In the First Extracellular Domain of E-cadherin, Heterophilic Interactions, but Not the Conserved His-Ala-Val Motif, Are Required for Adhesion
2002; Elsevier BV; Volume: 277; Issue: 42 Linguagem: Inglês
10.1074/jbc.m201256200
ISSN1083-351X
AutoresMargaret Renaud-Young, Warren J. Gallin,
Tópico(s)RNA Research and Splicing
ResumoThe classical cadherins, definitive proteins of the cadherin superfamily, are characterized functionally by their ability to mediate calcium-dependent cell aggregationin vitro. To test hypothetical mechanisms of adhesion, we have constructed two mutants of the chicken E-cadherin protein, one with the highly conserved His-Ala-Val (HAV) sequence motif reversed to Val-Ala-His (VAH), the other lacking the first extracellular domain (EC1). The inversion of HAV to VAH has no effect on the capacity of E-cadherin to mediate adhesion. Deletion of EC1 completely eliminates the ability of E-cadherin to mediate homophilic adhesion, but the deletion mutant is capable of adhering heterophilically to both unmutated E-cadherin and to the HAV/VAH mutant. These results demonstrate that the conserved HAV sequence motif is not involved in cadherin-mediated adhesion as has been suggested previously and supports the idea that in the context of the cell surface, cadherin-mediated cell-cell adhesion involves an interaction of EC1 with other domains of the cadherin extracellular moiety and not the “linear zipper” model, which posits trans interactions only between EC1 on apposing cell surfaces. The classical cadherins, definitive proteins of the cadherin superfamily, are characterized functionally by their ability to mediate calcium-dependent cell aggregationin vitro. To test hypothetical mechanisms of adhesion, we have constructed two mutants of the chicken E-cadherin protein, one with the highly conserved His-Ala-Val (HAV) sequence motif reversed to Val-Ala-His (VAH), the other lacking the first extracellular domain (EC1). The inversion of HAV to VAH has no effect on the capacity of E-cadherin to mediate adhesion. Deletion of EC1 completely eliminates the ability of E-cadherin to mediate homophilic adhesion, but the deletion mutant is capable of adhering heterophilically to both unmutated E-cadherin and to the HAV/VAH mutant. These results demonstrate that the conserved HAV sequence motif is not involved in cadherin-mediated adhesion as has been suggested previously and supports the idea that in the context of the cell surface, cadherin-mediated cell-cell adhesion involves an interaction of EC1 with other domains of the cadherin extracellular moiety and not the “linear zipper” model, which posits trans interactions only between EC1 on apposing cell surfaces. extracellular domain(s) cytomegalovirus mutant with inversion of His-Ala-Val to Val-Ala-His mutant with first extracellular domain deleted Tris-buffered saline Classical cadherins were defined initially by their ability to mediate calcium-dependent cell-cell adhesion (1Hyafil F. Babinet C. Jacob F. Cell. 1981; 26: 447-454Abstract Full Text PDF PubMed Scopus (225) Google Scholar, 2Hyafil F. Morello D. Babinet C. Jacob F. Cell. 1980; 21: 927-934Abstract Full Text PDF PubMed Scopus (283) Google Scholar, 3Gallin W.J. Edelman G.M. Cunningham B.A. Proc. Natl. Acad. Sci. U. S. A. 1983; 80: 1038-1042Crossref PubMed Scopus (183) Google Scholar, 4Ogou S.-I. Yoshida-Noro C. Takeichi M. J. Cell Biol. 1983; 97: 944-948Crossref PubMed Scopus (75) Google Scholar, 5Ogou S.