Cooperative Regulation of the Interferon Regulatory Factor-1 Tumor Suppressor Protein by Core Components of the Molecular Chaperone Machinery
2009; Elsevier BV; Volume: 284; Issue: 38 Linguagem: Inglês
10.1074/jbc.m109.019505
ISSN1083-351X
AutoresVikram Narayan, Mirjam Eckert, Maciej Żylicz, Maciej Żylicz, Kathryn L. Ball,
Tópico(s)Enzyme Structure and Function
ResumoOur understanding of the post-translational processes involved in regulating the interferon regulatory factor-1 (IRF-1) tumor suppressor protein is limited. The introduction of mutations within the C-terminal Mf1 domain (amino acids 301–325) impacts on IRF-1-mediated gene repression and growth suppression as well as the rate of IRF-1 degradation. However, nothing is known about the proteins that interact with this region to modulate IRF-1 function. A biochemical screen for Mf1-interacting proteins has identified an LXXLL motif that is required for binding of Hsp70 family members and cooperation with Hsp90 to regulate IRF-1 turnover and activity. These conclusions are supported by the finding that Hsp90 inhibitors suppress IRF-1-dependent transcription shortly after treatment, although at later time points inhibition of Hsp90 leads to an Hsp70-dependent depletion of nuclear IRF-1. Conversely, the half-life of IRF-1 is increased by Hsp90 in an ATPase-dependent manner leading to the accumulation of nuclear but not cytoplasmic IRF-1. This study begins to elucidate the role of the Mf1 domain of IRF-1 in orchestrating the recruitment of regulatory factors that can impact on both its turnover and transcriptional activity. Our understanding of the post-translational processes involved in regulating the interferon regulatory factor-1 (IRF-1) tumor suppressor protein is limited. The introduction of mutations within the C-terminal Mf1 domain (amino acids 301–325) impacts on IRF-1-mediated gene repression and growth suppression as well as the rate of IRF-1 degradation. However, nothing is known about the proteins that interact with this region to modulate IRF-1 function. A biochemical screen for Mf1-interacting proteins has identified an LXXLL motif that is required for binding of Hsp70 family members and cooperation with Hsp90 to regulate IRF-1 turnover and activity. These conclusions are supported by the finding that Hsp90 inhibitors suppress IRF-1-dependent transcription shortly after treatment, although at later time points inhibition of Hsp90 leads to an Hsp70-dependent depletion of nuclear IRF-1. Conversely, the half-life of IRF-1 is increased by Hsp90 in an ATPase-dependent manner leading to the accumulation of nuclear but not cytoplasmic IRF-1. This study begins to elucidate the role of the Mf1 domain of IRF-1 in orchestrating the recruitment of regulatory factors that can impact on both its turnover and transcriptional activity. Interferon regulatory factor-1 (IRF-1), 3The abbreviations used are: IRF-1interferon regulatory factor-1ELISAenzyme-linked immunosorbent assayGAPDHglyceraldehyde-3-phosphate dehydrogenasemAbmonoclonal antibodyGSTglutathione S-transferaseRTreverse transcriptionWTwild type. 3The abbreviations used are: IRF-1interferon regulatory factor-1ELISAenzyme-linked immunosorbent assayGAPDHglyceraldehyde-3-phosphate dehydrogenasemAbmonoclonal antibodyGSTglutathione S-transferaseRTreverse transcriptionWTwild type. the founding member of the interferon regulatory factor family, is a transcription factor that regulates a diverse range of target genes during the response to stimuli such as pathogen infection (1Taniguchi T. Ogasawara K. Takaoka A. Tanaka N. Annu. Rev. Immunol. 2001; 19: 623-655Crossref PubMed Scopus (1258) Google Scholar), DNA damage (2Tanaka N. Ishihara M. Lamphier M.S. Nozawa H. Matsuyama T. Mak T.W. Aizawa S. Tokino T. Oren M. Taniguchi T. Nature. 