Human RNase H1 Activity Is Regulated by a Unique Redox Switch Formed between Adjacent Cysteines
2003; Elsevier BV; Volume: 278; Issue: 17 Linguagem: Inglês
10.1074/jbc.m211279200
ISSN1083-351X
AutoresWalt F. Lima, Hongjiang Wu, Josh G. Nichols, Sherilynn Manalili, Jared J. Drader, Steven A. Hofstadler, Stanley T. Crooke,
Tópico(s)Protein Structure and Dynamics
ResumoHuman RNase H1 is active only under reduced conditions. Oxidation as well as N-ethylmaleimide (NEM) treatment of human RNase H1 ablates the cleavage activity. The oxidized and NEM alkylated forms of human RNase H1 exhibited binding affinities for the heteroduplex substrate comparable with the reduced form of the enzyme. Mutants of human RNase H1 in which the cysteines were either deleted or substituted with alanine exhibited cleavage rates comparable with the reduced form of the enzyme, suggesting that the cysteine residues were not required for catalysis. The cysteine residues responsible for the observed redox-dependent activity of human RNase H1 were determined by site-directed mutagenesis to involve Cys147 and Cys148. The redox states of the Cys147 and Cys148 residues were determined by digesting the reduced, oxidized, and NEM-treated forms of human RNase H1 with trypsin and analyzing the cysteine containing tryptic fragments by μ high performance liquid chromatography-electrospray ionization-Fourier transform ion cyclotron mass spectrometry. The tryptic fragment Asp131–Arg153 containing Cys147and Cys148 was identified. The mass spectra for the Asp131–Arg153 peptides from the oxidized and reduced forms of human RNase H1 in the presence and absence of NEM showed peptide masses consistent with the formation of a disulfide bond between Cys147 and Cys148. These data show that the formation of a disulfide bond between adjacent Cys147and Cys148 residues results in an inactive enzyme conformation and provides further insights into the interaction between human RNase H1 and the heteroduplex substrate. Human RNase H1 is active only under reduced conditions. Oxidation as well as N-ethylmaleimide (NEM) treatment of human RNase H1 ablates the cleavage activity. The oxidized and NEM alkylated forms of human RNase H1 exhibited binding affinities for the heteroduplex substrate comparable with the reduced form of the enzyme. Mutants of human RNase H1 in which the cysteines were either deleted or substituted with alanine exhibited cleavage rates comparable with the reduced form of the enzyme, suggesting that the cysteine residues were not required for catalysis. The cysteine residues responsible for the observed redox-dependent activity of human RNase H1 were determined by site-directed mutagenesis to involve Cys147 and Cys148. The redox states of the Cys147 and Cys148 residues were determined by digesting the reduced, oxidized, and NEM-treated forms of human RNase H1 with trypsin and analyzing the cysteine containing tryptic fragments by μ high performance liquid chromatography-electrospray ionization-Fourier transform ion cyclotron mass spectrometry. The tryptic fragment Asp131–Arg153 containing Cys147and Cys148 was identified. The mass spectra for the Asp131–Arg153 peptides from the oxidized and reduced forms of human RNase H1 in the presence and absence of NEM showed peptide masses consistent with the formation of a disulfide bond between Cys147 and Cys148. These data show that the formation of a disulfide bond between adjacent Cys147and Cys148 residues results in an inactive enzyme conformation and provides further insights into the interaction between human RNase H1 and the heteroduplex substrate. N-ethylmaleimide β-mercaptoethanol tris(2-carboxyethyl)phosphate high performance liquid chromatography electrospray ionization Fourier transform ion cyclotron RNase H hydrolyzes RNA in RNA-DNA hybrids (1Stein H. Hausen P. Science. 