-I. Okada T.S. Takeichi M. Dev. Biol. 1982; 92: 521-528Crossref PubMed Scopus (47) Google Scholar). Both the extracellular and the intracellular portions of the cadherin play critical roles in mediating adhesion (6Nagafuchi A. Takeichi M. EMBO J. 1988; 7: 3679-3684Crossref PubMed Scopus (664) Google Scholar). Perturbation and expression experiments have demonstrated that cadherin-mediated adhesion promotes a range of cellular processes subsequent to adhesion, including epithelial polarization (7Gumbiner B. Simons K. J. Cell Biol. 1986; 102: 457-468Crossref PubMed Scopus (381) Google Scholar, 8Nelson W.J. Shore E.M. Wang A.Z. Hammerton R.W. J. Cell Biol. 1990; 110: 349-357Crossref PubMed Scopus (244) Google Scholar), blastula compaction (2Hyafil F. Morello D. Babinet C. Jacob F. Cell. 1980; 21: 927-934Abstract Full Text PDF PubMed Scopus (283) Google Scholar), neurite outgrowth (9Drazba J. Lemmon V. Dev. Biol. 1990; 138: 82-93Crossref PubMed Scopus (150) Google Scholar, 10Tomaselli K.J. Neugebauer K.M. Bixby J.L. Lilien J. Reichardt L.F. Neuron. 1988; 1: 33-43Abstract Full Text PDF PubMed Scopus (314) Google Scholar), and formation of desmosomes (11Li Z. Gallin W. Pasdar G. J. Cell Sci. 1998; 111: 1005-1019PubMed Google Scholar, 12Marrs J.A. Andersson-Fisone C. Jeong M.C. Cohen-Gould L. Zurzolo C. Nabi I.R. Rodriguez-Boulan E. Nelson W.J. J. Cell Biol. 1995; 129: 507-519Crossref PubMed Scopus (128) Google Scholar) and gap junctions (13Mege R.M. Matsuzaki F. Gallin W.J. Goldberg J.I. Cunningham B.A. Edelman G.M. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 7274-7278Crossref PubMed Scopus (245) Google Scholar, 14Musil L.S. Cunningham B.A. Edelman G.M. Goodenough D.A. J. Cell Biol. 1990; 111: 2077-2088Crossref PubMed Scopus (593) Google Scholar, 15Musil L.S. Goodenough D.A. J. Cell Biol. 1991; 115: 1357-1374Crossref PubMed Scopus (617) Google Scholar, 16Matsuzaki F. Mege R.M. Jaffe S.H. Friedlander D.R. Gallin W.J. Goldberg J.I. Cunningham B.A. Edelman G.M. J. Cell Biol. 1990; 110: 1239-1252Crossref PubMed Scopus (122) Google Scholar). Classical cadherin proteins at the cell surface consist of five extracellular domains (ECs),1a transmembrane sequence, and a cytoplasmic domain (Fig. 1). Each cadherin extracellular domain shares a folding topology of seven β-strands arranged in two β-sheets forming a barrel with hydrophobic amino acid side chains largely sequestered within the interior (17Overduin M. Harvey T.S. Bagby S. Tong K.I. Yau P. Takeichi M. Ikura M. Science. 1995; 267: 386-389Crossref PubMed Scopus (372) Google Scholar, 18Shapiro L. Fannon A.M. Kwong P.D. Thompson A. Lehmann M.S. Grubel G. Legrand J.F. Als-Nielsen J. Colman D.R. Hendrickson W.A. Nature. 1995; 374: 327-337Crossref PubMed Scopus (978) Google Scholar, 19Nagar B. Overduin M. Ikura M. Rini J.M. Nature. 1996; 380: 360-364Crossref PubMed Scopus (565) Google Scholar, 20Boggon T.J. Murray J. Chappuis-Flament S. Wong E. Gumbiner B.M. Shapiro L. Science. 2002; 296: 1308-1313Crossref PubMed Scopus (548) Google Scholar). The amino and carboxyl termini emerge from opposite ends of each folded domain, maintaining an orientation with the amino terminus directed away from the cell. Conserved amino acid residues that are capable of coordinating calcium ions are present at the ends of each barrel (17Overduin M. Harvey T.S. Bagby S. Tong K.I. Yau P. Takeichi M. Ikura M. Science. 1995; 267: 386-389Crossref PubMed Scopus (372) Google Scholar, 18Shapiro L. Fannon A.M. Kwong P.D. Thompson A. Lehmann M.S. Grubel G. Legrand J.F. Als-Nielsen J. Colman D.R. Hendrickson W.A. Nature. 1995; 374: 327-337Crossref PubMed Scopus (978) Google Scholar, 19Nagar B. Overduin M. Ikura M. Rini J.M. Nature. 1996; 380: 360-364Crossref PubMed Scopus (565) Google Scholar, 20Boggon T.J. Murray J. Chappuis-Flament S. Wong E. Gumbiner B.M. Shapiro L. Science. 