Portal de Periódicos da CAPES

Transcription Elongation Factor S-II Confers Yeast Resistance to 6-Azauracil by Enhancing Expression of the SSM1 Gene

2000; Elsevier BV; Volume: 275; Issue: 38 Linguagem: Inglês

10.1074/jbc.m910371199

1083-351X

Makoto Shimoaraiso, Toshiyuki Nakanishi, Takeo Kubo, Shunji Natori,

Genomics, phytochemicals, and oxidative stress

Loss of function of S-II makes yeast sensitive to 6-azauracil. Here, we identified a multi-copy suppressor gene of this phenotype, termed SSM1 (suppressor of 6-azauracil sensitivity of the S-II null mutant 1), that encodes a novel protein consisting of 280 amino acid residues. Although both theSSM1 null mutant and the S-II/SSM1 double null mutant were viable under normal growth conditions, they resembled theS-II null mutant in being sensitive to 6-azauracil. Expression of the SSM1 gene was found to be repressed in theS-II null mutant but was restored by overexpression of chimeric S-II molecules that were able to stimulate transcription elongation by RNA polymerase II in vitro. Furthermore, we identified two transcription arrest sites within the transcription unit of the SSM1 gene in vitro that could be relieved by S-II. These results indicate that S-II confers yeast resistance to 6-azauracil by stimulating transcription elongation of the SSM1 gene. Loss of function of S-II makes yeast sensitive to 6-azauracil. Here, we identified a multi-copy suppressor gene of this phenotype, termed SSM1 (suppressor of 6-azauracil sensitivity of the S-II null mutant 1), that encodes a novel protein consisting of 280 amino acid residues. Although both theSSM1 null mutant and the S-II/SSM1 double null mutant were viable under normal growth conditions, they resembled theS-II null mutant in being sensitive to 6-azauracil. Expression of the SSM1 gene was found to be repressed in theS-II null mutant but was restored by overexpression of chimeric S-II molecules that were able to stimulate transcription elongation by RNA polymerase II in vitro. Furthermore, we identified two transcription arrest sites within the transcription unit of the SSM1 gene in vitro that could be relieved by S-II. These results indicate that S-II confers yeast resistance to 6-azauracil by stimulating transcription elongation of the SSM1 gene. 6-azauracil polymerase chain reaction open reading frame base pair(s) Transcription is a complex process controlled at various steps, such as initiation, elongation, and termination (1Buratowski S. Cell. 1994; 77: 1-3Abstract Full Text PDF PubMed Scopus (265) Google Scholar, 2Tjian R. Maniatis T. Cell. 1994; 77: 5-8Abstract Full Text PDF PubMed Scopus (955) Google Scholar, 3Orphanides G. Lagrange T. Reinberg D. Genes Dev. 1996; 10: 2657-2683Crossref PubMed Scopus (852) Google Scholar, 4Roeder R.G. Trends Biochem. Sci. 1996; 21: 327-335Abstract Full Text PDF PubMed Scopus (718) Google Scholar). Recently, it has become evident that expression of several cellular and virus genes is regulated at the transcription elongation step (5Spencer C. Groudine M. Oncogene. 1990; 5: 777-785PubMed Google Scholar, 6Kerppola T.K. Kane C.M. FASEB J. 1991; 5: 2833-2842Crossref PubMed Scopus (91) Google Scholar, 7Kane C.M. Conaway R.C. Conaway J.W. Transcription: Mechanisms and Regulation. Raven Press, Ltd., New York1993: 279-296Google Scholar, 8Aso T. Conaway J.W. Conaway R.C. FASEB J. 1995; 9: 1419-1428Crossref PubMed Scopus (56) Google Scholar). So far, multiple transcription elongation factors, such as S-II (TFIIS) (9Sekimizu K. Nakanishi Y. Mizuno D. Natori S. Biochemistry. 1979; 18: 1582-1588Crossref PubMed Scopus (56) Google Scholar,10Natori S. Mol. Cell. Biochem. 1982; 46: 173-187Crossref PubMed Scopus (33) Google Scholar), elongin (SIII) (11Bradsher J.N. Jackson K.W. Conaway R.C. Conaway J.W. J. Biol. Chem. 1993; 268: 25587-25593Abstract Full Text PDF PubMed Google Scholar, 12Aso T. Lane W.S. Conaway J.W. Conaway R.C. Science. 