1969; 166: 393-395Crossref PubMed Scopus (179) Google Scholar). RNase H activity appears to be ubiquitous in eukaryotes and bacteria (2Itaya M. Kondo K. Nucleic Acids Res. 1991; 19: 4443-4449Crossref PubMed Scopus (63) Google Scholar, 3Itaya M. McKelvin D. Chatterjie S.K. Crouch R.J. Mol. Gen. Genet. 1991; 227: 438-445Crossref PubMed Scopus (54) Google Scholar, 4Kanaya S. Itaya M. J. Biol. Chem. 1992; 267: 10184-10192Abstract Full Text PDF PubMed Google Scholar, 5Busen W. J. Biol. Chem. 1980; 255: 9434-9443Abstract Full Text PDF PubMed Google Scholar, 6Rong Y.W. Carl P.L. Biochemistry. 1990; 29: 383-389Crossref PubMed Scopus (34) Google Scholar, 7Eder P.S. Walder R.T. Walder J.A. Biochimie (Paris). 1993; 75: 123-126Crossref PubMed Scopus (103) Google Scholar). Although RNases H constitute a family of proteins of varying molecular weight, the nucleolytic activity and substrate requirements appear to be similar for the various isotypes. For example, all RNases H studied to date function as endonucleases exhibiting limited sequence specificity and requiring divalent cations (e.g. Mg2+, Mn2+) to produce cleavage products with 5′ phosphate and 3′-hydroxyl termini (8Crouch R.J. Dirksen M.L. Linn S.M. Roberts R.J. Nucleases. Cold Spring Harbor Laboratory Press, Plainview, NY1982: 211-241Google Scholar). Two classes of RNase H enzymes have been identified in mammalian cells (5Busen W. J. Biol. Chem. 1980; 255: 9434-9443Abstract Full Text PDF PubMed Google Scholar, 9Eder P.S. Walder J.A. J. Biol. Chem. 1991; 266: 6472-6479Abstract Full Text PDF PubMed Google Scholar, 10Frank P. Albert S. Cazenave C. Toulme J.J. Nucleic Acids Res. 1994; 22: 5247-5254Crossref PubMed Scopus (40) Google Scholar). These enzymes were shown to differ with respect to co-factor requirements and were shown to be inhibited by sulfhydryl reagents (10Frank P. Albert S. Cazenave C. Toulme J.J. Nucleic Acids Res. 1994; 22: 5247-5254Crossref PubMed Scopus (40) Google Scholar, 11Wu H. Lima W.F. Crooke S.T. Antisense Nucleic Acid Drug Dev. 1998; 8: 53-61Crossref PubMed Scopus (54) Google Scholar). Although the biological roles of the mammalian enzymes are not fully understood, it has been suggested that mammalian RNase H1 may be involved in replication and that the RNase H2 enzyme may be involved in transcription (12Busen W. Peters J.H. Hausen P. Eur. J. Biochem. 1977; 74: 203-208Crossref PubMed Scopus (48) Google Scholar, 13Turchi J.J. Huang L. Murante R.S. Kim Y. Bambara R.A. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 9803-9807Crossref PubMed Scopus (168) Google Scholar). Recently, two human RNase H genes have been cloned and expressed (11Wu H. Lima W.F. Crooke S.T. Antisense Nucleic Acid Drug Dev. 1998; 8: 53-61Crossref PubMed Scopus (54) Google Scholar,14Frank P. Braunshofer-Reiter C. Wintersberger U. Grimm R. Busen W. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 12872-12877Crossref PubMed Scopus (68) Google Scholar, 15Cerritelli S.M. Crouch R.J. Genomics. 1998; 53: 307-311Crossref Scopus (47) Google Scholar). RNase H1 is a 286-amino acid protein and is expressed ubiquitously in human cells and tissues (11Wu H. Lima W.F. Crooke S.T. Antisense Nucleic Acid Drug Dev. 1998; 8: 53-61Crossref PubMed Scopus (54) Google Scholar). The amino acid sequence of human RNase H1 displays strong homology with RNase H1 from yeast, chicken, Escherichia coli, and mouse (11Wu H. Lima W.F. Crooke S.T. Antisense Nucleic Acid Drug Dev. 1998; 8: 53-61Crossref PubMed Scopus (54) Google Scholar). The human RNase H2 enzyme is a 299-amino acid protein with a calculated mass of 33.4 kDa and has also been shown to be ubiquitously expressed in human cells and tissues (14Frank P. Braunshofer-Reiter C. Wintersberger U. Grimm R. Busen W. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 12872-12877Crossref PubMed Scopus (68) Google Scholar). 1H. Wu, unpublished data.1H. Wu, unpublished data. Human RNase H2 shares strong amino acid sequence homology with RNase H2 fromCaenorhabditis elegans, yeast, and E. coli(14Frank P. Braunshofer-Reiter C. Wintersberger U. Grimm R. Busen W. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 12872-12877Crossref PubMed Scopus (68) Google Scholar). The properties of the cloned and expressed human RNase H1 have recently been characterized and many of the properties observed for human RNase H1 are consistent with the E. coli RNase H1 isotype, (e.g. the co-factor requirements, substrate specificity and binding specificity) (16Wu H. Lima W.L. Crooke S.T. J. Biol. Chem. 1999; 274: 28270-28278Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar, 17Lima W.F. Crooke S.T. Biochemistry. 1997; 36: 390-398Crossref PubMed Scopus (111) Google Scholar). In fact, the carboxyl-terminal portion of human RNase H1 is highly conserved with the amino acid sequence of the E. coli enzyme. The glutamic acid and two aspartic acid residues of the catalytic site, as well as the histidine and aspartic acid residues of the proposed second divalent cation binding site of the E. coli enzyme are conserved in human RNase H1 (18Kanaya S. Katsuda-Kakai C. Ikehara M. J. Biol. Chem. 1991; 266: 11621-11627Abstract Full Text PDF PubMed Google Scholar, 19Nakamura H. Oda Y. Iwai S. Inoue H. Ohtsuka E. Kanaya S. Kimura S. Katsuda C. Katayanagi K. Morikawa K. Miyashiro H. Ikehara M. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 11535-11539Crossref PubMed Scopus (192) Google Scholar, 20Katayanagi K. Miyagawa M. Matsushima M. Ishkiawa M. Kanaya S. Ikehara M. Matsuzaki T. Morikawa K. Nature. 1990; 347: 306-309Crossref PubMed Scopus (307) Google Scholar, 21Yang W. Hendrickson W.A. Crouch R.J. Satow Y. Science. 1990; 249: 1398-1405Crossref PubMed Scopus (451) Google Scholar). In addition, the lysine residues within the highly basic α-helical substrate-binding region of E. coli RNase H1 are also conserved in the human enzyme. Site-directed mutagenesis of the catalytic amino acids and the basic residues of the substrate-binding domain of human RNase H1 showed that these conserved residues are required for activity (22Wu H. Lima W.F. Crooke S.T. J. Biol. Chem. 2001; 276: 23547-23553Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar). Despite these similarities, the structures of the two enzymes differ in a number of important properties. For example, the amino acid sequence of human RNase H1 is ∼2-fold longer than the E. colienzyme. The human enzyme contains a 73 amino acid region homologous with the RNA-binding domain of yeast RNase H1 at the amino terminus of the protein, which is separated from the conserved E. coliRNase H1 region by a 62-amino acid spacer region (22Wu H. Lima W.F. Crooke S.T. J. Biol. Chem. 2001; 276: 23547-23553Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar, 23Cerritelli S.M. Crouch R.J. RNA (N. Y.). 1995; 1: 246-259PubMed Google Scholar, 24Evans S.P. Bycroft M. J. Mol. Biol. 1999; 291: 661-669Crossref PubMed Scopus (29) Google Scholar). Mutants in which the RNA-binding domain and spacer region of human RNase H1 were deleted showed that the RNA-binding domain was not required for RNase H activity and that this region was responsible for the observed positional preference for cleavage displayed by the enzyme as well as the enhanced binding affinity of the enzyme for various polynucleotides (22Wu H. Lima W.F. Crooke S.T. J. Biol. Chem. 2001; 276: 23547-23553Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar). The spacer region, on the other