2002; 296: 1308-1313Crossref PubMed Scopus (548) Google Scholar). Binding of calcium at these sites maintains the structural integrity of the cadherin ECs, giving the protein a rigid conformation that allows it to mediate cell-cell adhesion. A single amino acid substitution in a calcium binding site between EC1 and EC2 or between EC2 and EC3 can abolish adhesion and increase motility, whereas mutations in other calcium-binding elements do not affect these behaviors (21Ozawa M. Engel J. Kemler R. Cell. 1990; 63: 1033-1038Abstract Full Text PDF PubMed Scopus (238) Google Scholar, 22Handschuh G. Luber B. Hutzler P. Hofler H. Becker K.F. J. Mol. Biol. 2001; 314: 445-454Crossref PubMed Scopus (34) Google Scholar). Cadherins expressed on adjacent cells homoassociate through an antiparallel, trans, interaction of their extracellular regions. The bonds that they form across the intercellular space hold the plasma membranes of adjacent cells in close proximity. Adhesive strength is also dependent on a cis interaction between cadherins of the same cell (23Brieher W.M. Yap A.S. Gumbiner B.M. J. Cell Biol. 1996; 135: 487-496Crossref PubMed Scopus (264) Google Scholar) mediated at least in part by the transmembrane domain (24Huber O. Kemler R. Langosch D. J. Cell Sci. 1999; 112: 4415-4423Crossref PubMed Google Scholar). These stable interactions can be rapidly disassembled or reorganized in response to extracellular signals such as growth factors (25Weidner K.M. Behrens J. Vandekerckhove J. Birchmeier W. J. Cell Biol. 1990; 111: 2097-2108Crossref PubMed Scopus (580) Google Scholar) and can occur without extreme alterations in the makeup of the adhesive complex or the amount of complex at the junction (26Gumbiner B.M. J. Cell Biol. 2000; 148: 399-404Crossref PubMed Scopus (690) Google Scholar). The mechanism by which the extracellular domains mediate adhesion is poorly understood. The amino acid residues responsible for thetrans interaction are currently unknown, although there is solid evidence that the first domain (EC1) is important in forming specific cadherin interactions (27Nose A. Tsuji K. Takeichi M. Cell. 1990; 61: 147-155Abstract Full Text PDF PubMed Scopus (414) Google Scholar, 28Kitagawa M. Natori M. Murase S. Hirano S. Taketani S. Suzuki S.T. Biochem. Biophys. Res. Commun. 2000; 271: 358-363Crossref PubMed Scopus (45) Google Scholar). Several different crystal structures have yielded different interaction interfaces (18Shapiro L. Fannon A.M. Kwong P.D. Thompson A. Lehmann M.S. Grubel G. Legrand J.F. Als-Nielsen J. Colman D.R. Hendrickson W.A. Nature. 1995; 374: 327-337Crossref PubMed Scopus (978) Google Scholar, 19Nagar B. Overduin M. Ikura M. Rini J.M. Nature. 1996; 380: 360-364Crossref PubMed Scopus (565) Google Scholar, 20Boggon T.J. Murray J. Chappuis-Flament S. Wong E. Gumbiner B.M. Shapiro L. Science. 2002; 296: 1308-1313Crossref PubMed Scopus (548) Google Scholar, 29Tamura K. Shan W.S. Hendrickson W.A. Colman D.R. Shapiro L. Neuron. 1998; 20: 1153-1163Abstract Full Text Full Text PDF PubMed Scopus (278) Google Scholar), and an NMR solution structure of EC1 indicates that it does not dimerize in solution (17Overduin M. Harvey T.S. Bagby S. Tong K.I. Yau P. Takeichi M. Ikura M. Science. 1995; 267: 386-389Crossref PubMed Scopus (372) Google Scholar). It has also been suggested that the highly conserved His-Ala-Val motif (HAV) of the first domain is important for binding (30Blaschuk O.W. Sullivan R. David S. Pouliot Y. Dev. Biol. 1990; 139: 227-229Crossref PubMed Scopus (335) Google Scholar, 31Blaschuk O.W. Pouliot Y. Holland P.C. J. Mol. Biol. 1990; 211: 679-682Crossref PubMed Scopus (53) Google Scholar). E-cadherin peptides containing the HAV sequence have been shown to induce epithelial cell invasion, implying that the adhesive region flanks the HAV sequence (32Noe V. Willems J. Vandekerckhove J. Roy F.V. Bruyneel E. Mareel M. J. Cell Sci. 1999; 112: 127-135Crossref PubMed Google Scholar). However, there is doubt that this motif is crucial because many nonclassical cadherins, and some classical ones, do not have HAV but are still capable oftrans adhesion (33Tanihara H. Sano K. Heimark R.L., St. John T. Suzuki S. Cell Adhes. Commun. 