1996; 382: 816-818Crossref PubMed Scopus (301) Google Scholar, 3Pamment J. Ramsay E. Kelleher M. Dornan D. Ball K.L. Oncogene. 2002; 21: 7776-7785Crossref PubMed Scopus (77) Google Scholar), and hypoxia (4Tendler D.S. Bao C. Wang T. Huang E.L. Ratovitski E.A. Pardoll D.A. Lowenstein C.J. Cancer Res. 2001; 61: 3682-3688PubMed Google Scholar). In addition, the loss of IRF-1 can cooperate with c-Ha-ras (5Tanaka N. Ishihara M. Kitagawa M. Harada H. Kimura T. Matsuyama T. Lamphier M.S. Aizawa S. Mak T.W. Taniguchi T. Cell. 1994; 77: 829-839Abstract Full Text PDF PubMed Scopus (464) Google Scholar) in cellular transformation; it becomes up-regulated in cells that bear oncogenic lesions (6Passioura T. Dolnikov A. Shen S. Symonds G. Cancer Res. 2005; 65: 797-804PubMed Google Scholar), and deletions of IRF-1 are associated with the development of gastric and esophageal tumors, as well as some leukemias (7Nozawa H. Oda E. Ueda S. Tamura G. Maesawa C. Muto T. Taniguchi T. Tanaka N. Int. J. Cancer. 1998; 77: 522-527Crossref PubMed Scopus (78) Google Scholar, 8Tamura G. Sakata K. Nishizuka S. Maesawa C. Suzuki Y. Terashima M. Eda Y. Satodate R. J. Pathol. 1996; 180: 371-377Crossref PubMed Scopus (93) Google Scholar, 9Willman C.L. Sever C.E. Pallavicini M.G. Harada H. Tanaka N. Slovak M.L. Yamamoto H. Harada K. Meeker T.C. List A.F. et al.Science. 1993; 259: 968-971Crossref PubMed Scopus (379) Google Scholar). On the basis of these observations IRF-1 has been characterized as a tumor suppressor protein. Although initially identified as a component of the IFNβ-enhanceosome complex, IRF-1 has since been demonstrated to regulate the expression of a large cohort of interferon-responsive genes involved in negative growth control (10Fujita T. Sakakibara J. Sudo Y. Miyamoto M. Kimura Y. Taniguchi T. EMBO J. 1988; 7: 3397-3405Crossref PubMed Scopus (261) Google Scholar, 11Miyamoto M. Fujita T. Kimura Y. Maruyama M. Harada H. Sudo Y. Miyata T. Taniguchi T. Cell. 1988; 54: 903-913Abstract Full Text PDF PubMed Scopus (781) Google Scholar, 12Xie R.L. Gupta S. Miele A. Shiffman D. Stein J.L. Stein G.S. van Wijnen A.J. J. Biol. Chem. 2003; 278: 26589-26596Abstract Full Text Full Text PDF PubMed Scopus (53) Google Scholar). interferon regulatory factor-1 enzyme-linked immunosorbent assay glyceraldehyde-3-phosphate dehydrogenase monoclonal antibody glutathione S-transferase reverse transcription wild type. interferon regulatory factor-1 enzyme-linked immunosorbent assay glyceraldehyde-3-phosphate dehydrogenase monoclonal antibody glutathione S-transferase reverse transcription wild type. Structurally, IRF-1 includes several domains; prominent among these is a highly conserved N-terminal sequence-specific DNA-binding domain, a transactivation domain, and a C-terminal regulatory domain known as the enhancer (13Kirchhoff S. Oumard A. Nourbakhsh M. Levi B.Z. Hauser H. Eur. J. Biochem. 2000; 267: 6753-6761Crossref PubMed Scopus (27) Google Scholar). The enhancer was originally identified as a region required for maximal IRF-1-mediated transactivation, although it does not have intrinsic transactivation potential (13Kirchhoff S. Oumard A. Nourbakhsh M. Levi B.Z. Hauser H. Eur. J. Biochem. 2000; 267: 6753-6761Crossref PubMed Scopus (27) Google Scholar). More recent structure-function analysis has shown that the enhancer is involved in the recruitment of coactivators to IRF-1 target promoters (14Dornan D. Eckert M. Wallace M. Shimizu H. Ramsay E. Hupp T.R. Ball K.L. Mol. Cell. Biol. 2004; 24: 10083-10098Crossref PubMed Scopus (58) Google Scholar) and that it can facilitate IRF-1-mediated growth suppression (15Eckert M. Meek S.E. Ball K.L. J. Biol. Chem. 2006; 281: 23092-23102Abstract Full Text Full Text PDF PubMed Scopus (14) Google Scholar), as well as being an important determinant of the rate at which IRF-1 is degraded (15Eckert M. Meek S.E. Ball K.L. J. Biol. Chem. 2006; 281: 23092-23102Abstract Full Text Full Text PDF PubMed Scopus (14) Google Scholar, 16Nakagawa K. Yokosawa H. Eur. J. Biochem. 