A Central Role for Decorin during Vertebrate Convergent Extension
2009; Elsevier BV; Volume: 284; Issue: 17 Linguagem: Inglês
10.1074/jbc.m808991200
ISSN1083-351X
AutoresJason J. Zoeller, Wittaya Pimtong, Helen Corby, Silvia Goldoni, Alex E. Iozzo, Rick T. Owens, Shiu‐Ying Ho, Renato V. Iozzo,
Tópico(s)Protease and Inhibitor Mechanisms
ResumoDecorin, an archetypal member of the small leucine-rich proteoglycan gene family, regulates collagen fibrillogenesis and cell growth. To further explore its biological function, we examined the role of Decorin during zebrafish development. Zebrafish Decorin is a chondroitin sulfate proteoglycan that exhibits a high degree of conservation with its mammalian counterpart and displays a unique spatiotemporal expression pattern. Morpholino-mediated knockdown of zebrafish decorin identified a developmental role during medial-lateral convergence and anterior-posterior extension of the body plan, as well as in craniofacial cartilage formation. decorin morphants displayed a pronounced shortening of the head-to-tail axis as well as compression, flattening, and extension of the jaw cartilages. The morphant phenotype was efficiently rescued by zebrafish decorin mRNA. Unexpectedly, microinjection of excess zebrafish decorin mRNA or proteoglycan/protein core into one-cell stage embryos caused cyclopia. The morphant and overexpression phenotype represent a convergent extension defect. Our results indicate a central function for Decorin during early embryogenesis. Decorin, an archetypal member of the small leucine-rich proteoglycan gene family, regulates collagen fibrillogenesis and cell growth. To further explore its biological function, we examined the role of Decorin during zebrafish development. Zebrafish Decorin is a chondroitin sulfate proteoglycan that exhibits a high degree of conservation with its mammalian counterpart and displays a unique spatiotemporal expression pattern. Morpholino-mediated knockdown of zebrafish decorin identified a developmental role during medial-lateral convergence and anterior-posterior extension of the body plan, as well as in craniofacial cartilage formation. decorin morphants displayed a pronounced shortening of the head-to-tail axis as well as compression, flattening, and extension of the jaw cartilages. The morphant phenotype was efficiently rescued by zebrafish decorin mRNA. Unexpectedly, microinjection of excess zebrafish decorin mRNA or proteoglycan/protein core into one-cell stage embryos caused cyclopia. The morphant and overexpression phenotype represent a convergent extension defect. Our results indicate a central function for Decorin during early embryogenesis. Proteoglycan-enriched extracellular matrices provide powerful messages to the cells via signaling events that vary from storing growth factors and morphogens to modulating their bioactivity and interactions with their cognate receptors (1.Ramirez F. Rifkin D.B. Matrix Biol. 2003; 22: 101-107Crossref PubMed Scopus (142) Google Scholar). Decorin belongs to the family of the small leucine-rich proteoglycans (SLRPs) 3The abbreviations used are: SLRPs, small leucine-rich proteoglycans; GAG, glycosaminoglycan; EGFR, epidermal growth factor receptor; HS, heparan sulfate; cABC, chondroitinase ABC; ISH, in situ hybridization; FBS, fetal bovine serum; PBS, phosphate-buffered saline; dpf, days post-fertilization; hpf, hours post-fertilization; RT, reverse transcription; MO, morpholino. (2.Ameye L. Young M.F. Glycobiology. 