Interactions between p-33 and p-55 Domains of the Helicobacter pylori Vacuolating Cytotoxin (VacA)
2004; Elsevier BV; Volume: 279; Issue: 3 Linguagem: Inglês
10.1074/jbc.m310159200
ISSN1083-351X
AutoresVictor J. Torres, Mark S. McClain, Timothy L. Cover,
Tópico(s)RNA and protein synthesis mechanisms
ResumoThe VacA toxin secreted by Helicobacter pylori is considered to be an important virulence factor in the pathogenesis of peptic ulcer disease and gastric cancer. VacA monomers self-assemble into water-soluble oligomeric structures and can form anion-selective membrane channels. The goal of this study was to characterize VacA-VacA interactions that may mediate assembly of VacA monomers into higher order structures. We investigated potential interactions between two domains of VacA (termed p-33 and p-55) by using a yeast two-hybrid system. p-33/p-55 interactions were detected in this system, whereas p-33/p-33 and p-55/p-55 interactions were not detected. Several p-33 proteins containing internal deletion mutations were unable to interact with wild-type p-55 in the yeast two-hybrid system. Introduction of these same deletion mutations into the H. pylori vacA gene resulted in secretion of mutant VacA proteins that failed to assemble into large oligomeric structures and that lacked vacuolating toxic activity for HeLa cells. Additional mapping studies in the yeast two-hybrid system indicated that only the N-terminal portion of the p-55 domain is required for p-33/p-55 interactions. To characterize further p-33/p-55 interactions, we engineered an H. pylori strain that produced a VacA toxin containing an enterokinase cleavage site located between the p-33 and p-55 domains. Enterokinase treatment resulted in complete proteolysis of VacA into p-33 and p-55 domains, which remained physically associated within oligomeric structures and retained vacuolating cytotoxin activity. These results provide evidence that interactions between p-33 and p-55 domains play an important role in VacA assembly into oligomeric structures. The VacA toxin secreted by Helicobacter pylori is considered to be an important virulence factor in the pathogenesis of peptic ulcer disease and gastric cancer. VacA monomers self-assemble into water-soluble oligomeric structures and can form anion-selective membrane channels. The goal of this study was to characterize VacA-VacA interactions that may mediate assembly of VacA monomers into higher order structures. We investigated potential interactions between two domains of VacA (termed p-33 and p-55) by using a yeast two-hybrid system. p-33/p-55 interactions were detected in this system, whereas p-33/p-33 and p-55/p-55 interactions were not detected. Several p-33 proteins containing internal deletion mutations were unable to interact with wild-type p-55 in the yeast two-hybrid system. Introduction of these same deletion mutations into the H. pylori vacA gene resulted in secretion of mutant VacA proteins that failed to assemble into large oligomeric structures and that lacked vacuolating toxic activity for HeLa cells. Additional mapping studies in the yeast two-hybrid system indicated that only the N-terminal portion of the p-55 domain is required for p-33/p-55 interactions. To characterize further p-33/p-55 interactions, we engineered an H. pylori strain that produced a VacA toxin containing an enterokinase cleavage site located between the p-33 and p-55 domains. Enterokinase treatment resulted in complete proteolysis of VacA into p-33 and p-55 domains, which remained physically associated within oligomeric structures and retained vacuolating cytotoxin activity. These results provide evidence that interactions between p-33 and p-55 domains play an important role in VacA assembly into oligomeric structures. Helicobacter pylori is a Gram-negative, spiral-shaped microaerophilic bacterium that colonizes the gastric mucosa of more than 50% of the human population (1.Warren J.R. Marshall B.J. Lancet. 