2000; 267: 1680-1686Crossref PubMed Scopus (71) Google Scholar, 17Pion E. Narayan V. Eckert M. Ball K.L. Cell. Signal. 2009; 21: 1479-1487Crossref PubMed Scopus (22) Google Scholar). Housed within the enhancer is a multifunctional subdomain that we have named Mf1 (Multifunctional 1; amino acids 301–325). This domain impacts on IRF-1-mediated transrepression of the CDK2 gene (14Dornan D. Eckert M. Wallace M. Shimizu H. Ramsay E. Hupp T.R. Ball K.L. Mol. Cell. Biol. 2004; 24: 10083-10098Crossref PubMed Scopus (58) Google Scholar) and is required for maximal IRF-1-mediated growth suppression (14Dornan D. Eckert M. Wallace M. Shimizu H. Ramsay E. Hupp T.R. Ball K.L. Mol. Cell. Biol. 2004; 24: 10083-10098Crossref PubMed Scopus (58) Google Scholar). Most recently studies have shown that Mf1 is also involved in processing of polyubiquitinated IRF-1 by the proteasome (17Pion E. Narayan V. Eckert M. Ball K.L. Cell. Signal. 2009; 21: 1479-1487Crossref PubMed Scopus (22) Google Scholar). Although the Mf1 is involved in multiple regulatory processes (15Eckert M. Meek S.E. Ball K.L. J. Biol. Chem. 2006; 281: 23092-23102Abstract Full Text Full Text PDF PubMed Scopus (14) Google Scholar, 17Pion E. Narayan V. Eckert M. Ball K.L. Cell. Signal. 2009; 21: 1479-1487Crossref PubMed Scopus (22) Google Scholar), nothing is currently known about the mechanism of action of this region and how, for example, cellular factors interact with the Mf1 domain to modulate IRF-1-dependent gene expression and growth repressor activity or to promote IRF-1 turnover. In this study, we provide evidence linking IRF-1 to the Hsp70 family and Hsp90, the core components of the molecular chaperone machinery. Originally defined by their role in de novo protein folding and the response to cellular stress (18Wandinger S.K. Richter K. Buchner J. J. Biol. Chem. 2008; 283: 18473-18477Abstract Full Text Full Text PDF PubMed Scopus (463) Google Scholar, 19Saibil H.R. Curr. Opin. Struct. Biol. 2008; 18: 35-42Crossref PubMed Scopus (138) Google Scholar), it is now recognized that the molecular chaperones have diverse functions in processes that include the following: protein folding (19Saibil H.R. Curr. Opin. Struct. Biol. 2008; 18: 35-42Crossref PubMed Scopus (138) Google Scholar), preventing the aggregation of denatured proteins (20Liberek K. Lewandowska A. Zietkiewicz S. EMBO J. 2008; 27: 328-335Crossref PubMed Scopus (315) Google Scholar), maintenance of cell signaling and trafficking pathways (21Pratt W.B. Toft D.O. Exp. Biol. Med. (Maywood). 2003; 228: 111-133Crossref PubMed Scopus (1239) Google Scholar, 22Vaughan C.K. Mollapour M. Smith J.R. Truman A. Hu B. Good V.M. Panaretou B. Neckers L. Clarke P.A. Workman P. Piper P.W. Prodromou C. Pearl L.H. Mol. Cell. 2008; 31: 886-895Abstract Full Text Full Text PDF PubMed Scopus (139) Google Scholar), and the assembly and/or disassembly of multiprotein complexes (23Ellis R.J. Trends Biochem. Sci. 2006; 31: 395-401Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar, 24Freeman B.C. Yamamoto K.R. Science. 2002; 296: 2232-2235Crossref PubMed Scopus (346) Google Scholar). In addition, Hsp70 and Hsp90 are involved in the regulation of diverse "client" proteins where changes in conformation and activity of mature proteins are the primary goal. Client proteins interact with Hsp70 and/or Hsp90 in a cyclic manner with binding and dissociation being linked to changes in chaperone conformation and the hydrolysis of ATP (25Pratt W.B. Morishima Y. Osawa Y. J. Biol. Chem. 2008; 283: 22885-22889Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar, 26Pearl L.H. Prodromou C. Annu. Rev. Biochem. 