2002; 12: R107-R116Crossref PubMed Scopus (367) Google Scholar, 3.Iozzo R.V. J. Biol. Chem. 1999; 274: 18843-18846Abstract Full Text Full Text PDF PubMed Scopus (577) Google Scholar, 4.Schaefer L. Iozzo R.V. J. Biol. Chem. 2008; 283: 2135-2139Abstract Full Text Full Text PDF Scopus (401) Google Scholar). The Decorin protein core directly binds type I collagen, a key biological interaction that controls the pace and extent of collagen fibril formation both in vitro and in vivo (5.Reed C.C. Iozzo R.V. Glycoconj. J. 2002; 19: 249-255Crossref PubMed Scopus (312) Google Scholar). The attached glycosaminoglycan (GAG) chain also contributes by coordinating the proper spacing between the fibrils (6.Rühland C. Schönherr E. Robenek H. Hansen U. Iozzo R.V. Bruckner P. Seidler D.G. FEBS J. 2007; 274: 4246-4255Crossref PubMed Scopus (126) Google Scholar). The structural requirement of Decorin during these events was clearly manifested by the decorin-null mice. Gene targeting of murine decorin resulted in irregular collagen fibril morphology associated with fragility of the skin (7.Danielson K.G. Baribault H. Holmes D.F. Graham H. Kadler K.E. Iozzo R.V. J. Cell Biol. 1997; 136: 729-743Crossref PubMed Scopus (1189) Google Scholar). In addition to various collagen types, Decorin binds to Zn2+, fibrin, fibronectin, C1q, thrombospondin, transforming growth factor β, LRP1, and EGFR (8.Yang V.W.C. LaBrenz S.R. Rosenberg L.C. McQuillan D. Höök M. J. Biol. Chem. 1999; 274: 12454-12460Abstract Full Text Full Text PDF PubMed Scopus (30) Google Scholar, 9.Dugan T.A. Yang V.W.C. McQuillan D.J. Höök M. J. Biol. Chem. 2006; 281: 38208-38216Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar, 10.Schmidt G. Robenek H. Harrach B. Glössl J. Nolte V. Hörmann H. Richter H. Kresse H. J. Cell Biol. 1987; 104: 1683-1691Crossref PubMed Scopus (130) Google Scholar, 11.Krumdieck R. Höök M. Rosenberg L.C. Volanakis J.E. J. Immunol. 1992; 149: 3695-3701PubMed Google Scholar, 12.Winnemöller M. Schön P. Vischer P. Kresse H. Eur. J. Cell Biol. 1992; 59: 47-55PubMed Google Scholar, 13.Hildebrand A. Romaris M. Rasmussen L.M. Heinegård D. Twardzik D.R. Border W.A. Ruoslahti E. Biochem. J. 1994; 302: 527-534Crossref PubMed Scopus (866) Google Scholar, 14.Ferdous Z. Wei V.M. Iozzo R.V. Höök M. Grande-Allen K.J. J. Biol. Chem. 2007; 282: 35887-35898Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar, 15.Iozzo R.V. Moscatello D. McQuillan D.J. Eichstetter I. J. Biol. Chem. 1999; 274: 4489-4492Abstract Full Text Full Text PDF PubMed Scopus (322) Google Scholar, 16.Santra M. Reed C.C. Iozzo R.V. J. Biol. Chem. 2002; 277: 35671-35681Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar, 17.Brandan E. Cabello-Verrugio C. Vial C. Matrix Biol. 2008; 27: 700-708Crossref PubMed Scopus (81) Google Scholar). Decorin is also involved in the pathogenesis of renal diseases (18.Schaefer L. Macakova K. Raslik I. Micegova M. Gröne H.-J. Schönherr E. Robenek H. Echtermeyer F.G. Grässel S. Bruckner P. Schaefer R.M. Iozzo R.V. Kresse H. Am. J. Pathol. 2002; 160: 1181-1191Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar, 19.Schaefer L. Mihalik D. Babelova A. Krzyzankova M. Grone H.J. Iozzo R.V. Young M.F. Seidler D.G. Lin G. Reinhardt D. Schaefer R.M. Am. J. Pathol. 2004; 165: 383-396Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar, 20.Williams K.J. Qiu G. Usui H.K. Dunn S.R. McCue P. Bottinger E. Iozzo R.V. Sharma K. Am. J. Pathol. 2007; 171: 1441-1450Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar), angiogenesis (21.Grant D.S. Yenisey C. Rose R.W. Tootell M. Santra M. Iozzo R.V. Oncogene. 2002; 21: 4765-4777Crossref PubMed Scopus (189) Google Scholar), wound healing (22.Järveläinen H. Puolakkainen P. Pakkanen S. Brown E.L. Höök M. Iozzo R.V. Sage H. Wight T.N. Wound Repair Regen. 2006; 14: 443-452Crossref PubMed Scopus (132) Google Scholar), myocardial infarction (23.Weis S.M. Zimmerman S.D. Shah M. Covell J.W. Omens J.H. Ross Jr., J. Dalton N. Jones Y. Reed C.C. Iozzo R.V. McCulloch A.D. Matrix Biol. 2005; 24: 313-324Crossref PubMed Scopus (85) Google Scholar), lung mechanics (24.Fust A. LeBellego F. Iozzo R.V. Roughley P.J. Ludwig M.S. Am. J. Physiol. 