Expression of the Insulin-responsive Glucose Transporter GLUT4 in Adipocytes Is Dependent on Liver X Receptor α
2003; Elsevier BV; Volume: 278; Issue: 48 Linguagem: Inglês
10.1074/jbc.m302287200
ISSN1083-351X
AutoresKnut Tomas Dalen, Stine M. Ulven, Krister Bamberg, Jan-Ακε Gustafsson, Hilde I. Nebb,
Tópico(s)Cholesterol and Lipid Metabolism
ResumoThe insulin-responsive glucose transporter GLUT4 plays a crucial role in insulin-mediated facilitated glucose uptake into adipose tissue and muscle, and impaired expression of GLUT4 has been linked to obesity and diabetes. In this study, we demonstrate that liver X receptors (LXRs) regulate the expression of GLUT4 through direct interaction with a conserved LXR response element in the GLUT4 promoter. The expression of GLUT4 in WAT is induced by a potent LXR agonist in wild type, LXRα-/-, and LXRβ-/- mice but not in LXRα-/-β-/- mice, demonstrating that both LXRs are able to mediate ligand activated transcription of the GLUT4 gene. However, basal and insulin stimulated expression of GLUT4 in epididymal WAT is reduced only in mice carrying ablation of the LXRα isoform. The expression of GLUT4 is furthermore correlated to the induction of LXRα during mouse and human adipocyte differentiation. LXRβ is thus apparently not able to rescue basal expression of GLUT4 in the absence of LXRα. We have previously demonstrated that LXRα is down-regulated in animal models of obesity and diabetes, thus revealing a striking correlation between GLUT4 and LXRα expression in insulin-resistant conditions. This suggests that the LXRα isoform has a unique role in adipose expression of GLUT4 and suggests that alteration of adipose tissue expression of LXRα might be a novel tool to normalize the expression of a gene that is dysregulated in diabetic and insulin-resistant conditions. The insulin-responsive glucose transporter GLUT4 plays a crucial role in insulin-mediated facilitated glucose uptake into adipose tissue and muscle, and impaired expression of GLUT4 has been linked to obesity and diabetes. In this study, we demonstrate that liver X receptors (LXRs) regulate the expression of GLUT4 through direct interaction with a conserved LXR response element in the GLUT4 promoter. The expression of GLUT4 in WAT is induced by a potent LXR agonist in wild type, LXRα-/-, and LXRβ-/- mice but not in LXRα-/-β-/- mice, demonstrating that both LXRs are able to mediate ligand activated transcription of the GLUT4 gene. However, basal and insulin stimulated expression of GLUT4 in epididymal WAT is reduced only in mice carrying ablation of the LXRα isoform. The expression of GLUT4 is furthermore correlated to the induction of LXRα during mouse and human adipocyte differentiation. LXRβ is thus apparently not able to rescue basal expression of GLUT4 in the absence of LXRα. We have previously demonstrated that LXRα is down-regulated in animal models of obesity and diabetes, thus revealing a striking correlation between GLUT4 and LXRα expression in insulin-resistant conditions. This suggests that the LXRα isoform has a unique role in adipose expression of GLUT4 and suggests that alteration of adipose tissue expression of LXRα might be a novel tool to normalize the expression of a gene that is dysregulated in diabetic and insulin-resistant conditions. One important physiological consequence of obesity is a reduced ability to respond to insulin in peripheral tissues. Untreated, this insulin resistance is associated with increased risk for development of cardiovascular disease and, in later stages, type 2 diabetes. Numerous studies have shown that the effect of insulin to increase glucose uptake is directly dependent on recruitment of GLUT4, a facilitative glucose transporter, from an intracellular vesicle pool to the plasma membrane (reviewed in Refs. 1Suzuki K. Kono T. Proc. Natl. Acad. Sci. U. S. A. 1980; 77: 2542-2545Crossref PubMed Scopus (771) Google Scholar and 2Simpson F. Whitehead J.P. James D.E. Traffic. 