1995; 269: 1439-1443Crossref PubMed Scopus (293) Google Scholar), TFIIF (13Price D.H. Sluder A.E. Greenleaf A.L. Mol. Cell. Biol. 1989; 9: 1465-1475Crossref PubMed Scopus (134) Google Scholar, 14Kephart D.D. Wang B.Q. Burton Z.F. Price D.H. J. Biol. Chem. 1994; 269: 13536-13543Abstract Full Text PDF PubMed Google Scholar, 15Gu W. Reines D. J. Biol. Chem. 1995; 270: 11238-11244Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar), TEF-b (16Marshall N.F. Price D.H. J. Biol. Chem. 1995; 270: 12335-12338Abstract Full Text Full Text PDF PubMed Scopus (427) Google Scholar, 17Marshall N.F. Peng J. Xie Z. Price D.H. J. Biol. Chem. 1996; 271: 27176-27183Abstract Full Text Full Text PDF PubMed Scopus (531) Google Scholar), and ELL (18Shilatifard A. Lane W.S. Jackson K.W. Conaway R.C. Conaway J.W. Science. 1996; 271: 1873-1876Crossref PubMed Scopus (281) Google Scholar), have been identified. Among them, S-II was originally purified and characterized from mouse Ehrlich ascites tumor cells as a specific stimulatory protein of RNA polymerase II (9Sekimizu K. Nakanishi Y. Mizuno D. Natori S. Biochemistry. 1979; 18: 1582-1588Crossref PubMed Scopus (56) Google Scholar, 10Natori S. Mol. Cell. Biochem. 1982; 46: 173-187Crossref PubMed Scopus (33) Google Scholar, 19Sekimizu K. Kobayashi N. Mizuno D. Natori S. Biochemistry. 1976; 15: 5064-5070Crossref PubMed Scopus (65) Google Scholar, 20Sekimizu K. Yokoi H. Natori S. J. Biol. Chem. 1982; 257: 2719-2721Abstract Full Text PDF PubMed Google Scholar, 21Ueno K. Sekimizu K. Mizuno D. Natori S. Nature. 1979; 277: 145-146Crossref PubMed Scopus (33) Google Scholar). Subsequently, S-II has been identified in various organisms and shown to make RNA polymerase II read-through intrinsic blocks within the transcription units of eukaryotic genes, in vitro, by promoting cleavage of the 3′-end of the nascent RNA by RNA polymerase II (22Reines D. Chamberlin M.J. Kane C.M. J. Biol. Chem. 1989; 264: 10799-10809Abstract Full Text PDF PubMed Google Scholar, 23Reines D. Ghanoumi P. Li Q. Mote Jr., J. J. Biol. Chem. 1992; 267: 15516-15522Abstract Full Text PDF PubMed Google Scholar, 24Reines D. Conaway J.W. Conaway R.C. Trends Biochem. Sci. 1996; 21: 351-355Abstract Full Text PDF PubMed Scopus (120) Google Scholar, 25SivaRaman L. Reines D. Kane C.M. J. Biol. Chem. 1990; 265: 14554-14560Abstract Full Text PDF PubMed Google Scholar, 26Izban M.G. Luse D.S. Genes Dev. 1992; 6: 1342-1356Crossref PubMed Scopus (229) Google Scholar, 27Izban M.G. Luse D.S. J. Biol. Chem. 1993; 268: 12864-12873Abstract Full Text PDF PubMed Google Scholar, 28Reines D. J. Biol. Chem. 1992; 267: 3795-3800Abstract Full Text PDF PubMed Google Scholar, 29Reines D. Mote Jr., J. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 1917-1921Crossref PubMed Scopus (92) Google Scholar, 30Gu W. Powell W. Mote Jr., J. Reines D. J. Biol. Chem. 1993; 268: 25604-25616Abstract Full Text PDF PubMed Google Scholar, 31Guo H. Price D.H. J. Biol. Chem. 1993; 268: 18762-18770Abstract Full Text PDF PubMed Google Scholar, 32Kassavetis G.A. Geiduschek E.P. Science. 1993; 259: 944-945Crossref PubMed Scopus (66) Google Scholar). To investigate the cellular functions of S-II in eukaryotic transcription, we have been studying S-II from yeast (Saccharomyces cerevisiae) (33Nakanishi T. Nakano A. Nomura K. Sekimizu K. Natori S. J. Biol. Chem. 1992; 267: 13200-13204Abstract Full Text PDF PubMed Google Scholar, 34Nakanishi T. Shimoaraiso M. Kubo T. Natori S. J. Biol. Chem. 1995; 270: 8991-8995Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar, 35Shimoaraiso M. Nakanishi T. Kubo T. Natori S. J. Biol. Chem. 1997; 272: 26550-26554Abstract Full Text Full Text PDF PubMed Scopus (14) Google Scholar). The yeastS-II null mutant is viable but becomes sensitive to 6-azauracil (6-AU)1 (34Nakanishi T. Shimoaraiso M. Kubo T. Natori S. J. Biol. Chem. 1995; 270: 8991-8995Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar, 36Hubert J.