1994; 2: 15-26Crossref PubMed Scopus (138) Google Scholar, 34Babb S.G. Barnett J. Doedens A.L. Cobb N. Liu Q. Sorkin B.C. Yelick P.C. Raymond P.A. Marrs J.A. Dev. Dyn. 2001; 221: 231-237Crossref PubMed Scopus (43) Google Scholar). To characterize the role of the HAV motif and of the whole EC1 in adhesion we evaluated the capability of two mutant forms of E-cadherin to mediate adhesion in a set of well defined cell-cell aggregation assays. One mutant has had the conserved HAV motif reversed to VAH, and the other mutant has the entire EC1 domain deleted. The results of these experiments, taken in conjunction with recent reports on human cadherin 4 (R-cadherin) (28Kitagawa M. Natori M. Murase S. Hirano S. Taketani S. Suzuki S.T. Biochem. Biophys. Res. Commun. 2000; 271: 358-363Crossref PubMed Scopus (45) Google Scholar) and Xenopus laevis C-cadherin (35Chappuis-Flament S. Wong E. Hicks L.D. Kay C.M. Gumbiner B.M. J. Cell Biol. 2001; 154: 231-243Crossref PubMed Scopus (188) Google Scholar), demonstrate that the HAV sequence is not essential for adhesion and that EC1 interacts in trans with EC domains other than EC1 to mediate cell-cell adhesion, consistent with data obtained by atomic force measurements (36Sivasankar S. Brieher W. Lavrik N. Gumbiner B. Leckband D. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 11820-11824Crossref PubMed Scopus (145) Google Scholar, 37Leckband D. Sivasankar S. Curr. Opin. Cell Biol. 2000; 12: 587-592Crossref PubMed Scopus (73) Google Scholar, 38Sivasankar S. Gumbiner B. Leckband D. Biophys. J. 2001; 80: 1758-1768Abstract Full Text Full Text PDF PubMed Scopus (107) Google Scholar) and contrary to the linear zipper model, which is based on the interfaces predicted from crystal structures (18Shapiro L. Fannon A.M. Kwong P.D. Thompson A. Lehmann M.S. Grubel G. Legrand J.F. Als-Nielsen J. Colman D.R. Hendrickson W.A. Nature. 1995; 374: 327-337Crossref PubMed Scopus (978) Google Scholar, 20Boggon T.J. Murray J. Chappuis-Flament S. Wong E. Gumbiner B.M. Shapiro L. Science. 2002; 296: 1308-1313Crossref PubMed Scopus (548) Google Scholar) (Fig. 1 A). The S180 cell line was originally derived from the axial tip of a transplanted mouse sarcoma (39Dunham L.J. Stewart H.L. J. Natl. Cancer Inst. 1953; 13: 1299-1377PubMed Google Scholar). S180 cells are spindle-shaped, do not undergo calcium-dependent cell-cell adhesion, and do not express any known cadherin proteins, making them ideal for observing the effects of cadherin transfection. S180 cells and all transfectants were grown in Dulbecco's modified Eagle's medium with 15% fetal calf serum in a 10% CO2incubator at 37 °C. For passaging, cells were released from the plate by incubation with PBS (150 mm NaCl, 2 mmNaH2PO4, 10 mmNa2HPO4, pH 7.4) and 5 mm EDTA at 37 °C for ∼15–25 min, which released them from the plates as single cells, counted using a Coulter counter, and replated in culture medium at desired cell densities, usually 105 cells/10-cm culture dish in 10 ml of medium. The 5′-end of the E-cadherin reading frame was amplified from chicken liver cDNA using primers WJG1003 and WJG1004 (TableI) and digested with NheI andXhoI. An XhoI/BamHI fragment containing the majority of the E-cadherin coding region was isolated from plasmid pEC320 (40Gallin W.J. Sorkin B.C. Edelman G.M. Cunningham B.A. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 2808-2812Crossref PubMed Scopus (104) Google Scholar). pBK-CMV expression vector (Stratagene) was modified by digestion with EcoRI and KpnI followed by polishing with mung bean nuclease and ligation to remove part of the polylinker. The resulting vector (pBK-CMV ·E/K) was digested with NheI and BamHI, and a three-fragment ligation was performed. The entire insert of the resulting plasmid was sequenced completely to confirm that the plasmid had the correct sequence. A schematic drawing of the mature protein encoded by this plasmid is shown in Fig. 1 B.Table IOligonucleotides used in constructing the mutant expression plasmidsPrimer nameSequenceWJG1003GGGCTAGCGGCCCGGTCCCTGAGCCWJG1004TTGTTGGATTTGATCTGCACCWJG1034CAGCTTCACCATCTACGCWJG1045GTGGGCCACGGATAAGAGGGTGTAGCGAWJG1042CCTTGAAGGGGTAGGTATGTGWJG1058CTCTTATCCGTGGCCCACTCGGCCAGCGGGCAWJG1046TGAACACGGGCCTCTTCTGCCTCGGGAGWJG1047GCAGAAGAGGCCCGTGTTCATCAAGGAGGWJG1035GACCAGAACGACAACAAGCWJG1040GGTCAATGGTGAACATCTGG Open table in a new tab The HAV/VAH mutant was created by overlapping PCR mutagenesis (41Stappert J. Kemler R. Stevenson B.R. Gallin W.J. Paul D.L. Cell-Cell Interactions: A Practical Approach. IRL Press, Oxford1992: 75-89Google Scholar). Two fragments were amplified from unmutated plasmid template using primers WJG1034 and WJG1045, and primers WJG1058 and WJG1042 (Table I). The resulting PCR products were gel purified, and a mixture was used as a template, amplified with primers WJG1034 and WJG1042. The resulting PCR product was digested with XhoI and KpnI, ligated into the wild-type plasmid that had also been digested with XhoI andKpnI, and a cloned plasmid was isolated. The sequence of the resulting insert was determined to confirm that only the designed mutation, inversion of the HAV sequence to VAH, had been introduced into the E-cadherin sequence. A schematic drawing of the mature protein encoded by this plasmid is shown in Fig. 1 B. The ΔI mutation was created by overlapping PCR mutagenesis (41Stappert J. Kemler R. Stevenson B.R. Gallin W.J. Paul D.L. Cell-Cell Interactions: A Practical Approach. IRL Press, Oxford1992: 75-89Google Scholar). As described for the ΔI mutant, using primers WJG1034 and WJG1046 and primers WJG1047 and WJG1042. There were two undesigned mutations found, one converting an arginine to a proline in the propeptide sequence and the other converting valine to isoleucine in the second extracellular domain. A schematic drawing of the mature protein encoded by this plasmid is shown in Fig. 1 B. S180 cells were transfected with plasmids using an optimized calcium coprecipitation method (42Xia Z. Dudek H. Miranti C.K. Greenberg M.E. J. Neurosci. 1996; 16: 5425-5436Crossref PubMed Google Scholar) and selected in medium supplemented with 400 μg/ml Geneticin (G418, Invitrogen). Two weeks after transfection, cells were selected for their abilities to express high levels of E-cadherin using magnetic activated cell sorting (Miltenyi Biotec). Cells were released from the culture plate and incubated with rabbit anti-E-cadherin antibody (40 μg/ml) in PBS, 2 mm EDTA, 0.5% (w/v) bovine serum albumin, then with magnetic beads coupled to goat anti-rabbit antibody (20 μl of bead suspension/107 cells). Cells expressing E-cadherin were retained on a high gradient magnetic separation column and then rinsed from the column upon removal of the magnetic field. Clones were isolated from the separated cells by limiting dilution. Expression of E-cadherin was confirmed by immunofluorescent staining with a polyclonal rabbit anti-E-cadherin antibody. Only a single clone from each primary transfection plate was saved, ensuring that the clones are independently derived. Cultures of stable transfectants were maintained in 200 μg/ml G418 in Dulbecco's modified Eagle's medium and 15% (v/v) fetal calf serum. Genomic DNA was isolated from confluent 10-cm dishes of S180, S180L-11, HAV/VAH-1, HAV/VAH-2, HAV/VAH-4, ΔI-1, and ΔI-2 cells. DNA was isolated from the cells (43Strauss W.M. Ausubel F.M. Brent R. Kingston R.E. Moore D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. 