2001; 2: 2-11Crossref PubMed Scopus (86) Google Scholar). GLUT4 is expressed exclusively in tissues exhibiting insulin-stimulated glucose uptake, such as muscle, heart, and adipose tissue (3Kaestner K.H. Christy R.J. McLenithan J.C. Braiterman L.T. Cornelius P. Pekala P.H. Lane M.D. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 3150-3154Crossref PubMed Scopus (252) Google Scholar). In the basal state, GLUT4 is sorted to an intracellular compartment with a low exocytotic rate, which changes to a high exocytotic rate upon insulin stimulation through activation of intracellular phosphorylation cascades (2Simpson F. Whitehead J.P. James D.E. Traffic. 2001; 2: 2-11Crossref PubMed Scopus (86) Google Scholar). Although this insulin-stimulated translocation of GLUT4 is the main factor that increases glucose uptake, it also depends on the amount of stored GLUT4 in such a compartment. The expression of GLUT4 is reduced in rodent models of insulin deficiency (4Berger J. Biswas C. Vicario P.P. Strout H.V. Saperstein R. Pilch P.F. Nature. 1989; 340: 70-72Crossref PubMed Scopus (248) Google Scholar, 5Garvey W.T. Huecksteadt T.P. Birnbaum M.J. Science. 1989; 245: 60-63Crossref PubMed Scopus (201) Google Scholar) and in adipose tissue of human obese or type 2 diabetic subjects (6Garvey W.T. Maianu L. Huecksteadt T.P. Birnbaum M.J. Molina J.M. Ciaraldi T.P. J. Clin. Invest. 1991; 87: 1072-1081Crossref PubMed Google Scholar, 7Garvey W.T. Maianu L. Hancock J.A. Golichowski A.M. Baron A. Diabetes. 1992; 41: 465-475Crossref PubMed Google Scholar), directly linking adipose expression of GLUT4 to insulin resistance. Moreover, recent studies in mice have demonstrated that selective ablation of GLUT4 in adipose tissue leads to decreased whole body glucose tolerance and insulin responsiveness (8Abel E.D. Peroni O. Kim J.K. Kim Y.B. Boss O. Hadro E. Minnemann T. Shulman G.I. Kahn B.B. Nature. 2001; 409: 729-733Crossref PubMed Scopus (962) Google Scholar), whereas forced overexpression enhances systemic glucose clearance and insulin sensitivity (9Shepherd P.R. Gnudi L. Tozzo E. Yang H. Leach F. Kahn B.B. J. Biol. Chem. 1993; 268: 22243-22246Abstract Full Text PDF PubMed Google Scholar). This implies an important role of adipose tissue GLUT4 expression in whole body glucose homeostasis, despite the fact that it is estimated that adipose tissue only accounts for 10% of the insulin-mediated whole body glucose uptake (10Smith U. Int. J. Obes. Relat. Metab. Disord. 2002; 26: 897-904Crossref PubMed Scopus (163) Google Scholar). The differentiation and maintenance of adipose tissue is driven by the transcription factor peroxisome proliferator-activated receptor γ (PPARγ), 1The abbreviations used are: PPARγperoxisome proliferator-activated receptor γaFABPadipose type fatty acid-binding proteinTZDthiazolidinedioneLXRliver X receptorTGtriglycerideRXRretinoic X receptorLXRELXR response elementSREBP-1csterol regulatory element-binding protein 1cFASfatty acid synthaseEMSAelectromagnetic mobility shift assayWATwhite adipose tissue. a member of the nuclear receptor family (11Rosen E.D. Sarraf P. Troy A.E. Bradwin G. Moore K. Milstone D.S. Spiegelman B.M. Mortensen R.M. Mol. Cell. 1999; 4: 611-617Abstract Full Text Full Text PDF PubMed Scopus (1669) Google Scholar, 12Auwerx J. Diabetologia. 1999; 42: 1033-1049Crossref PubMed Scopus (583) Google Scholar, 13Berger J. Moller D.E. Annu. Rev. Med. 2002; 53: 409-435Crossref PubMed Scopus (2114) Google Scholar). PPARγ heterodimerizes with retinoid X receptor α (RXRα) and controls transcription of target genes by binding to a direct repeat-1 PPARγ response element located in the promoter of target genes (12Auwerx J. Diabetologia. 