1983; 1: 1273-1275PubMed Google Scholar). Colonization of the gastric mucosa by H. pylori results in mucosal inflammation and is recognized as a major risk factor for the development of peptic ulcer disease, distal gastric adenocarcinoma, and gastric lymphoma (2.Cover T.L. Berg D.E. Blaser M.J. Mobley H.L.T. Groisman E.A. Principles of Bacterial Pathogenesis. Academic Press, San Diego2001: 510-558Google Scholar, 3.Dunn B.E. Cohen H. Blaser M.J. Clin. Microbiol. Rev. 1997; 10: 720-741Crossref PubMed Google Scholar, 4.Suerbaum S. Michetti P. N. Engl. J. Med. 2002; 347: 1175-1186Crossref PubMed Scopus (2149) Google Scholar).Most virulent H. pylori strains secrete a cytotoxin known as VacA into the extracellular space (5.Cover T.L. Blaser M.J. J. Biol. Chem. 1992; 267: 10570-10575Abstract Full Text PDF PubMed Google Scholar, 6.Montecucco C. Papini E. de Bernard M. Telford J.L. Rappuoli R. Alouf J.E. Freer J.H. The Comprehensive Sourcebook of Bacterial Protein Toxins. Academic Press, San Diego1999: 264-286Google Scholar, 7.Atherton J.C. Cover T.L. Papini E. Telford J.L. Mobley H.L.T. Mendz G.L. Hazell S.L. Helicobacter pylori: Physiology and Genetics. American Society for Microbiology, Washington, D. C.2001: 97-110Google Scholar, 8.Papini E. Zoratti M. Cover T.L. Toxicon. 2001; 39: 1757-1767Crossref PubMed Scopus (84) Google Scholar). Several lines of evidence indicate that VacA contributes to the capacity of H. pylori to colonize the stomach and that this toxin is an important virulence factor in the pathogenesis of peptic ulceration and gastric cancer (6.Montecucco C. Papini E. de Bernard M. Telford J.L. Rappuoli R. Alouf J.E. Freer J.H. The Comprehensive Sourcebook of Bacterial Protein Toxins. Academic Press, San Diego1999: 264-286Google Scholar, 7.Atherton J.C. Cover T.L. Papini E. Telford J.L. Mobley H.L.T. Mendz G.L. Hazell S.L. Helicobacter pylori: Physiology and Genetics. American Society for Microbiology, Washington, D. C.2001: 97-110Google Scholar, 8.Papini E. Zoratti M. Cover T.L. Toxicon. 2001; 39: 1757-1767Crossref PubMed Scopus (84) Google Scholar, 9.Figueiredo C. Machado J.C. Pharoah P. Seruca R. Sousa S. Carvalho R. Capelinha A.F. Quint W. Caldas C. van Doorn L.J. Carneiro F. Sobrinho-Simoes M. J. Natl. Cancer Inst. 2002; 94: 1680-1687Crossref PubMed Scopus (555) Google Scholar, 10.Atherton J.C. Cao P. Peek Jr., R.M. Tummuru M.K. Blaser M.J. Cover T.L. J. Biol. Chem. 1995; 270: 17771-17777Abstract Full Text Full Text PDF PubMed Scopus (1375) Google Scholar, 11.Telford J.L. Ghiara P. Dell'Orco M. Comanducci M. Burroni D. Bugnoli M. Tecce M.F. Censini S. Covacci A. Xiang Z. Papini E. Montecucco C. Parente L. Rappuoli R. J. Exp. Med. 1994; 179: 1653-1658Crossref PubMed Scopus (521) Google Scholar, 12.Fujikawa A. Shirasaka D. Yamamoto S. Ota H. Yahiro K. Fukada M. Shintani T. Wada A. Aoyama N. Hirayama T. Fukamachi H. Noda M. Nat. Genet. 2003; 33: 375-381Crossref PubMed Scopus (219) Google Scholar). The most extensively characterized activity of VacA is its capacity to induce vacuolation in mammalian cells (5.Cover T.L. Blaser M.J. J. Biol. Chem. 1992; 267: 10570-10575Abstract Full Text PDF PubMed Google Scholar, 13.Leunk R.D. Johnson P.T. David B.C. Kraft W.G. Morgan D.R. J. Med. Microbiol. 