2005; 288: L159-L166Crossref PubMed Scopus (49) Google Scholar), tooth development (25.Goldberg M. Septier D. Rapoport O. Iozzo R.V. Young M.F. Ameye L.G. Calcif. Tissue Int. 2005; 77: 297-310Crossref PubMed Scopus (64) Google Scholar), and bone marrow stromal cell biology (26.Bi Y. Stueltens C.H. Kilts T. Wadhwa S. Iozzo R.V. Robey P.G. Chen X.-D. Young M.F. J. Biol. Chem. 2005; 280: 30481-30489Abstract Full Text Full Text PDF PubMed Scopus (210) Google Scholar). The function of Decorin through the EGFR has been extensively linked to the pathobiology of cancer (27.Moscatello D.K. Santra M. Mann D.M. McQuillan D.J. Wong A.J. Iozzo R.V. J. Clin. Investig. 1998; 101: 406-412Crossref PubMed Scopus (245) Google Scholar, 28.Csordás G. Santra M. Reed C.C. Eichstetter I. McQuillan D.J. Gross D. Nugent M.A. Hajnóczky G. Iozzo R.V. J. Biol. Chem. 2000; 275: 32879-32887Abstract Full Text Full Text PDF PubMed Scopus (199) Google Scholar, 29.Santra M. Eichstetter I. Iozzo R.V. J. Biol. Chem. 2000; 275: 35153-35161Abstract Full Text Full Text PDF PubMed Scopus (183) Google Scholar, 30.Reed C.C. Waterhouse A. Kirby S. Kay P. Owens R.A. McQuillan D.J. Iozzo R.V. Oncogene. 2005; 24: 1104-1110Crossref PubMed Scopus (180) Google Scholar, 31.Seidler D.G. Goldoni S. Agnew C. Cardi C. Thakur M.L. Owens R.A. McQuillan D.J. Iozzo R.V. J. Biol. Chem. 2006; 281: 26408-26418Abstract Full Text Full Text PDF PubMed Scopus (151) Google Scholar, 32.Goldoni S. Seidler D.G. Heath J. Fassan M. Baffa R. Thakur M.L. Owens R.A. McQuillan D.J. Iozzo R.V. Am. J. Pathol. 2008; 173: 844-855Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar, 33.Goldoni S. Iozzo R.V. Int. J. Cancer. 2008; 123: 2473-2479Crossref PubMed Scopus (136) Google Scholar). Notably, double mutant mice lacking both decorin and the tumor suppressor p53 die early as a consequence of aggressive lymphomas (34.Iozzo R.V. Chakrani F. Perrotti D. McQuillan D.J. Skorski T. Calabretta B. Eichstetter I. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 3092-3097Crossref PubMed Scopus (122) Google Scholar), suggesting that Decorin is permissive for tumorigenesis. In line with this hypothesis, a recent study utilizing decorin-null animals, which were backcrossed into a different genetic background, has shown that the lack of decorin favors spontaneous occurrence of intestinal tumors in ∼30% of the cases, and this tumor burden and frequency were exacerbated by subjecting the mutant mice to a high risk diet (35.Bi X. Tong C. Dokendorff A. Banroft L. Gallagher L. Guzman-Hartman G. Iozzo R.V. Augenlicht L.H. Yang W. Carcinogenesis. 2008; 29: 1435-1440Crossref PubMed Scopus (112) Google Scholar). In this study, to further explore the functions of Decorin, we utilized the zebrafish, Danio rerio, as a model organism. We identified zebrafish Decorin as a chondroitin sulfate proteoglycan that maintains a significant degree of conservation with the mammalian counterpart. Focusing on embryonic development, we defined the developmental expression profile of zebrafish decorin and applied a morpholino knockdown approach to block endogenous Decorin expression. The decorin morphants displayed a range of phenotypes characterized by progressive shortening of the body axis associated with abnormal craniofacial cartilage development. Zebrafish decorin mRNA was capable of rescuing the morphant phenotype. Interestingly, we found that an excess of zebrafish decorin mRNA induced cyclopia. Both the morphant and overexpressing phenotypes represent defects in embryonic convergent extension, the coordinated movement of embryonic cells in the anterior-posterior and medial-lateral directions (36.Tada M. Concha M.L. Heisenberg C.