2006; 75: 271-294Crossref PubMed Scopus (875) Google Scholar). Here a requirement for the C-terminal Mf1 domain of IRF-1 in the recruitment of Hsp70 proteins is demonstrated. In turn it is shown that Hsp70 recruits Hsp90 and together they have an impact on the turnover, localization, and activity of IRF-1. The data highlight a novel IRF-1 interaction that contributes to its activation pathway suggesting that the molecular chaperones are key components of a regulatory network that maintains IRF-1 tumor suppressor function. Antibodies were used at 1 μg/ml and were anti-IRF-1 and anti-GFP (BD Biosciences), anti-GAPDH (Abcam), anti-FLAG and anti-GST (Sigma), anti-Chk1 (G-4), anti-caspase-3 (Santa Cruz Biotechnology), and anti-Hp1α (Upstate). All antibodies to heat shock proteins were from StressGen. Secondary antibodies were purchased from Dako Cytomation. 17AAG and radicicol (AG Scientific) were dissolved in DMSO to 1 mg/ml and used as detailed in the figure legends. MG-132 (Calbiochem) was dissolved in DMSO to 10 mm and used as indicated. Cycloheximide (Supelco) was dissolved in water to 5 mg/ml and used at 30 μg/ml. Peptides were from Chiron Mimotopes and were synthesized with a biotin tag at the N terminus with an SGSG spacer. A375 and H1299 cells were cultured in Dulbecco's modified Eagle's medium and RPMI 1640 medium (Invitrogen), respectively, supplemented with 10% (v/v) fetal bovine serum (Autogen Bioclear) and 1% (v/v) penicillin/streptomycin mixture (Invitrogen). Cells were seeded 24 h before transfection. DNA (250 ng unless stated otherwise) was transfected into the cells using Attractene (Qiagen) as described in the manufacturer's instructions. Cells were lysed in Triton Lysis Buffer (50 mm Hepes, pH 7.5, 0.1% (v/v) Triton X-100, 150 mm NaCl, 10 mm NaF, 2 mm dithiothreitol, 0.1 mm EDTA, 20 μg/ml leupeptin, 1 μg/ml aprotinin, 2 μg/ml pepstatin, 1 mm benzamidine, 10 μg/ml soybean trypsin inhibitor, 2 mm Pefabloc, 1.6 mm EGTA) unless otherwise indicated. 2× volume lysis buffer was added to the cell pellet and incubated on ice for 20 min, followed by centrifugation at 16,000 × g for 15 min at 4 °C. Supernatant was collected and the protein quantified by Bradford assay. Samples were analyzed by SDS-PAGE and transferred to nitrocellulose (Protran, Schleicher & Schuell). The membranes were blocked using 5% (w/v) nonfat milk powder in phosphate-buffered saline + 0.1% (v/v) Tween 20 (PBST) for 1 h at room temperature. Membranes were then incubated with primary antibody at 1 μg/ml for 1 h at room temperature (or overnight at 4 °C) followed by the secondary antibody (1:2000) for 1 h. The immunoblots were washed extensively between each step with PBST. Antibody binding was detected by enhanced chemiluminescence. A375 cell lysate (as above) was treated with avidin (Sigma) at 40 μg/ml for 30 min on ice and centrifuged at 16,000 × g for 5 min. Treated lysates were pre-cleared using Sepharose-4B (Sigma) beads for 1 h at 4 °C and applied to a peptide column. Peptide affinity columns were prepared using Mobicol column jackets (MoBiTec) containing 50 μl of streptavidin-agarose with biotin peptide. Enough biotinylated peptide to saturate the streptavidin-agarose bead binding sites was used (Sigma) and incubated with the beads for 1 h at room temperature, and the column was then washed three times with Buffer W (100 mm Tris-HCl, pH 8.0, 150 mm NaCl, 1 mm EDTA, 1 mm benzamidine) to remove unbound peptide. Cleared lysate (0.5 mg) was added to the column and incubated with the resin for 1 h at room temperature. The column was washed four times with phosphate-buffered saline + 0.2% Triton X-100 and one time with Buffer W. Bound