hand, was required for RNase H activity as the deletion of this region resulted in a significant reduction in both kcat and Kmfor the enzyme. One biochemical property that has been used to classify RNase H enzymes is the sensitivity to sulfhydryl alkylating reagents such asN-ethylmaleimide (NEM)2 (10Frank P. Albert S. Cazenave C. Toulme J.J. Nucleic Acids Res. 1994; 22: 5247-5254Crossref PubMed Scopus (40) Google Scholar, 11Wu H. Lima W.F. Crooke S.T. Antisense Nucleic Acid Drug Dev. 1998; 8: 53-61Crossref PubMed Scopus (54) Google Scholar, 25Berkower I. Leis J. Hurwitz J. J. Biol. Chem. 1973; 248: 5914-5921Abstract Full Text PDF PubMed Google Scholar, 26Kanaya S. Kimura S. Katsuda C. Ikehara M. Biochem. J. 1990; 271: 59-66Crossref PubMed Scopus (64) Google Scholar). In general, RNase H1 enzymes are inhibited by NEM and both the E. coli and human enzymes share this property. In the case ofE. coli RNase H1, NEM was shown to alkylate all three cysteine residues of the enzyme, although it was determined that alkylation of Cys13 and Cys133 was responsible for the observed loss in enzymatic activity (26Kanaya S. Kimura S. Katsuda C. Ikehara M. Biochem. J. 1990; 271: 59-66Crossref PubMed Scopus (64) Google Scholar). Furthermore, site-directed mutagenesis of the cysteine residues of E. coli RNase H1 showed that these residues were not required for endonuclease activity. Finally, the E. coli enzyme was shown to be active under both reduced and oxidized conditions (26Kanaya S. Kimura S. Katsuda C. Ikehara M. Biochem. J. 1990; 271: 59-66Crossref PubMed Scopus (64) Google Scholar). These results suggest that the cysteines are not involved in catalysis but are positioned such that alkylation of the cysteines sterically interferes with substrate binding. Comparison of the amino acid sequence of Human RNase H1 with theE. coli enzyme indicates that of the five cysteine residues found in human RNase H1, only Cys148 is conserved (TableI). In fact, this cysteine residue is highly conserved in both prokaryotic and eukaryotic RNases H1. Human RNase H1 contains an additional cysteine adjacent to Cys148, and this residue is conserved in RNases H1 from vertebrates (Table I).Table IThe cysteine residues of RNases H1RNase HC18C46C147C148(13)C191C(63)C(133)Human+++++−−Mouse−++++−−Chicken−++++−−Yeast−+−−−−−C. elegans−−−+−−−T. brucei−+−+−−−C. fasciculata−+−+−−−E. coli−−−+−++H. influenzae−−−+−++S. typhimurium−−−+−++N. meningitidis−−−+−+−T. thermophila−−−+−+−HIV RT−−−−−Cysteine residues are numbered from the NH2 terminus of human RNase H1. Cysteines in parentheses correspond to the positions withinE. coli RNase H1 sequence. Open table in a new tab Cysteine residues are numbered from the NH2 terminus of human RNase H1. Cysteines in parentheses correspond to the positions withinE. coli RNase H1 sequence. In this study we have explored the role of the cysteine residues of Human RNase H1 with respect to the function of the enzyme. We have determined the optimum redox state for the protein as well as the effect of the redox state on the binding and catalytic properties of the enzyme. Finally, we have identified a unique redox switch formed by vicinal cysteine residues. Human RNase H1 was expressed and purified as previously described (11Wu H. Lima W.F. Crooke S.T. Antisense Nucleic Acid Drug Dev. 1998; 8: 53-61Crossref PubMed Scopus (54) Google Scholar, 16Wu H. Lima W.L. Crooke S.T. J. Biol. Chem. 1999; 274: 28270-28278Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar). The oxidized form of the enzyme was prepared by resuspending the lyophilized protein in dilution buffer (50 mm Tris, pH 7.5, 50 mm NaCl, 50% glycerol) to a final concentration of 0.5 mg/ml and incubating the enzyme at 25 °C for 1–4 h. The non-reduced form of human RNase H1 was prepared by resuspending the lyophilized protein in dilution buffer and adding 20–50 mm β-mercaptoethanol (BME) or 0.1–1 mm tris(2-carboxyethyl)phosphate (TCEP). Human RNase H1 was alkylated with NEM by reducing the protein with TCEP as described, adding 10–20 mm NEM and incubating for 1 h at 25 °C. The reduced and oxidized forms of the enzyme were analyzed by SDS-PAGE. The mutagenesis of human RNase H1 was performed using a PCR-based technique derived from Landtet al. (27Landt O. Grunert H. Hahn U. Gene (Amst.). 