1999; 42: 1033-1049Crossref PubMed Scopus (583) Google Scholar, 13Berger J. Moller D.E. Annu. Rev. Med. 2002; 53: 409-435Crossref PubMed Scopus (2114) Google Scholar, 14Tontonoz P. Hu E. Graves R.A. Budavari A.I. Spiegelman B.M. Genes Dev. 1994; 8: 1224-1234Crossref PubMed Scopus (2005) Google Scholar). Natural high affinity ligands for PPARγ have not been identified, but endogenous polyunsaturated fatty acids and 15-deoxy-Δ12,14-prostaglandin J2 (15-PGJ2) show micromolar affinity for the receptor in line with their serum levels (15Xu H.E. Lambert M.H. Montana V.G. Parks D.J. Blanchard S.G. Brown P.J. Sternbach D.D. Lehmann J.M. Wisely G.B. Willson T.M. Kliewer S.A. Milburn M.V. Mol. Cell. 1999; 3: 397-403Abstract Full Text Full Text PDF PubMed Scopus (970) Google Scholar, 16Forman B.M. Tontonoz P. Chen J. Brun R.P. Spiegelman B.M. Evans R.M. Cell. 1995; 83: 803-812Abstract Full Text PDF PubMed Scopus (2740) Google Scholar). Thiazolidinediones (TZDs), a new class of synthetic antidiabetic drugs, have been characterized as high affinity ligands for PPARγ (17Lehmann J.M. Moore L.B. Smith-Oliver T.A. Wilkison W.O. Willson T.M. Kliewer S.A. J. Biol. Chem. 1995; 270: 12953-12956Abstract Full Text Full Text PDF PubMed Scopus (3469) Google Scholar). peroxisome proliferator-activated receptor γ adipose type fatty acid-binding protein thiazolidinedione liver X receptor triglyceride retinoic X receptor LXR response element sterol regulatory element-binding protein 1c fatty acid synthase electromagnetic mobility shift assay white adipose tissue. Recently, we suggested that the liver X receptors (LXRs) are involved in the regulation of adipose tissue fatty acid metabolism and triglyceride (TG) storage (18Juvet L.K. Andresen S.M. Schuster G.U. Dalen K.T. Tobin K.A. Hollung K. Haugen F. Jacinto S. Ulven S.M. Bamberg K. Gustafsson J.-Å. Nebb H.I. Mol. Endocrinol. 2003; 17: 172-182Crossref PubMed Scopus (136) Google Scholar). LXRα (19Apfel R. Benbrook D. Lernhardt E. Ortiz M.A. Salbert G. Pfahl M. Mol. Cell. Biol. 1994; 14: 7025-7035Crossref PubMed Scopus (296) Google Scholar, 20Willy P.J. Umesono K. Ong E.S. Evans R.M. Heyman R.A. Mangelsdorf D.J. Genes Dev. 1995; 9: 1033-1045Crossref PubMed Scopus (923) Google Scholar) and LXRβ (21Song C. Kokontis J.M. Hiipakka R.A. Liao S. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 10809-10813Crossref PubMed Scopus (210) Google Scholar, 22Teboul M. Enmark E. Li Q. Wikstrom A.C. Pelto-Huikko M. Gustafsson J.-Å. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 2096-2100Crossref PubMed Scopus (200) Google Scholar) heterodimerize with RXRα and control transcription by binding to a direct repeat type 4 LXR response element (LXRE) located in the promoter of their target genes (20Willy P.J. Umesono K. Ong E.S. Evans R.M. Heyman R.A. Mangelsdorf D.J. Genes Dev. 1995; 9: 1033-1045Crossref PubMed Scopus (923) Google Scholar, 23Willy P.J. Mangelsdorf D.J. Genes Dev. 1997; 11: 289-298Crossref PubMed Scopus (141) Google Scholar). The LXRβ isoform is ubiquitously expressed in adults (21Song C. Kokontis J.M. Hiipakka R.A. Liao S. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 10809-10813Crossref PubMed Scopus (210) Google Scholar), whereas the expression of LXRα is predominantly restricted to tissues known to play important roles in lipid metabolism, such as liver, skeletal muscle, adipose tissue, kidney, and small intestine, but a lower expression level is also seen in spleen and pituitary and adrenal glands (19Apfel R. Benbrook D. Lernhardt E. Ortiz M.A. Salbert G. Pfahl M. Mol. Cell. Biol. 1994; 14: 7025-7035Crossref PubMed Scopus (296) Google Scholar, 20Willy P.J. Umesono K. Ong E.S. Evans R.M. Heyman R.A. Mangelsdorf D.J. Genes Dev. 1995; 9: 1033-1045Crossref PubMed Scopus (923) Google Scholar, 24Auboeuf D. Rieusset J. Fajas L. Vallier P. Frering V. Riou J.P. Staels B. Auwerx J. Laville M. Vidal H. Diabetes. 