-P. Semin. Cell Dev. Biol. 2002; 13: 251-260Crossref PubMed Scopus (180) Google Scholar). Convergent extension cell movements are required for proper establishment of the vertebrate body plan and are largely mediated by the noncanonical Wnt pathway (planar cell polarity pathway) converging on RhoA and Rac as downstream effectors of cell movement (37.Topczewski J. Sepich D.S. Myers D.C. Walker C. Amores A. Lele Z. Hammerschmidt M. Postlethwait J. Solnica-Krezel L. Dev. Cell. 2001; 1: 251-264Abstract Full Text Full Text PDF PubMed Scopus (370) Google Scholar, 38.Marlow F. Zwartkruis F. Malicki J. Neuhauss S.C.F. Abbas L. Weaver M. Driever W. Solnica-Krezel L. Dev. Biol. 1998; 203: 382-399Crossref PubMed Scopus (114) Google Scholar, 39.Heisenberg C.-P. Tada M. Rauch G.-J. Saúde L. Concha M.L. Geisler R. Stemple D.L. Smith J.C. Wilson S.W. Nature. 2000; 405: 76-81Crossref PubMed Scopus (839) Google Scholar, 40.Marlow F. Topczewski J. Sepich D. Solnica-Krezel L. Curr. Biol. 2002; 12: 876-884Abstract Full Text Full Text PDF PubMed Scopus (283) Google Scholar). Collectively, our findings indicate a novel and crucial role for Decorin function during establishment of the embryonic body plan. Cloning, Analysis, Synthesis, and Purification of Zebrafish decorin mRNA and Protein—Zebrafish decorin was PCR-amplified from a zebrafish cDNA template with the following primer pair, 5′-GGCGCGCCTTATGAAATCGGCCTGTCTCTCCCTG-3′ and 5′-CTCGAGCTTCTTCCTGTAGTTGCCGAGCT-3′ (Operon). The zebrafish decorin coding sequence was cloned into pCRII:TOPO (Invitrogen). Zebrafish decorin was then subcloned into the AsCI and XhoI sites of the pCEP-Pu-Hulk vector. pCEP-Pu-Hulk-zDcn was transfected by Lipofectamine (Invitrogen) into human embryonic kidney cells (293-EBNA) for the synthesis and purification of recombinant zebrafish Decorin as described previously (41.Zhu J.-X. Goldoni S. Bix G. Owens R.A. McQuillan D. Reed C.C. Iozzo R.V. J. Biol. Chem. 2005; 280: 32468-32479Abstract Full Text Full Text PDF PubMed Scopus (172) Google Scholar, 42.Goldoni S. Owens R.T. McQuillan D.J. Shriver Z. Sasisekharan R. Birk D.E. Campbell S. Iozzo R.V. J. Biol. Chem. 2004; 279: 6606-6612Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar). Chondroitinase ABC Digestion—Recombinant zebrafish Decorin (∼0.5 μg) was subjected to chondroitinase ABC digestion (6.5 milliunits, Sigma) for 5 h at 37 °C in a buffer containing 0.1 m Tris base, 30 mm sodium acetate, pH 8.0. Human recombinant Decorin (0.2 μg) was used as positive control for the digestion reaction. Samples were then separated on an 8% SDS-PAGE and detected by immunoblotting with a monoclonal anti-His antibody (Qiagen). Functional Assays with Zebrafish Decorin—For EGFR analysis, HeLa cells were plated on a 12-well plate (Nunc) and grown to subconfluency followed by serum starvation overnight. The next day cells were incubated with zebrafish Decorin (30 μg/ml) for 2 h, washed twice with Dulbecco's PBS, followed by extraction with RIPA buffer. Lysates were then separated on an 8% SDS-PAGE and subjected to immunoblotting with polyclonal anti-EGFR (Santa Cruz Biotechnology) and anti-phospho-EGFR-Tyr-1068 (Cell Signaling). β-Actin was used as loading control. For matrix binding analysis, glass slides were coated with collagen type I, fibronectin, or laminin 111 (BD Biosciences). Slides were incubated overnight at 37 °C with conditioned media from 293-EBNA cells, as negative control, or 293-EBNA cells expressing zebrafish decorin. The next day, wells were washed three times with Dulbecco's PBS and subjected to standard immunostaining with monoclonal anti-His (Qiagen), followed by secondary anti-mouse rhodamine-conjugated antibody (Santa Cruz Biotechnology). Fluorescence images were