-C. Guyonvarch A. Kammerer B. Exinger F. Liljelund P. Lacroute F. EMBO J. 1983; 2: 2071-2073Crossref PubMed Scopus (50) Google Scholar). By creating various deletion mutants of S-II, we found that the C-terminal 147 amino acid residues are sufficient for the stimulation of RNA polymerase II and suppression of 6-AU sensitivity (34Nakanishi T. Shimoaraiso M. Kubo T. Natori S. J. Biol. Chem. 1995; 270: 8991-8995Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar). Furthermore, by creating chimeric molecules of mouse and yeast S-II, we found that the region between Pro-131 and Phe-270 is responsible for the species-specific interaction of S-II and RNA polymerase II (35Shimoaraiso M. Nakanishi T. Kubo T. Natori S. J. Biol. Chem. 1997; 272: 26550-26554Abstract Full Text Full Text PDF PubMed Scopus (14) Google Scholar). These results suggested that the 6-AU sensitivity of theS-II null mutant is caused by loss of function of S-II as a transcription elongation factor. However, the target gene(s) for S-II that confers yeast resistance to 6-AU has not yet been identified. To gain more insight into the role of S-II in the sensitivity of yeast to 6-AU, we have identified a gene, SSM1, that suppresses sensitivity to 6-AU. We found that S-II enhances transcription of the SSM1 gene, resulting in suppression of the sensitivity of theS-II null mutant to 6-AU. The yeast S-II null mutant (TNY14) (34Nakanishi T. Shimoaraiso M. Kubo T. Natori S. J. Biol. Chem. 1995; 270: 8991-8995Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar) was transfected with multi-copy type genomic clones of S. cerevisiae with an average insert size of 10 kilobase pairs constructed in YEp13 by the method of Gietz et al. (37Gietz D. Jean A.S. Woods R.A. Schiestl R.H. Nucleic Acids Res. 1992; 20: 1425Crossref PubMed Scopus (2899) Google Scholar). Clones that formed colonies on EMD (0.67% yeast nitrogen base without amino acids, 0.5% casamino acids technical and 2% glucose) plates containing 100 μg/ml of 6-AU were selected. To determine the gene responsible for the suppression of 6-AU sensitivity, various deletion mutants of the multi-copy clone that suppressed 6-AU sensitivity were created by PCR, subcloned into YEp13, and transfected to TNY14 to examine suppression of 6-AU sensitivity. Plasmids were recovered from the transformants by the method of Strathern and Higgins (38Strathern J.N. Higgins D.R. Methods Enzymol. 1991; 194: 319-329Crossref PubMed Scopus (124) Google Scholar) and sequenced. Transformed cells were cultured in EMD medium at 30 °C until the optical density at 600 nm reached about 2.0. Then 2.5 × 106 cells were transferred to 0.5 ml of fresh medium, incubated at 30 °C for 2 h, and then diluted 1000-fold with the medium. The cell suspension was spread on YNBD (0.67% yeast nitrogen base without amino acids and 2% glucose) or YNBGS (0.67% yeast nitrogen base without amino acids, 0.5% casamino acids technical, 5% galactose, and 0.2% sucrose) plates with or without 100 μg/ml 6-azauracil. Colonies were examined after incubation at 30 °C for 5 days. NcoI and SalI sites were introduced to the 5′- and 3′-ends of the coding sequence of the SSM1 gene, respectively. The resulting DNA was ligated to aNcoI-SalI-digested pMYY4–3 containing theGAL1 promoter. The resulting plasmid was cloned and digested with BamHI and PstI, and the insert was ligated to a BamHI-PstI-digested pYO324 (39Ohya Y. Goebl M. Goodman L.E. Peterson-Bjorn S. Friesen J.D. Tamanoi F. Anraku Y. J. Biol. Chem. 1991; 266: 12356-12360Abstract Full Text PDF PubMed Google Scholar). The plasmid was cloned again and transfected to TNY14, and the SSM1 gene was overexpressed under the control of the GAL1 