proteins were eluted by boiling in SDS sample buffer. Eluates were run on a 4–12% NuPAGE gel (Invitrogen), and stained with colloidal blue (Invitrogen). Bands were excised and trypsinized in the gel prior to analysis by one-dimensional nanoliquid chromatography-tandem mass spectrometry using a 4000 QTrap (Applied Biosystems) tandem mass spectrometry system (Fingerprints Proteomics Facility, University of Dundee). The raw QTrap data were analyzed using Mascot. Alternatively, SDS-PAGE-separated samples were transferred onto nitrocellulose and immunoblotted as required. OneSTREP (IBA)-tagged IRF-1 (or empty vector) was transfected into A375 cells as described above. Post-transfection (24 h), cells were harvested and lysed in Triton Lysis Buffer. Following this, tagged complexes were purified according to the manufacturer's instructions and analyzed by SDS-PAGE/immunoblot. For the ELISA, purified recombinant Hsp70 or Hsc70 (250 ng) was coated onto a white 96-well plate (Fisher) in 0.1 m NaHCO3 buffer, pH 8.6, at 4 °C. Nonreactive sites were blocked using phosphate-buffered saline containing 3% bovine serum albumin. Empirically determined amounts of the protein of interest (GST, GST-IRF-1 WT, or GST-IRF-1 ΔEnh) were added in 1× Reaction Buffer (25 mm Hepes, pH 7.5, 50 mm KCl, 10 mm MgCl2, 5% (v/v) glycerol, 0.1% (v/v) Tween 20, 2 mg/ml bovine serum albumin) for 1 h at room temperature. After washing extensively in phosphate-buffered saline containing 0.1% (v/v) Tween 20, binding was detected using anti-GST and horseradish peroxidase-tagged anti-mouse antibodies, and electrochemical luminescence was quantified using a luminometer (Labsystems; Fluoroskan Ascent FL). A375 cells were lysed in fast protein liquid chromatography Lysis Buffer (20 mm Hepes, pH 7.5, 0.25 m NaCl, 10% (w/v) sucrose, 10% (v/v) glycerol, 0.1% (v/v) Triton X-100, 5 mm NaF, 2 mm β-glycerophosphate, 1 mm dithiothreitol, 20 μg/ml leupeptin, 1 μg/ml aprotinin, 2 μg/ml pepstatin, 1 mm benzamidine, 10 μg/ml soybean trypsin inhibitor, 2 mm Pefabloc, 1.6 mm EGTA) and passed through a 0.45-μm filter. Lysate generated from 1 × 10-cm plate extracted in 500 μl of buffer was loaded onto a 25-ml Superose-6 column (Amersham Biosciences) equilibrated in fast protein liquid chromatography column buffer (20 mm Hepes, pH 7.5, 0.25 m NaCl, 5% (w/v) sucrose, 5% (v/v) glycerol, 0.05% (v/v) Triton X-100, 5 mm NaF, 1 mm dithiothreitol, 1 mm benzamidine). The flow rate was adjusted to 0.4 ml/min, and 0.5-ml fractions were collected. Fractions were precipitated using trichloroacetic acid and analyzed by SDS-PAGE/immunoblot. H1299 cells were treated with 17AAG as indicated and harvested. Half of the cells were lysed in Triton Lysis Buffer, and analyzed for protein. From the remaining 50% of cells, RNA was extracted using the RNeasy mini kit (Qiagen). The extracted RNA was reverse-transcribed using the Omniscript RT kit (Qiagen). PCR was performed using PCR Master Mix (VH Bio) and an annealing temperature of 55 °C for 25 cycles. Primer sequences were as follows: IRF-1, TTAATAAAGAGGAGATGATCTTCC/CCTGCTTTGTATCGGCCTGTGTGA and GAPDH, GTCAGTGGTGGACCTGACCT/ACCTGGTGCTCAGTGTAGCC. For luciferase reporter assays, cells were cultured in 24-well plates and transfected with pCMV-Renilla/Luc (60 ng) together with either TLR3-Firefly/Luc WT or mutant (−ISRE; 140 ng). Luciferase assays were performed 24 h post-transfection using the Dual Luciferase® reporter assay system (Promega) according to the manufacturer's instructions. Luminescence was quantified using a Fluoroskan Ascent F1 luminometer (Labsystems). Signals were normalized using the internal control (Renilla luciferase signal). Results are represented as mean ± S.D. Subcellular fractionation was carried out using the ProteoExtract kit (Calbiochem) according to the manufacturer's instructions. For the half-life determination, A375 cells in 35-mm plates were transfected as indicated in the figure legends. Post-transfection (24 h), the cells were treated with 30 μg/ml cycloheximide and harvested at the indicated time points. Samples were fractionated as described above. Nuclear fractions (40 μg) were analyzed by SDS-PAGE/immunoblot. Band intensity was quantified using Scion Imaging software. The intensity of the zero time point was taken as 100%, and the others were measured relative to this. A graph of ln(% protein remaining) against time was plotted to obtain a linear graph. The equation of the graph was used to calculate the x axis value corresponding to y = ln(50%). This value represents the calculated half-life. The C-terminal enhancer region of IRF-1 (Fig. 1A) is an important regulatory domain (14Dornan D. Eckert M. Wallace M. Shimizu H. Ramsay E. Hupp T.R. Ball K.L. Mol. Cell. Biol. 2004; 24: 10083-10098Crossref PubMed Scopus (58) Google Scholar, 15Eckert M. Meek S.E. Ball K.L. J. Biol. Chem. 2006; 281: 23092-23102Abstract Full Text Full Text PDF PubMed Scopus (14) Google Scholar, 16Nakagawa K. Yokosawa H. Eur. J. Biochem. 2000; 267: 1680-1686Crossref PubMed Scopus (71) Google Scholar). Of particular interest is the Mf1 region (amino acids 301–325) that is essential for maximal IRF-1-mediated growth suppression (15Eckert M. Meek S.E. Ball K.L. J. Biol. Chem. 2006; 281: 23092-23102Abstract Full Text Full Text PDF PubMed Scopus (14) Google Scholar) and that plays a key role in determining the rate of IRF-1 degradation (17Pion E. Narayan V. Eckert M. Ball K.L. Cell. Signal. 2009; 21: 1479-1487Crossref PubMed Scopus (22) Google Scholar). In a quest to identify factors that mediate the regulatory functions of the Mf1 domain, we adapted a biochemical screen (Fig. 1B) developed to identify protein interaction motifs in IRF-1. 4V. Narayan and K. L. Ball, unpublished data. A biotin-labeled peptide (pep-(301–320)) based on amino acids 301–320 of IRF-1 was immobilized using streptavidin-agarose and used to generate an affinity column (50-μl volume). The column was loaded with A375 cell extract and washed extensively prior to the recovery of bound proteins. Eluted protein was analyzed using SDS-PAGE on 4–12% gradient gels and individual bands identified by mass fingerprinting (Fig. 1C, left panel). The major protein band pulled out by the pep-(301–320) column (Fig. 1C, left panel arrow) was analyzed by mass fingerprinting and was found to contain both constitutive and inducible members of the Hsp70 family of molecular chaperones. Immunoblot analysis using an Hsp70-specific antibody was used to confirm the mass fingerprint identification (Fig. 1C, right panel). The data presented above suggest that Hsp70 family members can bind to a 20-amino acid peptide based on part of the Mf1 domain. Based on this observation, evidence was sought that Hsp70 could bind the Mf1 region of IRF-1 when found in the context of the full-length protein. First, size exclusion chromatography was used to determine whether cellular IRF-1 and Hsp70 coeluted in a manner consistent with complex formation in the cellular environment. Using a Superose-6 column, IRF-1 from A375 cell lysate was found to elute in three distinct peaks (Fig. 2A) as follows: one in the void volume (peak 1) and two that were included (peaks 2 and 3), indicative of multiple IRF-1-containing complexes. Peak 2 coeluted with fractions that also contained Hsp70 suggesting that cellular IRF-1 and Hsp70 may be present in the same complex. To provide further evidence of Hsp70-IRF-1 complex formation in cells, OneStrep-tagged IRF-1 was expressed in A375 cells and captured using a Streptactin column. Fig. 2B shows that OneStrep-IRF-1 