acquired using an Olympus BX51 microscope driven by SPOT advanced version 4.0.9 imaging software (Diagnostic Instruments, Inc.). The fluorescence intensity (pixels) representing zebrafish Decorin bound to the matrix components was obtained using the histogram function of Adobe Photoshop CS2®. For tumor cell proliferation and apoptosis assays, HeLa cells were seeded in 96-well plates and grown in full serum medium for 48 h in the presence or absence of zDcn (30 μg/ml). Media were changed after 24 h. Proliferation was measured by incubation with CellTiter 96® AQueous One Solution (Promega) at day 0 and after 24 and 48 h of zDcn treatment. Apoptosis was measured using the Caspase-Glo® 3/7 Assay (Promega). Both kits were used following the manufacturer's instructions. Proliferation activity was measured at 490 nm, and luminosity was measured to detect apoptosis. Zebrafish Decorin Glycosaminoglycan Analysis—Recombinant zebrafish Decorin glycosaminoglycan chains (GAGs) were released from purified proteoglycan samples following treatment with 1 m NaBH4 in 0.5 n NaOH at 37 °C. The released GAGs were precipitated from the solution with cold ethanol and resuspended in water. Selected samples were then treated with either chondroitinase ABC or nitrous acid, pH 1.5. Samples were applied to cellulose acetate membranes (Super Sepraphore, Pall Corp.) along with hyaluronic acid/chondroitin sulfate mixed standards, and electrophoresis was performed in 0.1 m KH2PO4, pH 2.0, for 3 h at 35 mA. Following electrophoresis, GAGs were visualized by staining with 0.2% Alcian blue. Zebrafish Embryos, decorin Morpholino Design, and Microinjection—Wild-type zebrafish embryos were cultured at ∼28 °C according to common procedures in phenylthiourea-supplemented embryo medium to prevent pigmentation. All embryos were housed in the zebrafish facility at Thomas Jefferson University according to the guidelines put forth by IACUC. Morpholino antisense oligonucleotides (Gene Tools, LLC) were designed to target/block the 5′-untranslated region/translation start (Dcn-MOSTART) or to target/block a splice junction (Dcn-MOSPLICE) within zebrafish decorin. decorin morpholino sequences were as follows: Dcn-MOSTART GACAGGCCGATTTCATGTTGCTGAC and Dcn-MOSPLICE GCAGACCTGGGCATTTTGACACAGA. The nonspecific standard morpholino was used as a control (Control-MO). The standard control morpholino sequence was as follows: Control-MO CCTCTTACCTCAGTTACAATTTATA. Nonspecific morpholino off-target effects were eliminated by co-knockdown with p53-MO as described previously (43.Robu M.E. Larson J.D. Nasevicius A. Beiraghi S. Brenner C. Farber S.A. Ekker S.C. PLoS Genet. 2007; 3: e78Crossref PubMed Scopus (836) Google Scholar). The p53 morpholino sequence was as follows: p53-MO GCGCCATTGCTTTGCAAGAATTG. Morpholino (≤20 ng per embryo) was microinjected into 1-cell stage zebrafish embryos according to common practice (44.Nasevicius A. Ekker S.C. Nat. Genet. 2000; 26: 216-220Crossref PubMed Scopus (2137) Google Scholar). Phenotype observations and overall gross morphology were visualized with either a Leica MZFIII stereo microscope and photographed with an Axiocam camera (Carl Zeiss, Inc.) and AxioVision software version 3.0.6.1 or a Leica MZ16FA stereo microscope equipped with a DFC500 camera and Application Suite version 2.5.0.r1 (Leica). Embryos were imaged in either 4% methylcellulose, PBS plus Tween 20 (0.1%) or embryo medium, and anesthetized with Tricaine when necessary. The morphant phenotype was defined by comparison with matched control embryos. All embryos were classified by 2 dpf as normal and described by 180° full extension of the head-to-tail axis; mild was described by body curvature associated with a nearly full extension of the tail without straightening; moderate was