promoter. The procedure was essentially the same as that used for the construction of the S-II null mutant (34Nakanishi T. Shimoaraiso M. Kubo T. Natori S. J. Biol. Chem. 1995; 270: 8991-8995Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar). The SSM1 gene was replaced by a selectable marker URA3 by a PCR knockout strategy (40Baudin A. Ozier-Kalogerropoulous O. Denoubel A. Lacroute F. Cullin C. Nucleic Acids Res. 1993; 21: 3329-3330Crossref PubMed Scopus (1127) Google Scholar). For isolation of the SSM1 null mutant, we introduced the PCR product into the TNY04 strain (33Nakanishi T. Nakano A. Nomura K. Sekimizu K. Natori S. J. Biol. Chem. 1992; 267: 13200-13204Abstract Full Text PDF PubMed Google Scholar). For isolation of the SSM1/S-II double null mutant, we introduced it into the TNY03 (TNY04/s-ii::LEU2) strain. The resulting colonies were examined for disruption of the SSM1 ORF by colony PCR (41Amberg D.C. Botstein D. Beasley E.M. Yeast. 1995; 11: 1275-1280Crossref PubMed Scopus (117) Google Scholar) using primers corresponding to the 5′- and 3′-flanking regions of the SSM1 gene (−35 to −12 and +1130 to +1150). Total cellular RNA was extracted from yeast (42Piper P.W. Curran B.P.G. Curr. Genet. 1990; 17: 119-123Crossref PubMed Scopus (16) Google Scholar), and samples of 10 μg of RNA were subjected to 1.2% formaldehyde-agarose gel electrophoresis. Then the RNA was transferred to a nitrocellulose filter (Schleicher & Schuell). The filter was baked at 80 °C and hybridized with a 32P-labeled probe (the PCR product of the +1- to +843-bp fragment of the SSM1 gene) for 15 h at 42 °C. It was then washed twice with 2× SSC (1× SSC = 150 mm sodium chloride, 15 mmsodium citrate) containing 0.1% SDS for 15 min and once with 0.1× SSC containing 0.1% SDS for 10 min at 45 °C. This was done essentially as described by Christie et al. (43Christie K.R. Awrey D.E. Edwards A.M. Kane C.M. J. Biol. Chem. 1994; 269: 936-943Abstract Full Text PDF PubMed Google Scholar), using 3′- deoxycytidine-extended templates (44Kadesch T.R. Chamberlin M.J. J. Biol. Chem. 1982; 257: 5286-5295Abstract Full Text PDF PubMed Google Scholar) derived from the fragments of the SSM1 gene. The fragments of the SSM1 gene used were −163 to +227 (fragment 1), +1 to +408 (fragment 2), +300 to +746 (fragment 3), and +514 to +917 (fragment 4), where +1 indicates the first letter of the first Met codon in the SSM1 cDNA. These fragments were amplified, subcloned into theBamHI-XbaI sites of pGEM-3Z, and used as templates for detection of transcription arrest sites. Previously, we found that when the yeast S-II gene was disrupted, the resulting S-IInull mutants became sensitive to 6-AU (34Nakanishi T. Shimoaraiso M. Kubo T. Natori S. J. Biol. Chem. 1995; 270: 8991-8995Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar, 36Hubert J.-C. Guyonvarch A. Kammerer B. Exinger F. Liljelund P. Lacroute F. EMBO J. 1983; 2: 2071-2073Crossref PubMed Scopus (50) Google Scholar). Therefore, we looked for genes that suppress the 6-AU sensitivity of S-II null mutants. For this, we transfected multi-copy type genomic clones ofS. cerevisiae with an average insert size of 10 kilobase pairs constructed in YEp13 into TNY14 (an S-II null mutant) and isolated the colonies formed on a plate containing 100 μg/ml 6-AU. Of 91,000 transformants examined, 11 clones were resistant to 6-AU. Southern blot analysis of plasmids recovered from these clones using S-II cDNA as a probe revealed that 8 of the 11 clones were transfected with S-II DNA. Restriction maps of the plasmids recovered from the remaining three clones were identical, indicating that these clones were the same (data not shown). We further analyzed this plasmid (pR1), which contained a 12-kilobase pair insert. To restrict the region of pR1 needed to suppress the 6-AU sensitivity of TNY14, we created