1988; 26: 93-99Crossref PubMed Scopus (531) Google Scholar). The membranes of these VacA-induced vacuoles contain markers for late endosomal and lysosomal compartments (14.Molinari M. Galli C. Norais N. Telford J.L. Rappuoli R. Luzio J.P. Montecucco C. J. Biol. Chem. 1997; 272: 25339-25344Abstract Full Text Full Text PDF PubMed Scopus (166) Google Scholar). The precise mechanism of VacA-induced vacuole formation is not completely understood but is thought to involve binding of the toxin to the plasma membrane, internalization of the toxin, and action of the toxin in an intracellular site (6.Montecucco C. Papini E. de Bernard M. Telford J.L. Rappuoli R. Alouf J.E. Freer J.H. The Comprehensive Sourcebook of Bacterial Protein Toxins. Academic Press, San Diego1999: 264-286Google Scholar, 7.Atherton J.C. Cover T.L. Papini E. Telford J.L. Mobley H.L.T. Mendz G.L. Hazell S.L. Helicobacter pylori: Physiology and Genetics. American Society for Microbiology, Washington, D. C.2001: 97-110Google Scholar, 8.Papini E. Zoratti M. Cover T.L. Toxicon. 2001; 39: 1757-1767Crossref PubMed Scopus (84) Google Scholar). One model proposes that VacA forms anion-selective channels in the membrane of late endocytic compartments (6.Montecucco C. Papini E. de Bernard M. Telford J.L. Rappuoli R. Alouf J.E. Freer J.H. The Comprehensive Sourcebook of Bacterial Protein Toxins. Academic Press, San Diego1999: 264-286Google Scholar, 7.Atherton J.C. Cover T.L. Papini E. Telford J.L. Mobley H.L.T. Mendz G.L. Hazell S.L. Helicobacter pylori: Physiology and Genetics. American Society for Microbiology, Washington, D. C.2001: 97-110Google Scholar, 8.Papini E. Zoratti M. Cover T.L. Toxicon. 2001; 39: 1757-1767Crossref PubMed Scopus (84) Google Scholar, 15.Czajkowsky D.M. Iwamoto H. Cover T.L. Shao Z. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 2001-2006Crossref PubMed Scopus (191) Google Scholar, 16.Szabo I. Brutsche S. Tombola F. Moschioni M. Satin B. Telford J.L. Rappuoli R. Montecucco C. Papini E. Zoratti M. EMBO J. 1999; 18: 5517-5527Crossref PubMed Scopus (235) Google Scholar). In addition to inducing the formation of intracellular vacuoles, VacA causes multiple other effects on target cells, including depolarization of the membrane potential (16.Szabo I. Brutsche S. Tombola F. Moschioni M. Satin B. Telford J.L. Rappuoli R. Montecucco C. Papini E. Zoratti M. EMBO J. 1999; 18: 5517-5527Crossref PubMed Scopus (235) Google Scholar, 17.Schraw W. Li Y. McClain M.S. van der Goot F.G. Cover T.L. J. Biol. Chem. 2002; 277: 34642-34650Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar), permeabilization of epithelial monolayers (18.Papini E. Satin B. Norais N. de Bernard M. Telford J.L. Rappuoli R. Montecucco C. J. Clin. Investig. 1998; 102: 813-820Crossref PubMed Scopus (211) Google Scholar), apoptosis (19.Peek Jr., R.M. Blaser M.J. Mays D.J. Forsyth M.H. Cover T.L. Song S.Y. Krishna U. Pietenpol J.A. Cancer Res. 1999; 59: 6124-6131PubMed Google Scholar, 20.Galmiche A. Rassow J. Doye A. Cagnol S. Chambard J.C. Contamin S. de Thillot V. Just I. Ricci V. Solcia E. Van Obberghen E. Boquet P. EMBO J. 2000; 19: 6361-6370Crossref PubMed Scopus (299) Google Scholar, 21.Kuck D. Kolmerer B. Iking-Konert C. Krammer P.H. Stremmel W. Rudi J. Infect. Immun. 2001; 69: 5080-5087Crossref PubMed Scopus (158) Google Scholar, 22.Cover T.L. Krishna U.S. Israel D.A. Peek Jr, R.M. Cancer Res. 2003; 63: 951-957PubMed Google Scholar), detachment of epithelial cells from the basement membrane (12.Fujikawa A. Shirasaka D. Yamamoto S. Ota H. Yahiro K. Fukada M. Shintani T. Wada A. Aoyama N. Hirayama T. Fukamachi H. Noda M. Nat. Genet. 2003; 33: 375-381Crossref PubMed Scopus (219) Google Scholar), interference with the process of antigen presentation (23.Molinari M. Salio M. Galli C. Norais N. Rappuoli R. Lanzavecchia A. Montecucco C. J. Exp. Med. 1998; 187: 135-140Crossref PubMed Scopus (237) Google Scholar), and inhibition of T lymphocyte activation (24.Gebert B. Fischer W. Weiss E. Hoffmann R. Haas R. Science. 