1990; 96: 125-128Crossref PubMed Scopus (638) Google Scholar). Briefly, two separate PCR were performed using a set of site-directed mutagenic primers and two vector-specific primers (11Wu H. Lima W.F. Crooke S.T. Antisense Nucleic Acid Drug Dev. 1998; 8: 53-61Crossref PubMed Scopus (54) Google Scholar). For the RNase H1[C147,148A] mutant, the 5′-oligodeoxynucleotide used for PCR was CTGATGGCGCTGCTTCCAGTAATGGGCGTTA and the 3′-oligodeoxynucleotide was TTACTGGAAGCAGCGCCACTAGTGTAGACGACG. The PCR primers for RNase H1[C147A] were 5′-CTGATGGCGCTTGCTCCAGTAATGGGGCTA and 3′-TTACTGGAGCAAGCGCCATCAGTGTAGACGACG. The primers for RNase H1[C148A] were 5′-CTGATGGCTGCGCTTCCAGTAATGGGGCTAGA and 3′-TTACTGGAAGCGCAGCCATCAGTGTAGACG. The primers for RNase H1[C191A] were 5′-CATGCAGCCGCTAAAGCCATTGAACAAGCAA and 3′-CAATGGCTTTAGCGGCTGCATGAATTTCCGCTCT. Approximately 1 μg of human RNase H1 cDNA was used as the template for the first round of amplification of both the amino- and carboxyl-terminal portions of the cDNA corresponding to the mutant site. The fragments were purified by agarose gel extraction (Qiagen). PCR was performed in two rounds consisting of, respectively, 15 and 25 amplification cycles (94 °C, 30 s; 55 °C, 30 s; 72 °C, 180 s). The purified fragments were used as the template for the second round of PCR using the two vector-specific primers. The final PCR product was purified and cloned into the expression vector pET17b (Novagen) as described previously (11Wu H. Lima W.F. Crooke S.T. Antisense Nucleic Acid Drug Dev. 1998; 8: 53-61Crossref PubMed Scopus (54) Google Scholar). The incorporation of the desired mutations was confirmed by DNA sequencing. The plasmid was transfected into E. coli BL21(DE3) (Novagen). The bacteria were grown in M9ZB medium (28Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Smith J.A. Seidman J.G. Struhl K. Current Protocols in Molecular Biology. Wiley and Sons, New York1988: 3.10.3Google Scholar) at 37 °C and harvested at OD600 of 0.9. The cells were induced with 0.5 mmisopropyl-1-thio-β-d-galactopyranoside at 37 °C for 2 h. The cells were lysed in 8 m urea solution, and the recombinant protein was partially purified with nickel-nitrilotriacetic acid-agarose (Qiagen). The human RNase H1 was purified by C4 reverse phase chromatography as described previously (11Wu H. Lima W.F. Crooke S.T. Antisense Nucleic Acid Drug Dev. 1998; 8: 53-61Crossref PubMed Scopus (54) Google Scholar). The recombinant protein was collected, lyophilized, and analyzed by 12% SDS-PAGE (28Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Smith J.A. Seidman J.G. Struhl K. Current Protocols in Molecular Biology. Wiley and Sons, New York1988: 3.10.3Google Scholar). The lyophilized protein was re-suspended in dilution buffer (50 mm Tris, pH 7.5, 50 mm NaCl, 50% glycerol). The oligoribonucleotides were synthesized on a PE-ABI 380B synthesizer using 5′-O-silyl-2′-O-bis(2-acetoxyethoxy)methyl ribonucleoside phosphoramidites and procedures described elsewhere (29Scaringe S.A. Wincott F.E. Caruthers M.H. J. Am. Chem. Soc. 1998; 120: 11820-11821Crossref Scopus (211) Google Scholar). The oligoribonucleotides were purified by reverse phase HPLC. The DNA oligonucleotides were synthesized on a PE-ABI 380B