Portal de Periódicos da CAPES

Identification of GAS1 as an Epirubicin Resistance-related Gene in Human Gastric Cancer Cells with a Partially Randomized Small Interfering RNA Library

2009; Elsevier BV; Volume: 284; Issue: 39 Linguagem: Inglês

10.1074/jbc.m109.028068

1083-351X

Lina Zhao, Yanglin Pan, Gang Yi, Honghong Wang, Haifeng Jin, Jun Tie, Lin Xia, Yongguo Zhang, Lijie He, Liping Yao, Taidong Qiao, Tingting Li, Zhiguo Liu, Daiming Fan,

Chromosomal and Genetic Variations

Epirubicin has been widely used for chemotherapeutic treatment of gastric cancer; however, intrinsic and acquired chemoresistance remains an obstacle to successful management. The mechanisms underlying epirubicin resistance are still not well defined. Here we report the construction and application of a partially randomized retrovirus library of 4 × 106 small interfering RNAs to identify novel genes whose suppression confers epirubicin resistance in gastric cancer cells SGC7901. From 12 resistant cell colonies, two small interfering RNAs targeting GAS1 (growth arrest-specific 1) and PTEN (phosphatase and tensin homolog), respectively, were identified and validated. We identified a previously unrecognized chemoresistance role for GAS1. GAS1 suppression resulted in significant epirubicin resistance and cross-resistance to 5-fluorouracil and cisplatin in various gastric cancer cell lines. GAS1 suppression promoted multidrug resistance through apoptosis inhibition, partially by up-regulating the Bcl-2/Bax ratio that was abolished by Bcl-2 inhibition. GAS1 suppression induced chemoresistance partially by increasing drug efflux in an ATP-binding cassette transporter and drug-dependent manner. P-glycoprotein (P-gp) and BCRP (breast cancer resistance protein) but not MRP-1 were up-regulated, and targeted knockdown of P-gp and BCRP could partially reverse GAS1 suppression-induced epirubicin resistance. Verapamil, a P-gp inhibitor, could reverse P-gp substrate (epirubicin) but not non-P-gp substrate (5-fluorouracil and cisplatin) resistance in GAS1-suppressed gastric cancer cells. BCRP down-regulation could partially reverse 5-fluorouracil but not cisplatin resistance induced by GAS1 suppression, suggesting 5-fluorouracil but not cisplatin was a BCRP substrate. These results suggest that GAS1 might be a target to overcome multidrug resistance and provide a novel approach to identifying candidate genes that suppress chemoresistance of gastric cancers. Epirubicin has been widely used for chemotherapeutic treatment of gastric cancer; however, intrinsic and acquired chemoresistance remains an obstacle to successful management. The mechanisms underlying epirubicin resistance are still not well defined. Here we report the construction and application of a partially randomized retrovirus library of 4 × 106 small interfering RNAs to identify novel genes whose suppression confers epirubicin resistance in gastric cancer cells SGC7901. From 12 resistant cell colonies, two small interfering RNAs targeting GAS1 (growth arrest-specific 1) and PTEN (phosphatase and tensin homolog), respectively, were identified and validated. We identified a previously unrecognized chemoresistance role for GAS1. GAS1 suppression resulted in significant epirubicin resistance and cross-resistance to 5-fluorouracil and cisplatin in various gastric cancer cell lines. GAS1 suppression promoted multidrug resistance through apoptosis inhibition, partially by up-regulating the Bcl-2/Bax ratio that was abolished by Bcl-2 inhibition. GAS1 suppression induced chemoresistance partially by increasing drug efflux in an ATP-binding cassette transporter and drug-dependent manner. P-glycoprotein (P-gp) and BCRP (breast cancer resistance protein) but not MRP-1 were up-regulated, and targeted knockdown of P-gp and BCRP could partially reverse GAS1 suppression-induced epirubicin resistance. Verapamil, a P-gp inhibitor, could reverse P-gp substrate (epirubicin) but not non-P-gp substrate (5-fluorouracil and cisplatin) resistance in GAS1-suppressed gastric cancer cells. BCRP down-regulation could partially reverse 5-fluorouracil but not cisplatin resistance induced by GAS1 suppression, suggesting 5-fluorouracil but not cisplatin was a BCRP substrate. These results suggest that GAS1 might be a target