various deletion mutants of pR1 and examined whether they were able to suppress 6-AU sensitivity. As shown in Fig.1, we first examined four clones (pR3, pR5, pR14, and pR15) and found that pR5 and pR14 suppressed 6-AU sensitivity. As pR14 was a part of pR5, we further prepared four deletion mutants of pR14 (pR17, pR22, pR23, and pR27) and found that pR17 was sufficient for the suppression of 6-AU sensitivity. We determined the nucleotide sequence of pR17 and found that it contained an ORF encoding 280 amino acid residues. We named this protein SSM1 (Fig. 2). A putative TATA box and a poly(A) addition signal were found to be located at the 5′- and 3′-flanking regions of the ORF, respectively. A computer search revealed that the amino acid sequence of SSM1 was 100% identical with that encoded by YGL224C, whose function has not yet been determined. Thus, YGL224C is the original gene name for SSM1. It also showed 67% similarity with that encoded byYER037W.Figure 2Nucleotide and deduced amino acid sequences of the SSM1 gene. The deduced amino acid sequences of SSM1 is shown below the nucleotide sequence. Numbers of nucleotides are shown to the left of each row, starting from the first nucleotide of pR17. TATA box-like sequences and putative poly(A) addition sequences are indicated by white letters.View Large Image Figure ViewerDownload Hi-res image Download (PPT) To examine whether in fact SSM1 has the ability to suppress 6-AU sensitivity, we overexpressed the SSM1 gene in TNY14 under the control of the GAL1 promoter. As shown in Fig.3, TNY14 expressing SSM1 formed colonies on a plate containing 6-AU, indicating that SSM1 is responsible for conferring 6-AU resistance to TNY14. We examined whether SSM1 is essential for the growth of yeast. For this, we replaced the SSM1 gene of uracil− TNY04 by the URA 3 gene (Fig.4 A). Colonies formed on synthetic complete medium lacking uracil were examined for disruption of the SSM1 ORF by PCR using two primers corresponding to the 5′- and 3′-flanking regions of the SSM1 gene. As shown in Fig. 4 B, a single 1556-bp band was detected with the deletion mutant, and a single 1100-bp band was detected with TNY04, confirming that the deletion mutant is an SSM1 null mutant. As shown in Fig.4 C, this SSM1 null mutant formed colonies under standard growth conditions, indicating that the SSM1 gene is not essential for growth. However, like the S-II null mutant (TNY14), the SSM1 null mutant was sensitive to 6-AU and formed no colonies on the plate containing 6-AU. Similarly, theS-II/SSM1 double null mutant also formed colonies under normal growth conditions but formed no colonies in the presence of 6-AU (data not shown). Furthermore, the 6-AU sensitivity of theSSM1 null mutant was suppressed by overexpression of SSM1 but not by overexpression of S-II (Fig.5). These results suggest that SSM1 functions downstream of S-II in the suppression of 6-AU sensitivity and that S-II participates in the transcription of the SSM1 gene.Figure 56-AU sensitivity of the transformants over expressing the SSM1 or S-II genes in the SSM1 null mutant. TNY04/ssm1 ::URA3 (SSM1null mutant) and transformants of TNY14 in which the SSM1 gene or the S-II gene was overexpressed were examined for formation of colonies on YNBGS plates with 100 μg/ml 6-AU.View Large Image Figure ViewerDownload Hi-res image Download (PPT) To examine the relationship between S-II and transcription of the SSM1 gene, we performed Northern blot analysis of SSM1 mRNA in both wild type and S-II null mutant strains using SSM1 cDNA as a probe. As shown in Fig. 6, the intensity of the band of SSM1 mRNA was significantly less in theS-II null mutant than in the wild type strain irrespective of culture time, indicating that S-II enhances expression of the SSM1 gene. Previously, we demonstrated by using chimeric S-II molecules that