automated DNA synthesizer and standard phosphoramidite chemistry. The DNA oligonucleotides were purified by precipitation two times out of 0.5m NaCl with 2.5 volumes of ethyl alcohol. The RNA substrate was 5′-end-labeled with 32P using 20 u of T4 polynucleotide kinase (Promega), 120 pmol (7000 Ci/mmol) of [γ-32P]ATP (ICN), 40 pmol of RNA, 70 mm Tris, pH 7.6, 10 mm MgCl2, and 50 mm dithiothreitol. The kinase reaction was incubated at 37 °C for 30 min. The labeled oligoribonucleotide was purified by electrophoresis on a 12% denaturing polyacrylamide gel (30Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989: 431Google Scholar). The specific activity of the labeled oligonucleotide is ∼3000–8000 cpm/fmol. The heteroduplex substrates were prepared in 100 μl containing 50 nm unlabeled oligoribonucleotide, 105 cpm of 32P-labeled oligoribonucleotide, 100 nm complementary oligodeoxynucleotide, and hybridization buffer (20 mm Tris, pH 7.5, 20 mm KCl). Reactions were heated at 90 °C for 5 min, cooled to 37 °C, and 60 units of Prime RNase Inhibitor (5 Prime → 3 Prime, Boulder, CO) and MgCl2 at a final concentration of 1 mm were added. Hybridization reactions were incubated 2–16 h at 37 °C, and BME was added at final concentration ranging from 0 to 200 mm. The heteroduplex substrates were digested with 0.5 ng of human RNase H1 at 37 °C. A 10-μl aliquot of the cleavage reaction was removed at time points ranging from 2 to 120 min and quenched by adding 5 μl of stop solution (8 m urea and 500 mm EDTA). The aliquots were heated at 90 °C for 2 min, resolved in a 12% denaturing polyacrylamide gel, and the substrate and product bands were quantitated on a Amersham Biosciences PhosphorImager. The concentration of the converted product was plotted as a function of time. The initial cleavage rate was obtained from the slope (mole of RNA cleaved per min) of the best-fit line for the linear portion of the plot, which comprises, in general, <10% of the total reaction and data from at least five time points. Competition experiments were performed as described for the determination of initial rates with the exception that the hybridization reactions were prepared with 20 nmoligodeoxynucleotide, 10 nm oligoribonucleotide, and hybridization buffer without BME. Oxidized human RNase H1 was added to the hybridization reaction at final concentrations of 0.5 and 2.5 ng of protein. Alternatively, 20 mm BME and NEM-alkylated enzyme was added to the hybridization reaction at final concentrations of 0.5 and 2.5 ng. The hybridization reactions were digested with 250 pg of the reduced form of human RNase H1. The reactions were quenched, analyzed, and quantitated as described for the determination of initial rates. The gel renaturation assay was performed as described previously (6Rong Y.W. Carl P.L. Biochemistry. 1990; 29: 383-389Crossref PubMed Scopus (34) Google Scholar). Briefly, a 12% SDS-polyacrylamide gel containing 300,000 cpm of32P-labeled poly(rA)·poly(dT) per 13 × 15-cm gel was prepared. Following electrophoresis the SDS was removed by washing the gel with three changes 50 mm Tris, pH 8.0, 1 mm BME, 0.1 mm EDTA, and 25% (v/v) isopropanol for 20 min at 25 °C. The isopropanol was removed by washing the gel with two changes of 10 mm Tris, pH 8.0, and 5 mm BME for 15 min at 25 °C. The proteins were denatured by soaking the gel for 2 h at 25 °C with 50 mmTris, pH 8.0, 20 mm BME, 10 mm MgCl2, 50 mm NaCl, 6 m guanidine HCl, and 10% (v/v) glycerol. The proteins were renatured by washing the gel with three changes of 50 mm Tris, pH 8.0, 20 mm BME, 10 mm MgCl2, 50 mm NaCl, 2.5% Nonidet P-40, and 10% (v/v) glycerol for 20 h at 25 °C for reduced conditions and without BME for renaturation under oxidized conditions. Soluble radioactivity was washed from the gel with four changes of 5% (v/v) trichloroacedic acid and 1% (v/v) sodium pyrophosphate for 15 min at 25 °C. The gel was quantitated on a Amersham BiosciencesPhosphorImager. Trypsin digestion of human RNase H1 proteins was prepared in 30 μl containing 2 μm human RNase H1, 0.67m urea, 50 mm Tris-HCl, and 0.9 mmCaCl2 and a (trypsin:RNase H1) ratio of 1:75 (w/w) (32Mann M. Hendrickson R.C. Pandey A. Annu. Rev. Biochem. 