1997; 46: 1319-1327Crossref PubMed Scopus (639) Google Scholar). Naturally occurring oxysterols, mainly derivatives of cholesterol, function as high affinity ligands for LXRs (25Janowski B.A. Willy P.J. Devi T.R. Falck J.R. Mangelsdorf D.J. Nature. 1996; 383: 728-731Crossref PubMed Scopus (1477) Google Scholar, 26Lehmann J.M. Kliewer S.A. Moore L.B. Smith-Oliver T.A. Oliver B.B. Su J.L. Sundseth S.S. Winegar D.A. Blanchard D.E. Spencer T.A. Willson T.M. J. Biol. Chem. 1997; 272: 3137-3140Abstract Full Text Full Text PDF PubMed Scopus (1048) Google Scholar), and recently, a synthetic nonsteroidal LXR agonist was described (27Schultz J.R. Tu H. Luk A. Repa J.J. Medina J.C. Li L. Schwendner S. Wang S. Thoolen M. Mangelsdorf D.J. Lustig K.D. Shan B. Genes Dev. 2000; 14: 2831-2838Crossref PubMed Scopus (1404) Google Scholar). Several studies have demonstrated the importance of LXRs in cholesterol homeostasis (i.e. by regulating ATP-binding cassette transporters (28Repa J.J. Turley S.D. Lobaccaro J.A. Medina J. Li L. Lustig K. Shan B. Heyman R.A. Dietschy J.M. Mangelsdorf D.J. Science. 2000; 289: 1524-1529Crossref PubMed Scopus (1151) Google Scholar, 29Venkateswaran A. Repa J.J. Lobaccaro J.M. Bronson A. Mangelsdorf D.J. Edwards P.A. J. Biol. Chem. 2000; 275: 14700-14707Abstract Full Text Full Text PDF PubMed Scopus (347) Google Scholar), human cholesterol ester transfer protein (30Luo Y. Tall A.R. J. Clin. Invest. 2000; 105: 513-520Crossref PubMed Scopus (309) Google Scholar), apolipoprotein E (31Laffitte B.A. Repa J.J. Joseph S.B. Wilpitz D.C. Kast H.R. Mangelsdorf D.J. Tontonoz P. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 507-512Crossref PubMed Scopus (576) Google Scholar), and the rodent cholesterol-7α hydroxylase gene (26Lehmann J.M. Kliewer S.A. Moore L.B. Smith-Oliver T.A. Oliver B.B. Su J.L. Sundseth S.S. Winegar D.A. Blanchard D.E. Spencer T.A. Willson T.M. J. Biol. Chem. 1997; 272: 3137-3140Abstract Full Text Full Text PDF PubMed Scopus (1048) Google Scholar, 32Peet D.J. Turley S.D. Ma W. Janowski B.A. Lobaccaro J.M. Hammer R.E. Mangelsdorf D.J. Cell. 1998; 93: 693-704Abstract Full Text Full Text PDF PubMed Scopus (1252) Google Scholar)). In addition, LXRs have been linked to lipid metabolism by their direct regulation of the sterol regulatory element-binding protein 1c (SREBP-1c) (33Repa J.J. Liang G. Ou J. Bashmakov Y. Lobaccaro J.M. Shimomura I. Shan B. Brown M.S. Goldstein J.L. Mangelsdorf D.J. Genes Dev. 2000; 14: 2819-2830Crossref PubMed Scopus (1423) Google Scholar, 34Yoshikawa T. Shimano H. Amemiya-Kudo M. Yahagi N. Hasty A.H. Matsuzaka T. Okazaki H. Tamura Y. Iizuka Y. Ohashi K. Osuga J. Harada K. Gotoda T. Kimura S. Ishibashi S. Yamada N. Mol. Cell. Biol. 2001; 21: 2991-3000Crossref PubMed Scopus (435) Google Scholar) and fatty acid synthase (FAS) (35Joseph S.B. Laffitte B.A. Patel P.H. Watson M.A. Matsukuma K.E. Walczak R. Collins J.L. Osborne T.F. Tontonoz P. J. Biol. Chem. 2002; 277: 11019-11025Abstract Full Text Full Text PDF PubMed Scopus (626) Google Scholar) promoters as well as the observation that insulin-mediated regulation of these lipogenic genes in liver is dependent on LXRs (36Tobin K.A. Ulven S.M. Schuster G.U. Steineger H.H. Andresen S.M. Gustafsson J.-Å. Nebb H.I. J. Biol. Chem. 2002; 277: 10691-10697Abstract Full Text Full Text PDF PubMed Scopus (162) Google Scholar). This suggests that the LXRs are important regulators of lipid metabolism, in addition to their roles as regulators of cholesterol homeostasis. Earlier studies have shown that the transcription of GLUT4 in adipocytes is induced by ligands that activate PPARγ (37Wu Z. Xie Y. Morrison R.F. Bucher N.L. Farmer S.R. J. Clin. Invest. 