residues 132–270 of yeast S-II are indispensable for its specific interaction with homologous RNA polymerase II (35Shimoaraiso M. Nakanishi T. Kubo T. Natori S. J. Biol. Chem. 1997; 272: 26550-26554Abstract Full Text Full Text PDF PubMed Scopus (14) Google Scholar). Therefore, to examine whether a specific interaction of S-II and RNA polymerase II is indispensable for S-II to enhance the expression of the SSM1 gene, we separately expressed four chimeric S-II molecules in theS-II null mutant. These chimeric S-II molecules are the same as those we used previously to demonstrate a species-specific interaction between S-II and RNA polymerase II (Fig.7 A). We have shown that almost equivalent amounts of chimeric S-II molecules are generated when cDNAs for these molecules are expressed in an Escherichia coli expression system, as determined by immunoblotting (35Shimoaraiso M. Nakanishi T. Kubo T. Natori S. J. Biol. Chem. 1997; 272: 26550-26554Abstract Full Text Full Text PDF PubMed Scopus (14) Google Scholar). As shown in Fig. 7 B, expression of the SSM1 gene in TNY14 was enhanced only when wild type S-II or EYE was introduced. Introduction of mouse S-II or YEY did not seem to cause appreciable enhancement of SSM1 gene transcription. To quantify the transcription of the SSM1 gene in these transformants, intensity of the signals in Fig. 7 B was scanned, and the amounts relative to that in the wild type strain were calculated (TableI). Level of SSM1 mRNA in TNY14 was less than 13 of that in the wild type strain. This level was increased to the wild type strain level when Y or EYE was introduced, but introduction of E or YEY did not change this level. These results clearly indicate that the function of yeast S-II as a transcription elongation factor is indispensable for enhanced expression of the SSM1 gene in TNY14.Table IRelative contents of SSM1 mRNA in chimeric S-II transformantsWild typeS-II null mutantYEEYEYEY1.000.291.130.260.960.36Intensity of the bands for SSM1 mRNA in Fig. 7 B was scanned with IMAGE QUANT™ (Molecular Dynamics). Open table in a new tab Intensity of the bands for SSM1 mRNA in Fig. 7 B was scanned with IMAGE QUANT™ (Molecular Dynamics). We examined whether possible transcription arrest sites are present in the transcription unit of the SSM1 gene in vitro. The transcription unit of the SSM1 gene was divided into four fragments. Each fragment was amplified by PCR, a poly(dC) tail was added at its 3′-end, and it was used as a template for transcription by RNA polymerase II. As shown in Fig.8, two bands of 105 and 115 bases, respectively, were detected as well as the run off transcript of 390 bases when fragment 1 was used as a template. These bands represent RNA molecules arrested at specific blocks to elongation in fragment 1. No such premature transcripts were detected when the other three fragments were employed. Because only fragment 1 contains the 5′-upstream region of SSM1 cDNA, the arrest sites were assumed to be located in this region. We identified these arrest sites by nucleotide substitution experiments (45Hutchinson C.A. Phillips S. Edgell M.H. Gillam S. Jahnke P. Smith K. J. Biol. Chem. 1978; 253: 6551-6560Abstract Full Text PDF PubMed Google Scholar). As shown in Fig. 9 A, we created three fragment 1 mutants. In mutants 1 and 2, 10 bases corresponding to positions 101–110 and 111–120 of fragment 1 were replaced by GACTTCAATA, respectively. This sequence corresponded to positions 61–70 of fragment 1, where no transcription arrest was found to occur. In mutant 3, positions 101–120 were replaced by GACTTCAATAGACTTCAATA, which is a tandem repeat of GACTTCAATA. When mutant 1 and mutant 2 were used as templates, the bands of 105 and 115 bases, respectively, became fainter than those obtained when wild type fragment 1 was used as template, as shown in Fig. 9 B. On the other