2003; 301: 1099-1102Crossref PubMed Scopus (447) Google Scholar).The vacA gene is translated as a 139-140-kDa protoxin and shows no striking similarity to any other known bacterial toxin (5.Cover T.L. Blaser M.J. J. Biol. Chem. 1992; 267: 10570-10575Abstract Full Text PDF PubMed Google Scholar, 11.Telford J.L. Ghiara P. Dell'Orco M. Comanducci M. Burroni D. Bugnoli M. Tecce M.F. Censini S. Covacci A. Xiang Z. Papini E. Montecucco C. Parente L. Rappuoli R. J. Exp. Med. 1994; 179: 1653-1658Crossref PubMed Scopus (521) Google Scholar, 25.Cover T.L. Tummuru M.K.R. Cao P. Thompson S.A. Blaser M.J. J. Biol. Chem. 1994; 269: 10566-10573Abstract Full Text PDF PubMed Google Scholar, 26.Schmitt W. Haas R. Mol. Microbiol. 1994; 12: 307-319Crossref PubMed Scopus (282) Google Scholar). Upon expression, this protoxin undergoes N- and C-terminal processing to yield a mature 88-kDa secreted VacA toxin (27.Nguyen V.Q. Caprioli R.M. Cover T.L. Infect. Immun. 2001; 69: 543-546Crossref PubMed Scopus (68) Google Scholar). The mature secreted 88-kDa VacA toxin can undergo spontaneous proteolytic degradation into fragments that are about 33 and 55 kDa in mass (11.Telford J.L. Ghiara P. Dell'Orco M. Comanducci M. Burroni D. Bugnoli M. Tecce M.F. Censini S. Covacci A. Xiang Z. Papini E. Montecucco C. Parente L. Rappuoli R. J. Exp. Med. 1994; 179: 1653-1658Crossref PubMed Scopus (521) Google Scholar, 27.Nguyen V.Q. Caprioli R.M. Cover T.L. Infect. Immun. 2001; 69: 543-546Crossref PubMed Scopus (68) Google Scholar, 28.Garner J.A. Cover T.L. Infect. Immun. 1996; 64: 4197-4203Crossref PubMed Google Scholar, 29.Cover T.L. Hanson P.I. Heuser J.E. J. Cell Biol. 1997; 138: 759-769Crossref PubMed Scopus (179) Google Scholar). This degradation has been observed especially when preparations of the purified toxin are stored for prolonged periods (11.Telford J.L. Ghiara P. Dell'Orco M. Comanducci M. Burroni D. Bugnoli M. Tecce M.F. Censini S. Covacci A. Xiang Z. Papini E. Montecucco C. Parente L. Rappuoli R. J. Exp. Med. 1994; 179: 1653-1658Crossref PubMed Scopus (521) Google Scholar, 28.Garner J.A. Cover T.L. Infect. Immun. 1996; 64: 4197-4203Crossref PubMed Google Scholar). The site of proteolytic cleavage is predicted to be located within a hydrophilic surface-exposed loop (11.Telford J.L. Ghiara P. Dell'Orco M. Comanducci M. Burroni D. Bugnoli M. Tecce M.F. Censini S. Covacci A. Xiang Z. Papini E. Montecucco C. Parente L. Rappuoli R. J. Exp. Med. 1994; 179: 1653-1658Crossref PubMed Scopus (521) Google Scholar, 27.Nguyen V.Q. Caprioli R.M. Cover T.L. Infect. Immun. 2001; 69: 543-546Crossref PubMed Scopus (68) Google Scholar). It has been presumed that the two fragments (termed p-33 and p-55) represent two domains or subunits of VacA (11.Telford J.L. Ghiara P. Dell'Orco M. Comanducci M. Burroni D. Bugnoli M. Tecce M.F. Censini S. Covacci A. Xiang Z. Papini E. Montecucco C. Parente L. Rappuoli R. J. Exp. Med. 1994; 179: 1653-1658Crossref PubMed Scopus (521) Google Scholar, 30.Lupetti P. Heuser J.E. Manetti R. Massari P. Lanzavecchia S. Bellon P.L. Dallai R. Rappuoli R. Telford J.L. J. Cell Biol. 1996; 133: 801-807Crossref PubMed Scopus (158) Google Scholar, 31.Reyrat J.M. Lanzavecchia S. Lupetti P. de Bernard M. Pagliaccia C. Pelicic V. Charrel M. Ulivieri C. Norais N. Ji X. Cabiaux V. Papini E. Rappuoli R. Telford J.L. J. Mol. Biol. 1999; 290: 459-470Crossref PubMed Scopus (70) Google Scholar). It should be noted that the nomenclature for describing these fragments has not been uniform; several previous studies have described 37- and 58-kDa fragments (11.Telford J.L. Ghiara P. Dell'Orco M. Comanducci M. Burroni D. Bugnoli M. Tecce M.F. Censini S. Covacci A. Xiang Z. Papini E. Montecucco C. Parente L. Rappuoli R. J. Exp. Med. 1994; 179: 1653-1658Crossref PubMed Scopus (521) Google Scholar, 30.Lupetti P. Heuser J.E. Manetti R. Massari P. Lanzavecchia S. Bellon P.L. Dallai R. Rappuoli R. Telford J.L. J. Cell Biol. 1996; 133: 801-807Crossref PubMed Scopus (158) Google Scholar, 32.Ye D. Willhite D.C. Blanke S.R. J. Biol. Chem. 1999; 274: 9277-9282Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar, 33.Ye D. Blanke S.R. Infect. Immun. 