described by tail extension just past the yolk ball margin; and severe was described by abnormal short bodies associated with a tail that did not extend past the yolk ball. Reverse Transcription-PCR—Zebrafish total RNA (n = 51 embryos/group for developmental analysis and n = 26 embryos/group for morpholino splice junction blocking) verification was isolated according to the TRIzol method (Invitrogen). For reverse transcription, ∼5 μg of total RNA was annealed with oligo(dT) primer (Roche Applied Science) at 70 °C for 5 min followed by the addition of 5× Moloney murine leukemia virus buffer (Thermo Fisher Scientific), 10 mm deoxynucleotide triphosphates (Thermo Fisher Scientific), RNasin (Promega), Moloney murine leukemia virus reverse transcriptase (Thermo Fisher Scientific), and incubation at 42 °C for 1 h. Reverse transcription reactions were heated at 90 °C for 10 min followed by incubation at 4 °C for 2 min before usage, or reactions were kept at 4 °C for prolonged cDNA storage. decorin PCRs contained cDNA, 10 mm deoxynucleotide triphosphates (Thermo Fisher Scientific), Taq polymerase (Fisher), 10 pmol/μl zebrafish decorin forward primer GCTTTTGCTGATCTGAAGAGGGTCT, and 10 pmol/μl zebrafish decorin reverse primer CTGCGGTCACTTTGGTGATCTTGTT (Operon). PCRs were analyzed on 2.5-4% agarose gel electrophoresis. Zebrafish decorin Riboprobe Generation and Whole Mount in Situ Hybridization—For decorin riboprobe generation, zebrafish decorin sense/antisense riboprobes were synthesized by in vitro transcription from the TOPO:zebrafish decorin plasmid with Sp6 (Thermo Fisher Scientific) or T7 (Promega) RNA polymerase and were digoxigenin-labeled via digoxigenin-UTP (Roche Applied Science) incorporation during the in vitro transcription reaction. For ISH, RNA localization/detection with sense/antisense riboprobes was performed on groups of 10-20 embryos essentially as described previously (45.Zoeller J.J. McQuillan A. Whitelock J. Ho S.-Y. Iozzo R.V. J. Cell Biol. 2008; 181: 381-394Crossref PubMed Scopus (92) Google Scholar). All embryos were photographed on an Axioplan2 microscope with an Axiocam camera and Axiovision software version 3.0.6.1. Immunohistochemistry—For frozen sections, decorin ISH, RNA, or protein injected and uninjected embryos were fixed in 4% paraformaldehyde (Thermo Fisher Scientific) in PBS overnight. Embryos were washed in fix buffer (4% sucrose, 0.1 mm CaCl2, 16 mm NaH2PO4, 4 mm Na2HPO4; Fisher) three times for 5 min each. Embryos were immersed in 30% sucrose followed by embedding in OCT (Miles) at -20 °C. Frozen sections were prepared using a Thermo Shandon cryostat. All sections were placed on glass slides and stored at -80 °C. For immunohistochemistry, sections were immersed in ice-cold acetone for 5 min followed by immersion in 5% FBS (Sigma) for 1 h at room temperature. Sections were incubated with primary antibody, rabbit anti-human Decorin (a kind gift from Larry W. Fisher) at a 1:50 dilution in 1% FBS for 2 h at room temperature. Sections were washed in 1% FBS three times for 5 min each, followed by incubation with secondary antibody, goat anti-rabbit rhodamine (Santa Cruz Biotechnology), at a 1:300 dilution in 1% FBS for 2 h at room temperature. Sections were washed in 1% FBS three times for 5 min each. Sections were incubated with 4′,6-diamidino-2-phenylindole (Sigma) for 1 min followed by washing in 1% FBS for 5 min. Decorin-injected zebrafish sections incubated with the secondary antibody alone served as control. All sections were photographed on an Olympus BX 51 with a SPOT camera. Alcian Blue Staining of the Zebrafish Cartilage—Five-day embryos were fixed overnight at 4 °C in 4% paraformaldehyde. Embryos were cleared in PBS containing Tween 20 (0.2%), followed by cartilage staining in 0.1% Alcian blue (Chroma-Gesellschaft) according to the procedure described previously (43.Robu M.E. Larson J.D. Nasevicius A. Beiraghi S. Brenner C. Farber S.A. Ekker S.C. PLoS Genet. 