2001; 70: 437-473Crossref PubMed Scopus (912) Google Scholar,33Smith R.D. Int. J. Mass Spectrom. 2000; 200: 509-544Crossref Scopus (68) Google Scholar). Digestion reactions were incubated for 2 h at 65 °C. Immediately after removing the samples from the hot water bath, 3 μl of Me2SO was added to the mixture to enhance the solubility of hydrophobic peptides. 3S. M. Manalili, J. J. Drader, and S. A. Hofstadler, manuscript in preparation. Samples with the reducing agent were prepared as above except with the addition of 5 mm TCEP. The reaction was allowed to proceed at room temperature for 1 h. In selected experiments, NEM (10 mm final concentration, shaken at room temperature for 3 h) was introduced at this point to irreversibly “cap” the free sulfhydryl groups before adding trypsin. A Zorbax C18 0.32 × 150-mm capillary silica column (Micro-Tech Scientific, Sunnyvale, CA) was employed on a Micro-Tech Ultra-Plus II HPLC system and directly coupled to the mass spectrometer. The mobile phases were 1% formic acid, 10% Me2SO (mobile phase A), and 1% formic acid, 10% Me2SO in acetonitrile (mobile phase B). Samples containing 25 μl of the human RNase H1 tryptic digest solution were injected onto the HPLC column, equilibrated with 99% A and 1% B at 4 μl/min, and eluted with 99% B and 1% A, also at 4 μl/min. Experiments were performed on a modified Bruker Daltonics (Billerica, MA) Apex II 94e electrospray ionization-Fourier transform ion cyclotron (ESI-FTICR) mass spectrometer (35Marshall A.G. Hendrickson C.L. Jackson G.S. Mass Spectrom. Rev. 1998; 17: 1-35Crossref PubMed Scopus (1640) Google Scholar) with an actively shielded 9.4-tesla superconducting magnet. μHPLC-ESI-FTICR mass spectra were acquired at 6-s intervals and subsequently processed using the ICR2LS software package (Pacific Northwest National Laboratory, Richmond, WA). The enzymatic activity of human RNase H1 under oxidized and reduced conditions is shown in Table IIA. Oxidation of human RNase H1 resulted in the ablation of cleavage activity. The initial cleavage rate (V0) observed for the enzyme under reduced conditions was greater than 3 orders of magnitude faster than the rate observed for the oxidized enzyme. The loss of the enzymatic activity resulting from the oxidation of human RNase H1 was observed to be reversible (Table IIA). The enzymatic activity for Human RNase H1 was regenerated to the level of activity observed for the reduced form when the oxidized enzyme was incubated with 20 mm BME for 10 min. Furthermore, the enzyme activity was readily regenerated without requiring gradual reduction of the protein through gradient methods such as dialysis suggesting that regeneration of the enzyme was rapid and cooperative. The initial cleavage rate for human RNase H1 increased as a function of the concentration of the reducing agent BME (Fig.1). The enzyme was most active at BME concentrations ≥20 mm, and no loss in enzymatic activity was observed at 200 mm BME. Finally, analysis of the oxidized and reduced forms of human RNase H1 by SDS-PAGE showed that both forms migrated as monomers on the gel (data not shown).Table IIV0 for the reduced and oxidized forms of human RNase H1A:Redox stateV0pm min−1Oxidized RNase H1<Detectable limit2-aThe detection limit of the assay corresponds to <1% of the heteroduplex substrate