2000; 68: 4354-4357Crossref PubMed Scopus (39) Google Scholar, 34.Ye D. Blanke S.R. Mol. Microbiol. 2002; 43: 1243-1253Crossref PubMed Scopus (31) Google Scholar, 35.Willhite D.C. Ye D. Blanke S.R. Infect. Immun. 2002; 70: 3824-3832Crossref PubMed Scopus (26) Google Scholar, 36.de Bernard M. Burroni D. Papini E. Rappuoli R. Telford J. Montecucco C. Infect. Immun. 1998; 66: 6014-6016Crossref PubMed Google Scholar). In the current study, we designate the two fragments as p-33 and p-55, based on the results of mass spectrometry analysis (27.Nguyen V.Q. Caprioli R.M. Cover T.L. Infect. Immun. 2001; 69: 543-546Crossref PubMed Scopus (68) Google Scholar).Previous studies have identified specific functions that are attributable to either the p-33 or the p-55 domain. Several lines of evidence indicate that amino acid sequences within the p-55 domain (located at the C terminus of the mature secreted toxin) mediate binding of VacA to host cells (28.Garner J.A. Cover T.L. Infect. Immun. 1996; 64: 4197-4203Crossref PubMed Google Scholar, 31.Reyrat J.M. Lanzavecchia S. Lupetti P. de Bernard M. Pagliaccia C. Pelicic V. Charrel M. Ulivieri C. Norais N. Ji X. Cabiaux V. Papini E. Rappuoli R. Telford J.L. J. Mol. Biol. 1999; 290: 459-470Crossref PubMed Scopus (70) Google Scholar, 37.Wang H.J. Chang P.C. Kuo C.H. Tzeng C.S. Wang W.C. Biochem. Biophys. Res. Commun. 1998; 250: 397-402Crossref PubMed Scopus (9) Google Scholar, 38.Wang H.J. Wang W.C. Biochem. Biophys. Res. Commun. 2000; 278: 449-454Crossref PubMed Scopus (36) Google Scholar). VacA binding to cells is inhibited by antiserum reactive with the p-55 fragment but not inhibited by antiserum to the p-33 fragment (28.Garner J.A. Cover T.L. Infect. Immun. 1996; 64: 4197-4203Crossref PubMed Google Scholar). Also, a truncated form of VacA containing mainly the p-55 VacA fragment was reported to bind to target cells in a manner similar to the full-length VacA (31.Reyrat J.M. Lanzavecchia S. Lupetti P. de Bernard M. Pagliaccia C. Pelicic V. Charrel M. Ulivieri C. Norais N. Ji X. Cabiaux V. Papini E. Rappuoli R. Telford J.L. J. Mol. Biol. 1999; 290: 459-470Crossref PubMed Scopus (70) Google Scholar). Amino acid sequences located within a hydrophobic region near the N terminus (within the p-33 domain) are required for membrane channel formation by VacA (39.Vinion-Dubiel A.D. McClain M.S. Czajkowsky D.M. Iwamoto H. Ye D. Cao P. Schraw W. Szabo G. Blanke S.R. Shao Z. Cover T.L. J. Biol. Chem. 1999; 274: 37736-37742Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar, 40.McClain M.S. Iwamoto H. Cao P. Vinion-Dubiel A.D. Li Y. Szabo G. Shao Z. Cover T.L. J. Biol. Chem. 2003; 278: 12101-12108Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar). When expressed in transiently transfected cells, neither the p-33 nor the p-55 domain alone is sufficient for vacuolating toxin activity (32.Ye D. Willhite D.C. Blanke S.R. J. Biol. Chem. 1999; 274: 9277-9282Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar, 34.Ye D. Blanke S.R. Mol. Microbiol. 2002; 43: 1243-1253Crossref PubMed Scopus (31) Google Scholar, 41.de Bernard M. Arico B. Papini E. Rizzuto R. Grandi G. Rappuoli R. Montecucco C. Mol. Microbiol. 