hand, both bands became fainter when mutant 3 was used as a template. These results suggest that the two arrest sites are located in positions 101–110 and 111–120. These arrest sites seemed to be read through by RNA polymerase II when S-II was present. As shown in Fig. 10, the intensity of both bands decreased on addition of recombinant S-II to the reaction mixture.Figure 10Transcription arrest relief by yeast S-II. The transcription reaction was performed using 3′-deoxycytidine-extended fragment 1 as a template in the presence (+) or absence (−) of recombinant yeast S-II. The positions of the arrested transcripts of 105 and 115 bases are indicated byarrowheads.View Large Image Figure ViewerDownload Hi-res image Download (PPT) It is clear that the SSM1 gene is responsible for the sensitivity of TNY14 (a S-II null mutant) to 6-AU. Expression of the SSM1 gene in TNY14 was significantly enhanced by the introduction of S-II, resulting in suppression of 6-AU sensitivity. The mode of action of S-II is probably to make RNA polymerase II read through the two transcription arrest sites present in the 5′-upstream region of the SSM1 ORF. This is the first demonstration of a yeast gene whose expression is controlled by transcription elongation factor S-II. It should be noted that a basal level of expression of the SSM1 gene (less than 13 of wild type strain) was always detected in TNY14. Two transcription arrest sites were identified only in the 5′-upstream region of the ORF and not in other regions of the SSM1 gene. These arrest sites were not T-rich, as reported with other arrest sites in other genes (22Reines D. Chamberlin M.J. Kane C.M. J. Biol. Chem. 1989; 264: 10799-10809Abstract Full Text PDF PubMed Google Scholar). These arrest sites may be partly suppressed even in the absence of S-II, resulting in a basal level of production of SSM1 mRNA in TNY14. This assumption was supported by an in vitro transcription experiment. A significant run-off product (read-through product) was detected when fragment 1 was transcribedin vitro in the absence of S-II. Thus, TNY14 should have a basal level of SSM1 protein, although it is sensitive to 6-AU. Possibly, the amount of SSM1 protein translated from the basal level of mRNA may not be sufficient to suppress the 6-AU sensitivity of TNY14. Nothing is known about the function of SSM1. It was difficult to predict the function of SSM1 from its amino acid sequence, because no appreciable functional domains were identified. SSM1 could be an enzyme that inactivates 6-AU by modifying it. It could also be a protein that represses the uptake of 6-AU. Extensive biochemical studies are needed to elucidate the function of SSM1 in suppressing the toxicity of 6-AU at 100 μg/ml to TNY14. Nevertheless, our finding that SSM1 suppresses the sensitivity of TNY14 to 6-AU is important, because for the first time it gave a clue to the function of S-II in vivo. Sensitivity to 100 μg/ml 6-AU is the only phenotype so far identified for the S-II null mutant (33Nakanishi T. Nakano A. Nomura K. Sekimizu K. Natori S. J. Biol. Chem. 1992; 267: 13200-13204Abstract Full Text PDF PubMed Google Scholar, 34Nakanishi T. Shimoaraiso M. Kubo T. Natori S. J. Biol. Chem. 1995; 270: 8991-8995Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar, 36Hubert J.-C. Guyonvarch A. Kammerer B. Exinger F. Liljelund P. Lacroute F. EMBO J. 1983; 2: 2071-2073Crossref PubMed Scopus (50) Google Scholar). Except for the S-II gene, the SSM1 gene was the only gene that reversed this phenotype, and we found that expression of the SSM1 gene was controlled by S-II. It may be important to identify other phenotypes, and the genes responsible for them, in S-II null mutants. If these genes have transcription arrest sites similar to those in the SSM1 gene, it may be possible to extend the function of S-II to all these genes.