cleaved over 60 min.Reduced RNase H13500 ± 50Oxidized → reduced RNase H13328 ± 104B:Ratio (oxidized:reduced)V0pm min−1(0:1)7150 ± 250(2:1)3825 ± 325(10:1)<Detectable limit2-aThe detection limit of the assay corresponds to <1% of the heteroduplex substrate cleaved over 60 min.C:Ratio (NEM labeled:reduced)V0pm min−1(0:1)9200(2:1)2500(10:1)<Detectable limit2-aThe detection limit of the assay corresponds to <1% of the heteroduplex substrate cleaved over 60 min.A: initial rate measurements for human RNase H1 under oxidized and reduced conditions was determined as described under “Materials and Methods.” The V0 values are an average of three measurements with estimated errors of the coefficient of variation <10%. B: competition experiments were performed as described under “Materials and Methods.” The heteroduplex substrate was incubated with the oxidized form of human RNase H1 prior to adding the reduced form of the enzyme. The concentration of the reduced form of human RNase H1 enzyme was in excess of the substrate concentration. The concentration of the oxidized form of human RNase H1 was 10-fold in excess of the reduced enzyme. The initial rate for the reduced form of human RNase H1 enzyme alone and in the presence of the oxidized form of the enzyme was determined as described under “Materials and Methods.” C: the competition experiments were performed as described in B except that excess NEM-labeled human RNase H1 was used as the competing protein.2-a The detection limit of the assay corresponds to <1% of the heteroduplex substrate cleaved over 60 min. Open table in a new tab A: initial rate measurements for human RNase H1 under oxidized and reduced conditions was determined as described under “Materials and Methods.” The V0 values are an average of three measurements with estimated errors of the coefficient of variation <10%. B: competition experiments were performed as described under “Materials and Methods.” The heteroduplex substrate was incubated with the oxidized form of human RNase H1 prior to adding the reduced form of the enzyme. The concentration of the reduced form of human RNase H1 enzyme was in excess of the substrate concentration. The concentration of the oxidized form of human RNase H1 was 10-fold in excess of the reduced enzyme. The initial rate for the reduced form of human RNase H1 enzyme alone and in the presence of the oxidized form of the enzyme was determined as described under “Materials and Methods.” C: the competition experiments were performed as described in B except that excess NEM-labeled human RNase H1 was used as the competing protein. The oxidized form of human RNase H1 was observed to competitively inhibit the endoribonuclease activity of the reduced form of the enzyme (Table IIB). These experiments were performed under single-turnover kinetics with the concentration of the reduced form of human RNase H1 in excess of the substrate concentration and with the concentration of the oxidized form of the enzyme in excess of the reduced enzyme concentration. The V0 for the reduced form of the enzyme was 2-fold faster than the cleavage rate observed for the reduced form of the enzyme in the presence of 2-fold excess oxidized human RNase H1. In the presence of 10-fold excess oxidized enzyme, the initial cleavage rate for the reduced form of human RNase H1 was below the detection limit of the assay. Initial cleavage rates were also determined under multiple-turnover kinetics with the substrate concentration in excess of the enzyme concentration and with the concentration of the oxidized enzyme in 10-fold excess over the reduced form of human RNase H1. Competition experiments under multiple-turnover conditions showed no reduction in the cleavage rate compared with
Referência(s)