1997; 26: 665-674Crossref PubMed Scopus (105) Google Scholar). In transiently transfected cells, expression of the entire p-33 domain as well as about 111 amino acids from the N terminus of the p-55 domain is required for vacuolating toxin activity (32.Ye D. Willhite D.C. Blanke S.R. J. Biol. Chem. 1999; 274: 9277-9282Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar).Secreted VacA proteins assemble into large water-soluble and flower-shaped structures composed predominantly of 12-14 VacA monomers (29.Cover T.L. Hanson P.I. Heuser J.E. J. Cell Biol. 1997; 138: 759-769Crossref PubMed Scopus (179) Google Scholar, 30.Lupetti P. Heuser J.E. Manetti R. Massari P. Lanzavecchia S. Bellon P.L. Dallai R. Rappuoli R. Telford J.L. J. Cell Biol. 1996; 133: 801-807Crossref PubMed Scopus (158) Google Scholar, 42.Adrian M. Cover T.L. Dubochet J. Heuser J.E. J. Mol. Biol. 2002; 318: 121-133Crossref PubMed Scopus (45) Google Scholar). Assembly of VacA into oligomeric structures is presumably required for membrane channel formation. This hypothesis is supported by electron microscopy studies in which VacA associated with membranes appears as oligomeric structures (15.Czajkowsky D.M. Iwamoto H. Cover T.L. Shao Z. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 2001-2006Crossref PubMed Scopus (191) Google Scholar, 42.Adrian M. Cover T.L. Dubochet J. Heuser J.E. J. Mol. Biol. 2002; 318: 121-133Crossref PubMed Scopus (45) Google Scholar), as well as electrophysiologic studies in which the kinetics of membrane channel formation by VacA have been investigated (43.Iwamoto H. Czajkowsky D.M. Cover T.L. Szabo G. Shao Z. FEBS Lett. 1999; 450: 101-104Crossref PubMed Scopus (111) Google Scholar). Thus far, the process by which VacA assembles into higher order structures has not been studied in any detail. Therefore, the goal of this study was to characterize the interactions that may mediate assembly of VacA into oligomeric structures. We describe here several lines of evidence indicating that interactions occur between the p-33 and p-55 domains of VacA, and we identify candidate regions within these two domains that are required for these interactions. In addition, we propose that interactions between p-33 and p-55 domains are essential for the assembly of VacA into oligomeric structures and for VacA vacuolating cytotoxin activity.EXPERIMENTAL PROCEDURESBacterial and Yeast Strains, Media, and Growth Condition—H. pylori strain 60190 (ATCC 49503) was grown on trypticase soy agar plates containing 5% sheep blood at 37 °C in ambient air containing 5% CO2. Liquid cultures were grown in sulfite-free Brucella broth supplemented with either 5% fetal bovine serum or 0.5% activated charcoal. Escherichia coli XL1-Blue (Stratagene) was used for plasmid propagation and was grown on Luria-Bertani (LB) broth or LB agar at 37 °C. Yeast two-hybrid experiments were performed with Saccharomyces cerevisiae strain YRG-2 (MATα ura3-52 his3-200 ade2-101 lys2-801 trp1-901 leu2-3,112 gal4-542 gal80-538 LYS2::UASGAL1-TATAGAL1-HIS3 URA3::UASGAL4 17mers(x3)-TATACYC1-lacZ) (Stratagene). Yeast strains were grown in rich medium (yeast extract, peptone, dextrose (YPAD)) or in synthetic defined (SD) minimal medium (supplemented with required amino acids and glucose) at 30 °C as described in the GAL4 Two-hybrid Phagemid manual (Stratagene).Construction of VacA Yeast Two-hybrid Vectors Containing vacA Fragments—vacA sequences encoding the wild-type p-33 and p-55 VacA domains were PCR-amplified from genomic DNA of H. pylori strain 60190 and cloned into plasmids encoding the transcription activation domain (pAD) 1The abbreviations used are: pAD, plasmids encoding the GAL4 transcription-activation domain; pBD, plasmids encoding the GAL4 DNA binding domain; CHAPS, 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate. and/or the DNA binding domain (pBD) of the GAL4 Two-hybrid Phagemid system (Stratagene). The