1. John Wiley & Sons, Inc., New York1998: 2.2.1-2.2.3Google Scholar), and E-cadherin sequences were amplified from the DNA of each cell line by PCR, using primers WJG1034 and WJG1042. PCR products were purified and sequenced. Two unplanned mutations are present in the sequence of the ΔI construct. In the precursor sequence a Pro was substituted for an Arg residue. This may have an effect on processing of the protein and transport to the membrane. However, the mutant E-cadherin is expressed at the cell surface (Fig. 1 E) and is largely correctly processed by cleavage of the precursor peptide (Fig.2 A). The second mutation is the 44th amino acid in the second domain in which Ile is substituted for Val. This mutation is unlikely to be significant because the residue that was replaced has properties similar to the one that was replaced (a large, branched, nonpolar side chain). The side chain faces outward from the domain, not into the hydrophobic interior of the globular domain, so there is no effect on side chain packing in the interior of the domain, and the mutated residue is at a site that is highly variable in other domains and other cadherins (alignment not shown) and which does not correlate with adhesive specificity or subfamily identity. Polyclonal goat antibody was raised against the trypsin-released extracellular fragment of chicken E-cadherin. Polyclonal rabbit antibody was raised against a fusion protein encompassing most of the E-cadherin extracellular region. Fab′ fragments were prepared by overnight digestion of the whole IgG with pepsin followed by treatment with β-mercaptoethanol and iodoacetamide (44Acheson A. Gallin W.J. Stevenson B.R. Gallin W.J. Paul D.L. Cell-Cell Interactions: A Practical Approach. IRL Press, Oxford1992: 31-54Google Scholar). Cells were grown on glass coverslips. Confluent and subconfluent cultures were fixed with 4% paraformaldehyde in PBS, 0.5 mm CaCl2, 0.5 mm MgCl2, at room temperature for 15–30 min and quenched with 0.1 m glycine in PBS. Cells were permeabilized and further blocked in Tris/PO4/carrageenan/Triton X-100 (41 mm Tris, 4.4 mm Na2HPO4, 1.8 mmNaH2PO4, 120 mm NaCl, 0.5% (w/v) Triton X-100, 0.7% (w/v) Lambda Carrageenan, 30 mmNaN3) (45Sofroniew M.V. Schrell U. J. Histochem. Cytochem. 1982; 30: 504-511Crossref PubMed Scopus (84) Google Scholar), followed by incubation overnight with 4 μg/ml rabbit anti-E-cadherin IgG or 30 μg/ml goat anti-E-cadherin IgG in Tris/PO4/carrageenan/Triton X-100 solution, five 10-min washes with Tris/PO4, a 1-h incubation with fluorescein isothiocyanate-conjugated or Texas Red-conjugated second antibodies, and five 10-min washes with Tris/PO4. Coverslips were mounted on slides with MOWIOL/DABCO (46Osborn M. Weber K. Methods Cell Biol. 1982; 24: 97-132Crossref PubMed Scopus (339) Google Scholar) and examined by epifluorescence microscopy and confocal microscopy. Confluent cultures were rinsed with 10 ml of TBS, 1 mm phenylmethylsulfonyl fluoride and extracted with 1 ml of 1% SDS, 1 mm phenylmethylsulfonyl fluoride, 62.5 mm Tris-HCl, pH 6.8; the extracts were scraped into 5-ml polypropylene tubes and homogenized with a Polytron homogenizer (Brinkmann Instruments) to disperse the cells completely and shear the DNA. Extracts were then stored as frozen aliquots, and the protein concentration of the extracts was determined using the BCA method (Pierce). Aliquots of the extracts were mixed 1:1 with 2× sample buffer (4% (w/v) SDS, 20% (w/v) glycerol, 10% β-mercaptoethanol, 0.0002% (w/v) bromphenol blue, 125 mm Tris-HCl, pH 6.8), heated in a boiling water bath for 5 min, and clarified by centrifugation for 10 min at maximum speed in a microcentrifuge. 