1998; 101: 22-32Crossref PubMed Scopus (306) Google Scholar) and that the reduced levels of GLUT4 in adipose tissue in animal models of diabetes is normalized by treatment with PPARγ activators (38Hofmann C. Lorenz K. Colca J.R. Endocrinology. 1991; 129: 1915-1925Crossref PubMed Scopus (153) Google Scholar, 39Young P.W. Cawthorne M.A. Coyle P.J. Holder J.C. Holman G.D. Kozka I.J. Kirkham D.M. Lister C.A. Smith S.A. Diabetes. 1995; 44: 1087-1092Crossref PubMed Scopus (0) Google Scholar). The exact molecular mechanism responsible for this regulation is, however, not known. We demonstrated recently that the expression of LXRα is regulated similarly to GLUT4 in adipose tissue by being repressed in a model of obesity, which was normalized by treatment with a potent PPARγ activator (18Juvet L.K. Andresen S.M. Schuster G.U. Dalen K.T. Tobin K.A. Hollung K. Haugen F. Jacinto S. Ulven S.M. Bamberg K. Gustafsson J.-Å. Nebb H.I. Mol. Endocrinol. 2003; 17: 172-182Crossref PubMed Scopus (136) Google Scholar). Furthermore, activation of LXRs in adipose tissue increases basal glucose uptake (40Ross S.E. Erickson R.L. Gerin I. DeRose P.M. Bajnok L. Longo K.A. Misek D.E. Kuick R. Hanash S.M. Atkins K.B. Andresen S.M. Nebb H.I. Madsen L. Kristiansen K. MacDougald O.A. Mol. Cell. Biol. 2002; 22: 5989-5999Crossref PubMed Scopus (216) Google Scholar) and incorporation of TGs into lipid droplets (18Juvet L.K. Andresen S.M. Schuster G.U. Dalen K.T. Tobin K.A. Hollung K. Haugen F. Jacinto S. Ulven S.M. Bamberg K. Gustafsson J.-Å. Nebb H.I. Mol. Endocrinol. 2003; 17: 172-182Crossref PubMed Scopus (136) Google Scholar). Since all of these factors pointed to a role of LXRs in the regulation of glucose metabolism, we initiated a study to determine whether genes involved in this pathway are regulated by LXRs. Here we demonstrate that the adipose tissue expression of GLUT4 is directly regulated by both LXRα and LXRβ upon ligand stimulation but that the basal expression of GLUT4 is selectively dependent on the LXRα isoform. In view of the recently proposed antidiabetic effects of LXRs (41Cao G. Liang Y. Broderick C.L. Oldham B.A. Beyer T.P. Schmidt R.J. Zhang Y. Stayrook K.R. Suen C. Otto K.A. Miller A.R. Dai J. Foxworthy P. Gao H. Ryan T.P. Jiang X.C. Burris T.P. Eacho P.I. Etgen G.J. J. Biol. Chem. 2003; 278: 1131-1136Abstract Full Text Full Text PDF PubMed Scopus (257) Google Scholar), this work supports such a role for LXRs, since we now demonstrate a direct link between LXRα and a gene that is down-regulated in diabetic and insulin-resistant conditions. Materials—All restriction enzymes were purchased from Promega (Madison, WI). All cell culture plastic ware was obtained from Corning Inc. Media (D6546 and D6421), oligonucleotides, and other chemicals were obtained from Sigma. EMSAs and Northern blots were analyzed by phosphorimaging (ImageQuant™ software; Amersham Biosciences). The pCMX, pCMX-RXRα, and pCMX-LXRα expression vectors (29Venkateswaran A. Repa J.J. Lobaccaro J.M. Bronson A. Mangelsdorf D.J. Edwards P.A. J. Biol. Chem. 2000; 275: 14700-14707Abstract Full Text Full Text PDF PubMed Scopus (347) Google Scholar) were a gift from D. J. Mangelsdorf (Dallas, TX). Darglitazone and T0901317 were obtained from AstraZeneca (Mölndal, Sweden). Culturing of Cells—COS-1 and 3T3-L1 cells (ATCC) were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum (Integro, Dieren, Holland; lot 5-80301), 2 mm l-glutamine, penicillin (50 units/ml), and streptomycin (50 μg/ml) at 37 °C in 5% CO2. Cells were handled as described (42Tobin K.A. Steineger H.H. Alberti S. Spydevold O. Auwerx J. Gustafsson J.-Å. Nebb H.I. Mol. Endocrinol. 