sequences of the primers used for cloning the different vacA fragments into the yeast two-hybrid vectors are described in Table I. Primers combinations, restriction site used for cloning the PCR products into the pAD and pBD vectors, and the amino acid numbers of the VacA fragments are described in Table II.Table IOligonucleotides used in this studyPrimer nameNucleotide sequenceAND510a5′ - TATAGCCCGGGCCGCCTTTTTTACAACCGTGATAND5115′ - CCCCTCGACTTATTTAGCACCACTTTGAGAAGAND5125′ - CCCCGGATCCGCCTTTTTTACAACCGTGATAND515a5′ - CCCCGTCGACTTAAGCGTAGCTAGCGAAACGCGAND5165′ - CCCCGGATCCAACGACAAACAAGAGAGCAGAND60985′ - CCCCGAATTCAACGACAAACAAGAGAGCAGOP41755′ - CCCCGGATCCGCCTTTTTTACAACCCTTGGOP41765′ - CCCCGTCGACTTACGTATCAATACCTTTAAAATBAR15565′ - CCCCGAATTCGGTAATGGTGGTTTCAACACBAR15575′ - CCCCGAATTCACTAGGTCAATCTTTTCTGGBAR15585′ - CCCCGTCGACTTAGCCAGTTTCCAAACGCACGBAR15595′ - CCCCGTCGACTTAGATTTTCGCTTTCAATAAAACAOP28915′ - CCGACTACAAGGATGACGACGACAAAGOP28925′ - CTTTGTCGTCGTCATCCTTGTAGTCGG Open table in a new tab Table IIYeast two-hybrid vectors containing vacA fragmentsY2H plasmidsaName of the yeast two-hybrid (Y2H) plasmids expressing VacA fragments.Forward primersbOligonucleotides used to PCR-amplify the different vacA sequences. Oligonucleotide sequences are described in Table I.Reverse primersbOligonucleotides used to PCR-amplify the different vacA sequences. Oligonucleotide sequences are described in Table I.Restriction enzymescRestriction sites used to clone the PCR products into the pAD and pBD yeast two-hybrid plasmids.VacA amino acidsdThe VacA amino acid numbering system used in this table is based on designating the first amino acid (alanine) of the mature secreted VacA toxin of strain 60190 (25) as amino acid 1. Δ indicates amino acids that are deleted in the mutant VacA fragments.pBD33AND510aAND511SrfI/SalI1-312pAD33AND512AND511Bam HI/SalI1-312pBD55AND6098AND515aEcoRI/SalI313-821pAD55AND516AND515aBam HI/SalI313-821pADΔ6-27OP4175AND511Bam HI/SalI1-312 (Δ6-27)pADΔ28-108AND512AND511Bam HI/SalI1-312 (Δ28-108)pADΔ56-83AND512AND511Bam HI/SalI1-312 (Δ56-83)pADΔ85-127AND512AND511Bam HI/SalI1-312 (Δ85-127)pADΔ112-196AND512AND511Bam HI/SalI1-312 (Δ112-196)pBD313-700AND6098BAR1559EcoRI/SalI313-700pBD313-550AND6098BAR1558EcoRI/SalI313-550pBD313-478AND6098OP4176EcoRI/SalI313-478pBD550-821BAR1557AND515aEcoRI/SalI550-821pBD479-821BAR1556AND515aEcoRI/SalI479-821a Name of the yeast two-hybrid (Y2H) plasmids expressing VacA fragments.b Oligonucleotides used to PCR-amplify the different vacA sequences. Oligonucleotide sequences are described in Table I.c Restriction sites used to clone the PCR products into the pAD and pBD yeast two-hybrid plasmids.d The VacA amino acid numbering system used in this table is based on designating the first amino acid (alanine) of the mature secreted VacA toxin of strain 60190 (25.Cover T.L. Tummuru M.K.R. Cao P. Thompson S.A. Blaser M.J. J. Biol. Chem. 1994; 269: 10566-10573Abstract Full Text PDF PubMed Google Scholar) as amino acid 1. Δ indicates amino acids that are deleted in the mutant VacA fragments. Open table in a new tab To facilitate the introduction of in-frame deletion mutations into the pAD33 plasmid, vacA sequences encoding p-33 mutant domains were PCR-amplified from genomic DNA of previously described H. pylori strains harboring the specific in-frame vacA deletions (39.Vinion-Dubiel A.D. McClain M.S. Czajkowsky D.M. Iwamoto H. Ye D. Cao P. Schraw W. Szabo G. Blanke S.R. Shao Z. Cover T.L. J. Biol. Chem. 1999; 274: 37736-37742Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar) and cloned into the pAD vector (Table II). vacA sequences encoding p-55 fragments were PCR-amplified from genomic DNA of H. pylori strain 60190 (Table II) and were cloned into the pBD vector. The entire