20 μl of each of the samples was resolved on a 6% polyacrylamide gel (47Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207537) Google Scholar). Proteins were transferred electrophoretically to nitrocellulose, blocked with 3% (w/v) crude ovalbumin, 0.1% Triton X-100 in TBS, and incubated with the rabbit anti-E-cadherin (IgG final concentration, 10 μg/ml) and mouse monoclonal anti-β-tubulin ascites (Amersham Biosciences) diluted 1:5,000 in 3% (w/v) ovalbumin, 0.1% Tween 20, TBS overnight and washed five times with TTBS (50 mm Tris-HCl, 150 mm NaCl, 0.1% Tween 20, pH 8.0). The blot was then incubated with IR800 dye-labeled goat anti-rabbit IgG and IR700 dye-labeled goat anti-mouse IgG (LiCor) in 3% (w/v) ovalbumin, 0.1% Tween 20, TBS for 3 h, washed five times, and visualized using an Odyssey scanner (LiCor). The intensity of each band was determined by integrating pixel intensity over the full band with subtraction of background based on median pixel intensity along the band boundary. E-cadherin expression was normalized to the intensity of the β-tubulin band for each sample, and the level of E-cadherin expression was determined relative to the expression level of the S180L-11 sample. Confluent cultures were rinsed once with PBS, 0.5 mmMgCl2, 0.5 mm CaCl2 and then incubated with 2 ml of 0.5 mg/ml EZ-link biotinylation reagent (Pierce) in PBS, 0.5 mm MgCl2, 0.5 mmCaCl2 at 37 °C for 30 min. The culture was then rinsed once with TBS, 1 mm phenylmethylsulfonyl fluoride and extracted with 1 ml of 1% SDS, 1 mm phenylmethylsulfonyl fluoride, 62.5 mm Tris-HCl, pH 6.8, and the resulting extract was stored frozen at −20 °C. 200 μl of the SDS extract was mixed with 1 ml of HS buffer (0.1% SDS, 1% sodium deoxycholate, 0.5% Triton X-100, 20 mm Tris-HCl, pH 7.5, 120 mm NaCl, 25 mm KCl, 10 mm EDTA) and clarified by centrifugation for 30 min at maximum speed in a microcentrifuge. The clarified supernatant was transferred to a fresh microcentrifuge tube with 50 μl of 1:1 slurry of avidin-coupled agarose beads (Pierce). The samples were mixed by gentle rocking at 4 °C for 2 h, and then the beads were pelleted and washed once with HS buffer, once with high salt buffer (HS buffer with 1m NaCl), and once with low salt buffer (2 mmEDTA, 10 mm Tris-HCl, pH 7.5). The beads were then resuspended in 25 μl of 2× Laemmli SDS sample buffer, 100 mm dithiothreitol, heated in a boiling water bath for 5 min, and 20 μl of the resulting extract was resolved on a 6% Laemmli SDS gel and visualized by Western blotting. Aggregation assays were performed according to Hoffman (48Hoffman S. Stevenson B.R. Gallin W.J. Paul D.L. Cell-Cell Interactions: A Practical Approach. IRL Press, Oxford1992: 1-30Google Scholar). Cells were released from dishes with PBS, 5 mm EDTA, 2% (v/v) fetal calf serum and incubated on ice in Eagle's Spinner medium (Invitrogen) for 1 h to allow full dissociation. Aliquots of 2 × 106 cells were incubated with anti-E-cadherin or nonimmune Fab′ fragments (300 μg of Fab′ fragments/2 × 106 cells) in HDF buffer (137 mm NaCl, 5 mm KCl, 5.5 mm glucose, 4 mm NaHCO3, 2 mm EDTA, pH 7.5) for a minimum of 30 min on ice. The assay was initiated by suspending the cells to a final volume of 2 ml in prewarmed Eagle's medium, transferring them to glass scintillation vials, and shaking at ∼80 rpm at 37 °C. At 0, 20, 40, and 60 min after the start of incubation, aliquots of cell suspension were fixed with 1% glutaraldehyde in PBS, pH 7.5. Aliquots of the cell suspension were counted by diluting 1:20 into Isoton II (Beckman/Coulter Electronics) and counting particles within the range of single suspended S180 cell sizes (10–20 μm) with a Z2 Coulter counter. Percentage aggregation for each vial was calculated by the formula 100 × ((N 0 −Nt)/N 0), whereN 0 equals number of particles at time 0, andNt is the number of particles at the time the cells were sampled. Each point on each graph represents the average of three separate vials, treated with the same Fab′. Each assay was performed at least three times. Coaggregation was performed, with slight modifications, according to Friedlander et al. (49Friedlander D.R. Mege R.