as soluble interaction partner of 1.34 × 10-8 m and for soluble tenascin-X of 6.44 × 10-9 m were calculated, which is in good agreement with the solid phase binding data. The purity of the isolated proteins was checked by reducing and non-reducing SDS-PAGE (Fig. 2B). Avian tenascin-X occurs in trimeric and hexameric forms (20Hagios C. Brown-Luedi M. Chiquet-Ehrismann R. Exp. Cell Res. 1999; 253: 607-617Crossref PubMed Scopus (19) Google Scholar) containing at least three or six binding sites for collagen XII. Upon reduction the oligomeric forms dissociate into monomers. A similar pattern can be observed for tenascin-C, whose splice variants result in three bands on reducing gels (28Chiquet M. Fambrough D.M. J. Cell Biol. 1984; 98: 1926-1936Crossref PubMed Scopus (343) Google Scholar, 33Jones F.S. Hoffman S. Cunningham B.A. Edelman G.M. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 1905-1909Crossref PubMed Scopus (152) Google Scholar). Collagen XII can exist as homo- or heterotrimeric combinations of the small and the large splice variants, which represent the four major bands on non-reducing SDS-PAGE. Upon reduction, the polypeptide pattern is complex but entirely explainable (8Koch M. Bohrmann B. Matthison M. Hagios C. Trueb B. Chiquet M. J. Cell Biol. 1995; 130: 1005-1014Crossref PubMed Scopus (95) Google Scholar). The trimeric forms dissociate into large and small monomers and into various non-reducible dimers. Additional bands on reducing SDS-PAGE are due to glycosaminoglycan side chains attached to the large isoform of collagen XII (4Koch M. Bernasconi C. Chiquet M. Eur. J. Biochem. 1992; 207: 847-856Crossref PubMed Scopus (40) Google Scholar). The NC3 Domain of Collagen XII Contains the Binding Site for Tenascin-X—Collagen XII interacts with collagen I-containing fibrils through its collagenous domain (8Koch M. Bohrmann B. Matthison M. Hagios C. Trueb B. Chiquet M. J. Cell Biol. 1995; 130: 1005-1014Crossref PubMed Scopus (95) Google Scholar). Additionally, two interaction sites for heparin are known, one at the very end of a C-terminal splice variant (6Kania A.M. Reichenberger E. Baur S.T. Karimbux N.Y. Taylor R.W. Olsen B.R. Nishimura I. J. Biol. Chem. 1999; 274: 22053-22059Abstract Full Text Full Text PDF PubMed Scopus (30) Google Scholar, 9Aubert-Foucher E. Goldschmidt D. Jaquinod M. Mazzorana M. Biochem. Biophys. Res. Commun. 2001; 286: 1131-1139Crossref PubMed Scopus (2) Google Scholar) and the other within the 7th fibronectin type III domain of the large form of collagen XII (8Koch M. Bohrmann B. Matthison M. Hagios C. Trueb B. Chiquet M. J. Cell Biol. 1995; 130: 1005-1014Crossref PubMed Scopus (95) Google Scholar). To exclude the heparin binding sites being involved in binding of collagen XII to tenascin-X, competition experiments were performed. Even in 130-fold molar excess, heparin had no effect on the binding of collagen XII to tenascin-X (Fig. 3A). To study the contribution of the collagenous region (consisting of domains NC1, Col1, NC2, and Col2) of collagen XII in the binding process, collagenase digestion was performed. Treatment of collagen XII with highly purified bacterial collagenase simplified the complex pattern in reducing SDS-PAGE to two major bands that represent the NC3 domains of the small and large splice variants of the protein (Fig. 3B). The NC3 domain was purified via gel filtration chromatography, and because the cysteines are not removed the NC3 remains a trimeric molecule. (Fig. 3B, lane 4). In solid phase binding assays, collagenase-treated collagen XII showed a similar interaction with immobilized tenascin-X compared with the intact protein (Fig. 3C). To confirm those results, the purified NC3 domains were measured in surface resonance spectroscopy interaction experiments; from the obtained curves the apparent KD for the binding of soluble tenascin-X to the fragment is 5.90 × 10-9 m (Fig. 3D), i.e. very similar to intact collagen XII (cf. Fig. 1D). Taken together these results indicate that the binding site(s) for tenascin-X reside within the NC3 domain of collagen XII. Partial Co-distribution of Collagen XII with Tenascin-X in Chick Skin and Muscle—The extracellular matrix of skeletal muscle is arranged in three levels: the individual muscle fibers are surrounded by the endomysium, bundles of muscle fibers are encased by the perimysium, and the complete muscle is embedded in the epimysium. It is known that chick tenascin-X is a component of muscle extracellular matrix and is primarily situated in the epimysium and perimysium of developing muscles, whereas tendons are negative for tenascin-X, both at the mRNA and the protein level (20Hagios C. Brown-Luedi M. Chiquet-Ehrismann R. Exp. Cell Res. 1999; 253: 607-617Crossref PubMed Scopus (19) Google Scholar, 21Hagios C. Koch M. Spring J. Chiquet M. Chiquet-Ehrismann R. J. Cell Biol. 1996; 134: 1499-1512Crossref PubMed Scopus (82) Google Scholar). Collagen XII is a component of the skeletal muscle extracellular matrix as well. The protein and the mRNA are located in the epimysium, perimysium, and unlike tenascin-X, also in tendon (8Koch M. Bohrmann B. Matthison M. Hagios C. Trueb B. Chiquet M. J. Cell Biol. 1995; 130: 1005-1014Crossref PubMed Scopus (95) Google Scholar, 34Walchli C. Koch M. Chiquet M. Odermatt B.F. Trueb B. J. Cell Sci. 1994; 107: 669-681PubMed Google Scholar). By double immunofluorescence we could show that the two proteins colocalize, seemingly on the same interstitial fibrils, in the epimysi
Referência(s)