vacA fragment in each p-33 and p-55 encoding plasmid was analyzed by nucleotide sequence analysis in order to verify that no unintended mutations had been introduced.Yeast Methods—Yeast strains were co-transformed with 400 ng of individual plasmids using the lithium acetate method (44.Woods R.A. Gietz R.D. Methods Mol. Biol. 2001; 177: 85-97PubMed Google Scholar) and cultured on SD medium supplemented with the required amino acids and glucose at 30 °C as described in the GAL4 Two-hybrid Phagemid manual (Stratagene). For a positive protein-protein interaction control, we co-transformed the yeast with pBD-WT and pAD-WT plasmids, which encode fusion proteins consisting of amino acids 132-236 of wild-type γcI, fragment C, together with either the GAL4-BD or -AD, respectively. For a negative control (i.e. two proteins that do not interact), we used the pAD-WT plasmid co-transformed with a pBD-pLamin C plasmid, which expresses the BD of GAL4 fused to amino acids 60-230 of human lamin C. We also used plasmids pAD-Mut and pBD-Mut, which encode a mutated (E233K) γcI, fragment C, fused to either the GAL4-AD or -BD. The cI-E233K mutation interferes with the interaction between the cI monomers, resulting in a protein-protein interaction that is weaker than that of wild-type proteins. Plasmids expressing positive and negative interaction control proteins were obtained from Stratagene.One colony of each co-transformant was grown in 2 ml of SD medium containing 2% (w/v) glucose and lacking Trp and Leu (SD-Leu,-Trp) at 30 °C with aeration for ∼24 h. Cultures were then normalized to an A600 of about 0.26 in a final volume of 100 μl of SD-Leu,-Trp,-His broth, and 10-fold serially diluted into SD-Leu,-Trp,-His broth in a microtiter plate. Diluted cultures (5 μl) were seeded on duplicate SD-Leu,-Trp plates (selection for plasmids) and SD-Leu,-Trp,-His plates (selection for protein-protein interactions) and incubated at 30 °C for 3-10 days.To confirm the occurrence of protein-protein interactions, a β-galactosidase liquid assay was performed using the Yeast β-Galactosidase Assay Kit as described by the manufacturer (Pierce). Briefly, individual co-transformants were grown in 2 ml of SD-Leu,-Trp medium containing 2% (w/v) glucose at 30 °C with aeration for ∼16-24 h until cultures reached mid-log phase (A600 0.4-0.5). 150-μl aliquots of the cultures were then mixed with 150 μl of the working solution (equal volume of 2× β-Galactosidase Assay Buffer and Y-PER™ Reagent) and then incubated at 37 °C until solutions turned yellow (∼1-4 h), at which time reactions were stopped by the addition of 175 μl of β-Galactosidase Assay Stop Solution. The time required for yellow color development was recorded for each tube. The A410 values of clarified reaction supernatants (200 μl) were measured in a 96-well plate, and the β-galactosidase activity was calculated by using the Miller equation as described in the Yeast β-Galactosidase Assay Protocol (Pierce). The values presented are the average of at least three independent co-transformants (means ± S.D.). Statistical significance was analyzed using Student's t test.Introduction of DNA Encoding a FLAG Tag Epitope and Enterokinase Site into the vacA Gene of H. pylori 60190—To modify the vacA gene so that it encoded a VacA protein containing a FLAG tag (DYKDADDDK) and an enterokinase cleavage site (after the underlined K), complementary primers OP2891 and OP2892 encoding the FLAG epitope (Table I) were annealed and ligated into the unique StuI site of plasmid pA178 (45.McClain M.S. Cao P. Iwamoto H. Vinion-Dubiel A.D. Szabo G. Shao Z. Cover T.L. J. Bacteriol. 2001; 183: 6499-6508Crossref PubMed Scopus (95) Google Scholar). The resulting plasmid, pA178-FLAG, containe
Referência(s)