2000; 14: 741-752Crossref PubMed Scopus (185) Google Scholar) and were not allowed to grow confluent prior to experiments. 3T3-L1 cells were differentiated into adipocytes by the addition of adipogenic factors (23Willy P.J. Mangelsdorf D.J. Genes Dev. 1997; 11: 289-298Crossref PubMed Scopus (141) Google Scholar) with some adjustments. Preadipocytes were seeded at passage 6–8, grown 1–2 days postconfluence, and exposed to adipogenic medium (0.5 mm isobutylmethylxanthine, 0.1 μm dexamethazone, and 1 μg/ml insulin) for 3 days and then medium containing insulin (1 μg/ml) for 3 days, followed by an additional 7 days with regular medium to obtain mature adipocytes (day 13). Human (SGBS) cells were cultured and differentiated into adipocytes essentially as described (43Wabitsch M. Brenner R.E. Melzner I. Braun M. Moller P. Heinze E. Debatin K.M. Hauner H. Int. J. Obes. Relat. Metab. Disord. 2001; 25: 8-15Crossref PubMed Scopus (422) Google Scholar). Briefly, cells were subcultured in basal medium (Dulbecco's modified Eagle's medium/nutrient mix F-12 (D6421) supplemented with 4 mg of biotin, 2 g of d-pantothenate, 2 mm l-glutamine, penicillin (100 units/ml), and streptomycin (100 μg/ml) supplemented with 10% noninactivated fetal calf serum (10270-106; Invitrogen). For adipocyte differentiation, cells were seeded at low passage 6–10, grown into confluence, and exposed to adipogenic medium (Quickdiff; 3FC supplemented with 25 nm dexamethazone, 0.5 mm isobutylmethylxanthine, and 2 μm rosiglitazone), followed by continuous culturing in 3FC (basal medium supplemented with 10 μg/ml human transferrin, 20 nm insulin, 100 nm cortisol, and 0.2 nm T3). Cells were given fresh medium twice a week until experiments were started at days 15–17. Preparation and Analysis of RNA—Total RNA was extracted with TRIZOL® Reagent (Invitrogen), and 10–20 μg of total RNA was used for Northern blotting. Hybridization and stripping of membranes (Hybond-N; Amersham Biosciences) were performed as recommended (PT1200-1; Clontech). Membranes were probed with [α-32P]dCTP (Amersham Biosciences)-radiolabeled cDNAs synthesized using a multiple DNA labeling system (Amersham Biosciences). Human (h) and mouse (m) probes used were h-GLUT4, h-LXRα, h-PPARγ, h-SREBP-1, h-FAS, m-GLUT4, m-aFABP, m-L27, and m-36B4. Cloning of the GLUT4 cDNA and Probe—The mouse GLUT4 cDNA and the human GLUT4 probe were generated by reverse transcriptase polymerase chain reaction (RT-PCR) from total RNA isolated from differentiated 3T3-L1 and SGBS cells, respectively, using the ImProm-II™ reverse transcription system (Promega) with an oligo(dT)16 primer, followed by a PCR (30 cycles) with Pfu Turbo DNA polymerase (Stratagene, La Jolla, CA). The obtained PCR fragments were cloned into the pPCR-Script vector using the PCR-Script™ Amp cloning kit (Stratagene). PCR fragments obtained by a second PCR amplification from these vectors were used for labeling reactions in Northern analysis. The following primers were used to amplify the mouse GLUT4 CDS (accession number BC014282, nucleotides 111–1770): 5′-mGLUT4-CDS (5′-TAGAATTCCCCGGACCCTATACCCTATTCATTT-3′) and 3′-mGLUT4-CDS (5′-TAGGATCCGCTGTAGAGGAAAGGAGGGAGTCT-G-3′) and the human GLUT4 probe 5′-hGLUT4 probe (5′-CCATTGTT-ATCGGCATTCTGATCG-3′) and 3′-hGLUT4-probe (5′-ATAGCCTC-CGCAACATACTGGAAAC-3′). Cloning and Mutagenesis of the GLUT4 Promoter—A previously described nucleotide sequence for the human GLUT4 promoter (accession number M61126) was used as a bait in a BLAST search against htgs sequences at NCBI to identify a longer 5′-upstream sequence (annealed to accession number AC003688). The mouse GLUT4 promoter was identified with the full-length mouse GLUT4 mRNA as bait (accession number BC014282 annealed to accession number AL596185.8). For both promoters, the promoter sequence spanning 10,000 bp up- and downstream from the transcription start site was extracted and analyzed using a consensus LXRE (DGGTYA HWHW MGKKCA) generated by the GCG program (Wisconsin Package version 10.0, Genetics Computer Group (GCG), Madison, WI) to localize potential LXR response elements. The full-length GLUT4 promoter was amplified by PCR with Pfu Turbo DNA polymerase (Stratagene) from human genomic DNA (6550-1; Clontech) with primers selected by the Primer3 program (51Rozen S. Skaletsky H.J. Krawetz S. Misener S. Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ2000: 365-386Google Scholar) (primers were 5′-h-GLUT4-promoter (TAAGATCTCTGTGCTGGAACTCAGGGATCA) and 3′-h-GLUT4-promoter (TAAGATCTTCGGAGCCTATCTGTTGGAAGC)). The promoter was amplified in a 100-μl PCR mixture (100–500 ng of template, 1× cloned Pfu buffer, 200 μm each dNTP, 2.5 units of Pfu Turbo polymerase, and 20 pmol of each primer) in a long cycled PCR (2 min at 95 °C; 1 min at 95 °C, 45 sec at 60 °C (2 min/1000 bp) at 72 °C for 30 cycles; 10 min at 72 °C). The amplified promoter fragment was inserted into the pPCR-Script vector (Stratagene) prior to insertion into the BglII site in the pGL3-Basic luciferase reporter vector (Promega). The GLUT4 SmaI deletion reporter was made by restriction cutting of the full-length reporter with SmaI followed by religation of the vector. The mutation of the LXRE element in the human GLUT4 reporter was introduced by employing the mutated oligonucleotides used in the EMSA (Fig. 5A) as mutation-targeting primers. 10 ng of the full-length GLUT4 reporter was amplified in a 50-μl PCR mixture (1× cloned Pfu buffer, 200 μm each dNTP, 2.5 units of Pfu Turbo polymerase, and 15 pmol/each mutation oligonucleotide) in a long cycled PCR reaction (2 min at 95 °C; 45 s at 95 °C, 30 s at 55 °C, 15 min at 68 °C for 20 cycles). Following PCR, the PCR mixture was treated with DpnI (1 unit) at 37 °C for 1 h and transformed into supercompetent cells. Positive clones were identified by restriction analysis and verified by sequencing. Transfection, Luciferase Assay, and Electrophoretic Mobility Shift Assay—For reporter gene assays, COS-1 cells were transiently transfected in six-well dishes with luciferase reporters (5 μg) and co-transfected with pCMX-RXRα, pCMX-LXRα (1 μg each), and pSV-β-galactosidase (3 μg) expression vectors with calcium phosphate precipitation (42Tobin K.A. Steineger H.H. Alberti S. Spydevold O. Auwerx J. Gustafsson J.-Å. Nebb H.I. Mol. Endocrinol. 2000; 14: 741-752Crossref PubMed Scopus (185) Google Scholar). Total DNA concentration was adjusted to 12 μg with corresponding empty expression vectors and pGL3-basic vector. Differentiated human SGBS cells were transfected (12 wells) with reporters (800 ng) and pTK Renilla luciferase (80 ng) with LipofectAMINE Plus reagent (Invitrogen). Total DNA concentration was adjusted to 1.0 μg by the addition of pGL3-basic vector. After 3 h of transfection, medium containing appropriate reagents was added for 48 h. Cells were harvested in 100 μl lysis buffer, and luciferase activities were measured using the dual luciferase assay kit (Promega). For preparation of nuclear extract, COS-1 cells were transfected in 10-cm dishes with 20 μg of vector mixed with 70 μl of LipofectAMINE (Invitrogen) in 10 ml of serum and antibiotic-free medium for 6 h, followed by 48-h incubation in 20 ml of medium containing serum and antibiotics. Nuclear extracts from 3T3-L1 and transfected cells were isolated according to Ref. 44Caruccio L. Banerjee R. J. Immunol. Methods. 