was quantitatively depleted from cell extracts by Streptactin with no tagged-IRF-1 detectable in the flow-through. When OneStrep-IRF-1 bound protein was analyzed for the presence of 70-kDa heat shock protein family members using an antibody to Hsp/c70, of the three isoforms detected in the cell extract, only one isoform bound specifically to IRF-1 (Fig. 2B), and no binding was detected in the control lane. This suggests that the interaction between full-length IRF-1 and the cellular Hsp70 proteins is fairly specific as one isoform bound with a higher affinity. The above experiments suggest that Hsp70 family members can form a complex with IRF-1 in cells and that the interaction is specific to certain Hsp70 isoforms; however, they do not address whether the interaction is direct or if additional cellular factors are required. To determine whether Hsp70 could bind directly to IRF-1, we used recombinant proteins purified from E. coli. Hsp70 and Hsc70 (27Walerych D. Kudla G. Gutkowska M. Wawrzynow B. Muller L. King F.W. Helwak A. Boros J. Zylicz A. Zylicz M. J. Biol. Chem. 2004; 279: 48836-48845Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar) bound to GST-IRF-1 when they were immobilized (Fig. 2C). However, the affinity of Hsp70 was an order of magnitude greater than that of Hsc70 suggesting that IRF-1 interacts preferentially with Hsp70. As the interaction between IRF-1 and Hsp70 was identified using an Mf1 domain peptide (pep-(301–320); Fig. 1C), we determined whether the C-terminal domain was required for Hsp70 to bind full-length IRF-1. To do this a C-terminal IRF-1 deletion mutant (IRF-1ΔEnh (15Eckert M. Meek S.E. Ball K.L. J. Biol. Chem. 2006; 281: 23092-23102Abstract Full Text Full Text PDF PubMed Scopus (14) Google Scholar) was purified from an E. coli expression system. A comparison of Hsp70 binding to purified WT and ΔEnh IRF-1 (Fig. 2D) suggests that deletion of the C-terminal Mf1 domain leads to a significant decrease in the affinity of IRF-1 for Hsp70 supporting a role for the enhancer domain in engaging the chaperone machinery. In addition, as residual Hsp70 binding to the ΔEnh IRF-1 protein was detected, the interaction between IRF-1 and Hsp70 is likely to be complex, involving more than one interface. To confirm the presence of an additional interface(s) for Hsp70 in IRF-1, we used a series of overlapping peptides that spanned the length of IRF-1 and asked if any of these peptides could bind to Hsp70 from cell lysates. Fig. 2E shows that Hsp70 bound predominantly to the Mf1 domain and to a second peptide based on a region from the N-terminal DNA binding domain of IRF-1 (amino acids 91–110). As the crystal structure for the N-terminal domain of IRF-1 has been solved (28Escalante C.R. Yie J. Thanos D. Aggarwal A.K. Nature. 1998; 391: 103-106Crossref PubMed Scopus (313) Google Scholar), we were able to see that this region of IRF-1 forms a solvent-exposed flexible loop (data not shown). Thus, IRF-1-Hsp70 complex formation appears to require at least two distinct interfaces, one of which is composed of a solvent-exposed flexible loop. Hsp70, together with a second molecular chaperone Hsp90, is an essential component of a multiprotein complex that interacts with key regulatory factors involved in the control of cellular proliferation, differentiation, and death. Although Hsp90 has been demonstrated to interact directly with some client proteins in vitro, there is speculation that in the cellular environment Hsp90 will inevitably function together with Hsp70 (25Pratt W.B. Morishima Y. Osawa Y. J. Biol. Chem. 2008; 283: 22885-22889Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar, 29Te J. Jia L. Rogers J. Miller A. Hartson S.D. J. Proteome Res. 2007; 6: 1963-1973Crossref PubMed Scopus (50) Google Scholar). As the results presented above suggested that IRF-1 can interact specifically with Hsp70 both in vitro and in a cellular environment, we sought to determine whether IRF-1 was also a client of the Hsp90 chaperone complex. Hsp90 client proteins are targeted for proteasomal degradation upon treatment with Hsp90-specific inhibitors such as 17AAG and radicicol (30Neckers L. Mimnaugh E. Schulte T.W. Drug Resist. Updat. 