2007; 3: e78Crossref PubMed Scopus (836) Google Scholar) with the following modifications: 4 h of staining in sterilefiltered Alcian blue at 24 °C, followed by dehydration in ethanol series, washing in PBST, and incubation at 37 °C with 0.05% trypsin, 2.21 mm EDTA in Hanks' balanced salt solution (Cell-gro) for 2 h to digest excess tissue for clear visualization. decorin RNA-based Rescue, Overexpression, and Protein Microinjection—The zebrafish decorin coding sequence was subcloned into the SpeI and BglII sites of pT3TS vector for the synthesis of in vitro transcribed mRNA via T3 polymerase (Ambion). For decorin RNA-based rescue experiments, zebrafish decorin RNA was microinjected alone or in combination with Dcn-MOSPLICE at the 1-cell stage. For Decorin protein-based experiments, human Decorin was microinjected into 1-cell stage zebrafish embryos. 0-4 h post-injection, injected and matched uninjected embryos were collected for immunoblot analysis. Total embryo protein lysates were collected by syringe homogenization in RIPA buffer over ice. Extracts were centrifuged at ∼7000 rpm at 4 °C for 10 min to remove insoluble material. Sample supernatants were separated by SDS-PAGE and subjected to immunoblotting with goat anti-human Decorin (Calbiochem) followed by rabbit anti-goat horseradish peroxidase (Calbiochem). Immunoblot densitometry was analyzed via Scion Image 4.0.4 Beta (Scion Corp.). For zebrafish embryo load control, a portion of the gel was stained with the colloidal blue staining kit (Invitrogen, LC6025). Characterization and Analysis of Zebrafish decorin—Our analysis of the zebrafish genome revealed the presence of one single gene encoding decorin (Gene ID: 64698). Analysis of the available data base indicated that the zebrafish decorin gene was physically located on chromosome 4 and maintained conserved synteny with human chromosome 12 and mouse chromosome 10 decorin genes (Fig. 1A). Interestingly, the zebrafish decorin gene clustered in a syntenic manner with related SLRP family members, including epiphycan, keratocan, and lumican. The zebrafish decorin mRNA sequence (∼1.1 kb) is composed of seven exons interspersed by six introns and encodes a protein of ∼373 amino acids (supplemental Fig. S1, A and B), with a predicted molecular mass of ∼38 kDa (mature protein). Comparative analysis of Decorin amino acid sequences from 14 different species highlighted common ancestry and fish species evolutionary relationships compared with mammalian, amphibian, and avian counterparts (Fig. 1B). Amino acid alignment of zebrafish, mouse, and human Decorin indicated that zebrafish Decorin was ∼67% identical and ∼78% homologous to the human counterpart (supplemental Fig. S1A). Zebrafish Decorin maintains classic SLRP architecture characterized by a central region of ten leucine-rich repeats flanked by N- and C-terminal Cys-rich regions. We cloned the entire zebrafish decorin by RT-PCR into pCRII:TOPO and subcloned the coding sequence into pCEP-Pu/HULK for the synthesis and purification of His-tagged recombinant zebrafish Decorin by 293-EBNA or HT1080 cells. Our initial characterization, based solely on amino acid sequence, predicted that zebrafish Decorin was a heparan sulfate (HS) proteoglycan. Interestingly, we found that zebrafish Decorin harbors one N-terminal SGD motif flanked by additional residues, which conform to the predicted HS attachment sites (46.Bishop J.R. Schuksz M. Esko J.D. Nature. 