1999; 230: 1-10Crossref PubMed Scopus (27) Google Scholar, except that the proteinase inhibitor phenylmethylsulfonyl fluoride was replaced with 2× Complete (Roche Applied Science). Protein concentrations were measured by a BC assay (Interchim, Montlucon, France). Unprogrammed reticulocyte lysate and murine RXRα and human LXRα proteins were synthesized in vitro from pCMX, pCMX-mRXRα, and pCMX-hLXRα expression vectors, respectively, using a TNT-T7 quick coupled transcription/translation system (Promega). The oligonucleotide probes (for sequences, see Fig. 4A) were labeled using T4 polynucleotide kinase (Promega) and [γ-32P]ATP (Amersham Biosciences) and purified on ProbeQuant G50 Micro columns (Amersham Biosciences). Binding reactions and separation of the protein-DNA complexes from free probes were performed by using a modified version of a previously published protocol (26Lehmann J.M. Kliewer S.A. Moore L.B. Smith-Oliver T.A. Oliver B.B. Su J.L. Sundseth S.S. Winegar D.A. Blanchard D.E. Spencer T.A. Willson T.M. J. Biol. Chem. 1997; 272: 3137-3140Abstract Full Text Full Text PDF PubMed Scopus (1048) Google Scholar). For in vitro translated proteins, binding reactions were performed in a 20-μl reaction mixture (40 mm KCl, 10 mm Tris-HCl (pH 8.0), 0.2 mm EDTA, 1 mm dithiothreitol, 6% (v/v) glycerol, 0.1% (v/v) Nonidet P-40, 1 μg of single-stranded DNA, and 4 μl of in vitro translated lysate). Nuclear extract binding reactions were performed in a 20-μl reaction mixture (10 mm HEPES (pH 7.9), 20 mm KCl, 4% glycerol, 0.1% Nonidet P-40, 1 mm dithiothreitol, and 4 μl nuclear extract). Binding reactions were preincubated on ice for 15 min before the addition of 1 μl of double-stranded 32P-labeled probe (80–800 fmol; 20,000–100,000 cpm) followed by 20 min of incubation at room temperature. The protein-DNA complexes were resolved on a 4.5% nondenaturing polyacrylamide gel in 1× EMSA buffer (25 mm Trisma base (pH 8.5), 190 mm glycine and 1 mm EDTA) at 180 V for 3.5 h at 4 °C. Animal Experiments—All animal use was approved and registered by the Norwegian Animal Research authority and the regional ethical committee for animal experiments in Sweden. Male C57BL/6J mice, 10 weeks of age (25–30 g) (B & K Universal Ltd., Sollentuna, Sweden), LXRα-/-β+/+, LXRα+/+β-/-, LXRα-/-β-/-, and wild-type (LXRα+/+β+/+) control mice (7–9 weeks) were maintained in a temperature-controlled (22 °C) facility with a strict 12-h light/dark cycle and given free access to food and water. The generation of the LXRα-/-β+/+ and LXRα+/+β-/- mice has been described previously (45Alberti S. Schuster G. Parini P. Feltkamp D. Diczfalusy U. Rudling M. Angelin B. Bjorkhem I. Pettersson S. Gustafsson J.-Å. J. Clin. Invest. 2001; 107: 565-573Crossref PubMed Scopus (320) Google Scholar, 46Schuster G.U. Parini P. Wang L. Alberti S. Steffensen K.R. Hansson G.K. Angelin B. Gustafsson J.-Å. Circulation. 2002; 106: 1147-1153Crossref PubMed Scopus (157) Google Scholar). All transgenic mice used in this study, LXRα-/-β+/+, LXRα+/+β-/-, LXRα-/-β-/-, and wild-type (LXRα+/+β+/+) control mice, had mixed genetic backgrounds based on 129/Sv and C57BL/6J strains, backcrossed in C57BL/6J mice for three generations. In the 24-h feeding experiment, mice were gavage-fed twice (24 and 8 h before the mice were sacrificed) using 50 mg/kg T0901317 or 1 mg/kg darglitazone in a vehicle containing 1% carboxymethyl-cellulose (Sigma). Control mice received vehicle only. In the experiments including insulin injections, the mice were first fed twice with T0901317 (30 mg/kg) as described above and then injected with PBS (as a control) or insulin as a single 0.2-unit injection (intraperitoneally) of Actrapid insulin (Novo Nordisk, Bagsværd, Denmark) 3 h before they were sacrificed. For the 1-week feeding experiment, the mice were fed orally once a day with darglitazone (1 mg/kg) or T0901317 (30 mg/kg). For all in vivo experiments, tissues were rapidly frozen in liquid nitrogen and stored at -70 °C until isol
Referência(s)