1999; 2: 165-172Crossref PubMed Scopus (66) Google Scholar, 31Neckers L. Schulte T.W. Mimnaugh E. Invest. New Drugs. 1999; 17: 361-373Crossref PubMed Scopus (285) Google Scholar). When A375 cells were treated with a titration of 17AAG (25 nm to 20 μm), IRF-1 protein steady state levels decreased by 12 h using concentrations of the drug in the low nanomolar range (Fig. 3A, compare lanes 3 and 4 with lane 1). The effect of 17AAG on IRF-1 was verified in a second cell line as IRF-1 steady state levels were reduced by the drug in H1299 cells, as well as in A375 cells (Fig. 3B). To confirm that the 17AAG-induced decrease in the steady state levels of the IRF-1 protein was because of Hsp90 inhibition, and not an off-target effect of the drug itself, a second Hsp90 inhibitor, radicicol, was used. Although the mechanism of action of radicicol and 17AAG are similar (both bind to and block the ATP-binding site on Hsp90), radicicol is structurally unrelated to 17AAG. Fig. 3C (compare lanes 2 and 3 to lane 1) demonstrates that, similar to 17AAG, radicicol treatment causes a decrease in IRF-1 protein levels. To determine at which stage in the IRF-1 regulatory pathway Hsp90 was operating, we first asked whether 17AAG was able to act on exogenous as well as endogenous IRF-1. Fig. 4A shows that IRF-1 proteins expressed in an untagged form (lanes 3 and 4) and as a FLAG fusion protein (lanes 5 and 6), like endogenous IRF-1 (lanes 1 and 2), were sensitive to treatment with 17AAG, suggesting that the drug was not functioning through an effect on the IRF-1 promoter. This conclusion was supported by data showing that 17AAG used at either 1 or 10 μm had no effect on IRF-1 mRNA levels (Fig. 4B). As Hsp90 inhibitors have been shown to stimulate degradation of client proteins via the ubiquitin-mediated proteasome pathway, we tested whether 17AAG-dependent IRF-1 loss was sensitive to the proteasome inhibitor MG132. As shown in Fig. 4C, the effect of 17AAG on IRF-1 protein levels was partially lost upon treatment with MG132 (compare lanes 1 and 3 with lane 4), suggesting that proteasome-dependent degradation may play a role in the decrease in IRF-1 steady state levels observed upon inhibition of Hsp90 and that the effect of 17AAG is post-translational. Treatment of cells with 17AAG led to a decrease in IRF-1 protein levels at 12 h post-treatment; however, at earlier time points the steady state levels of IRF-1 were not affected significantly by Hsp90 inhibition (Fig. 5A). The time-dependent nature of 17AAG was exploited to assess its effect on the ability of endogenous IRF-1 to activate transcription at time points where no change in total IRF-1 protein levels was seen. Using a reporter in which the TLR3 promoter, an IRF-1 target gene (32Heinz S. Haehnel V. Karaghiosoff M. Schwarzfischer L. Müller M. Krause S.W. Rehli M. J. Biol. Chem. 2003; 278: 21502-21509Abstract Full Text Full Text PDF PubMed Scopus (164) Google Scholar), was linked to the expression of luciferase, 17AAG (1 μm) treatment consistently caused a decrease in IRF-1 activity prior to decreases in IRF-1 steady state levels (Fig. 5B). As IRF-1 is described as a relatively weak transcriptional activator (13Kirchhoff S. Oumard A. Nourbakhsh M. Levi B.Z. Hauser H. Eur. J. Biochem. 2000; 267: 6753-6761Crossref PubMed Scopus (27) Google Scholar), even small changes
Referência(s)