2007; 446: 1030-1037Crossref PubMed Scopus (1281) Google Scholar, 47.Wang H. Julenius K. Hryhorenko J. Hagen F.K. J. Biol. Chem. 2007; 282: 14586-14597Abstract Full Text Full Text PDF PubMed Scopus (12) Google Scholar), and which is strikingly similar to one of the known HS attachment sites found in human perlecan (supplemental Fig. S1C). Human and mouse Decorin harbor one N-terminal SG motif that serves as the attachment site for one chondroitin sulfate GAG chain. Despite the sequence-based prediction, we found that recombinant zebrafish Decorin was sensitive to chondroitinase ABC (cABC) digestion (Fig. 2A) indicating that zebrafish Decorin is a chondroitin sulfate proteoglycan. Further GAG analysis from conditioned media of 293-EBNA or HT1080 clones producing zebrafish Decorin indicated that the GAG chains of zebrafish Decorin were composed of chondroitin sulfate and were sensitive to chondroitinase ABC but not HNO2 (Fig. 2, B and C). Notably, zebrafish Decorin was capable of binding various matrix components and down-regulating EGFR levels, indicating that several biological functions of Decorin are well conserved (supplemental Fig. S2, A and B). Additionally, zebrafish Decorin was capable of inhibiting tumor cell proliferation and increasing tumor cell apoptosis (supplemental Fig. S2, C and D). To examine the spatial and temporal expression pattern of decorin mRNA throughout zebrafish embryonic development, we performed whole mount ISH and reverse transcription-PCR across various stages of zebrafish development (Fig. 3). By ISH, decorin mRNA could not be detected earlier than the 6-somite stage, reflecting the low expression levels as detected by RT-PCR (Fig. 3B, shield stage, 6 hpf). Whole mount ISH using a digoxigenin-labeled decorin antisense riboprobe was capable of localizing decorin mRNA at the 6-somite stage (12 hpf) in regions of the developing head and tail (Fig. 3C). At the 20-somite stage (18 hpf) decorin mRNA was expressed throughout the lateral plate mesoderm (*) all along the trunk of the embryo (Fig. 3D). The expression level in the lateral plate mesoderm was decreased over time, with lower levels detected at the prime-5 stage (1 dpf) and hatching stage (2 dpf) (Fig. 3, E and F, respectively). The mesoderm gives rise to many kinds of tissue, including muscle, blood, cartilage, bone, and connective tissue, suggesting Decorin may contribute to the development of these tissues. The expression of decorin mRNA could also be detected at 1 and 2 dpf throughout the head mesenchyme (black arrow), otic capsule (white arrowhead), heart (black arrowhead), and developing fin (white *) (Fig. 3, E and F). Moreover, the expression pattern in these regions remained the same at 5 dpf (data not shown). By using decorin-specific primers, we were able to detect the predicted 130-bp PCR product in cDNA derived from as early as 0.2 hpf to 4 dpf zebrafish embryos (Fig. 3, G and H). Analysis of decorin expression levels relative to β-actin over time suggested that very low decorin mRNA levels were present in the embryos at cleavage stage (0.2-2 hpf) (Fig. 3, G and H). Our findings indicate that low amounts of maternal decorin mRNA were deposited in the embryos because the onset of zygotic transcription does not initiate until at least 3-3.5 hpf. Low level mRNA was present in the embryos at blastula stage (3 hpf) and gastrula stage (shield stage, 6 hpf; 75% epiboly stage, 8 hpf). Higher levels of decorin mRNA could be detected at the 6-somite stage (12 hpf) (Fig. 3, G and H). The levels of decorin mRNA were higher at the 20-somite stage (18 hpf), prime-5 stage (1 dpf), prime-25 stage (36 hpf), and hatching stage (2 dpf), respectively (Fig. 3H). We found the levels of decorin mRNA to remain constant from 2 to 4 dpf (Fig. 3H). These results correspond to the decorin expression data available on the zebrafish developmental profile web resource (supplement
Referência(s)