-M. Cunningham B.A. Edelman G.M. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 7043-7047Crossref PubMed Scopus (196) Google Scholar). Cells were loaded with a 3 mg/ml solution of either Texas Red-labeled fixable dextran or fluorescein isothiocyanate-labeled fixable dextran using the Influx method (Molecular Probes). Cells were then maintained in normal medium until harvesting for the experiment (usually ∼8 h). Labeled cells were released from the culture dish with PBS and 5 mm EDTA. After counting, cells were diluted to 105 cells/50 μl in HDF with appropriate Fab′ fragments (20 μg/105 cells). The assay was initiated by combining both cell types in a final volume of 700 μl with minimum Eagle's medium and incubating in 24-well plates coated with PolyHEMA on a rotary shaker at ∼80 rpm. Cells were fixed after the 60-min incubation period by addition of the aliquots to 4% (w/v) paraformaldehyde PBS, pH 7.5. To calculate overall levels of aggregation, aliquots were taken from each well at times 0 and 60 min and evaluated using a Coulter counter, as above. Preliminary experiments indicated that if the level of aggregation was low (less than 20%), then there were essentially no visible aggregates to score. Also, if S180 aggregation was high, it was attributable to excess cellular debris aggregating cells in a cadherin-independent manner. When the negative control was contaminated in this way, the experiment was abandoned because any of the other wells could be contaminated in the same way. The number of Texas Red-labeled cells in each cluster was counted and expressed as a percentage of the total number of cells in that cluster. Comparisons of percentages of the three replicate wells were performed using single factor analysis of variance. Data from 20 coaggregates from three replicate wells were pooled and graphed on a histogram with bin sizes of 10%. Selected clusters were also photographed using confocal microscopy. S180 cells were transfected with the plasmids encoding wild-type E-cadherin (S180L), the mutant with the His-Ala-Val sequence inverted to Val-Ala-His (HAV/VAH), and the mutant with deletion of EC1 (ΔI). Three clonal cultures of unmutated E-cadherin transfectants, three clonal cultures of HAV/VAH transfectants, and two clonal cultures of ΔI transfectants were isolated for study. PCR of genomic DNA from each line yielded the expected PCR product. The identity of the transfected construct was confirmed by direct sequencing of the PCR products (data not shown). S180 cells at low density appear spindle-shaped, usually with filopodia spreading on substrate. When the culture reaches confluence, the cells become packed together, forming more than one layer of cells. S180 cells transfected with E-cadherin (S180L) retain the tendency to form multiple layers, but the layers tend to be sheets of cells that are connected through cadherin-mediated adhesion. Immunofluorescence reveals that wild-type E-cadherin localizes to the plasma membrane at sites of cell-cell interaction (Fig. 1 C). Contact regions are somewhat flattened with distinctive spikes of concentrated staining that indicate deep intercalation of the apposing adhesive membranes, as described previously for another S180 E-cadherin-transfected cell line (13Mege R.M. Matsuzaki F. Gallin W.J. Goldberg J.I. Cunningham B.A. Edelman G.M. Proc. Natl. Acad. Sci. U. S.
Referência(s)