to overcome multidrug resistance and provide a novel approach to identifying candidate genes that suppress chemoresistance of gastric cancers. Despite a recent decrease, gastric cancer remains the second most frequent cancer in the world and accounts for substantial morbidity and mortality worldwide. The outcome among patients with advanced gastric cancer is poor. Surgery combined with chemotherapy is the current treatment of choice. The combination of epirubicin, cisplatin, and 5-fluorouracil has been considered as one of the current standard chemotherapy regimes for gastric cancer (1Cunningham D. Allum W.H. Stenning S.P. Thompson J.N. Van de Velde C.J. Nicolson M. Scarffe J.H. Lofts F.J. Falk S.J. Iveson T.J. Smith D.B. Langley R.E. Verma M. Weeden S. Chua Y.J. MAGIC, Trial, ParticipantsN. Engl. J. Med. 2006; 355: 11-20Crossref PubMed Scopus (5021) Google Scholar, 2Macdonald J.S. N. Engl. J. Med. 2006; 355: 76-77Crossref PubMed Scopus (75) Google Scholar, 3Zhang C.X. Huang S. Xu N. Fang J.W. Shen P. Bao Y.H. Mou B.H. Shi M.G. Zhong X.L. Xiong P.J. Anticancer Drugs. 2007; 18: 581-586Crossref PubMed Scopus (8) Google Scholar). Accordingly, epirubicin remains to be one of the most widely used first-line chemotherapy agents in gastric cancer, but like many other anticancer drugs, intrinsic and acquired resistance to epirubicin treatment has limited its clinical use. Our previous data showed doxorubicin, a structurally related chemotherapy agent to epirubicin, was ineffective in more than 60% of freshly isolated gastric cancer specimens (4Liu H. Li N. Yao L. Jiang L. Bao G. Li J. Ma Q. Liu Z. Oncol. Rep. 2008; 20: 963-969PubMed Google Scholar). Unlike cisplatin and fluorouracil, whose resistance mechanisms in malignant tumors have been relatively well characterized, the mechanisms of epirubicin resistance remain largely unknown. To date, few molecules have been correlated with the epirubicin resistance of gastric cancer. In previous work, we have identified multiple molecules related to multidrug resistance (MDR) 5The abbreviations used are: MDRmultidrug resistanceRNAiRNA interferencedsRNAdouble stranded RNAsiRNAsmall interfering RNAshRNAshort hairpin RNACDDPcisplatin5-FU5-fluorouracilMTT3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromideRTreverse transcriptionGAPDHglyceraldehyde-3-phosphate dehydrogenaseEPIepirubicinVCRvincristineADRadriamycinABCATP-binding cassetteGFPgreen fluorescent proteinBCRPbreast cancer resistance proteinP-gpP-glycoprotein. through suppression-subtractive hybridization and differential display PCR (5Zhang D. Fan D. Expert Rev. Anticancer Ther. 2007; 7: 1369-1378Crossref PubMed Scopus (119) Google Scholar, 6Zhao Y. You H. Liu F. An H. Shi Y. Yu Q. Fan D. Cancer Lett. 2002; 185: 211-218Crossref PubMed Scopus (118) Google Scholar). However, the mechanism of drug resistance is too complicated to be elucidated only by genotype-based screens because of the fact that numerous unrelated or nonessential molecules may mix with the real key regulators; therefore, phenotype-based genome-wide functional screens might be ideal for functional annotation of both known and novel genes implicated in the drug resistance process (7Silva J. Chang K. Hannon G.J. Rivas F.V. Oncogene. 2004; 23: 8401-8409Crossref PubMed Scopus (100) Google Scholar). multidrug resistance RNA interference double stranded RNA small interfering RNA short hairpin RNA cisplatin 5-fluorouracil 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide reverse transcription glyceraldehyde-3-phosphate dehydrogenase epirubicin vincristine adriamycin ATP-binding cassette green fluorescent protein breast cancer resistance protein P-glycoprotein. Since the discovery that 21–23-bp double-stranded RNAs (dsRNA) could mediate sequence-specific, post-transcriptional gene silencing of a homologous gene, RNA interference (RNAi) has been utilized as a powerful tool for inhibiting the expression of genes of interest (8Singer O. Yanai A. Verma I.M. Proc. Natl. Acad. Sci. U.S.A. 2004; 101: 5313-5314Crossref PubMed Scopus (23) Google Scholar). Genome-scale RNAi screens can reveal novel or unexpected pathways and gene families that can induce specific phenotypes when inhibited and simultaneously provide a large background set of genes for the determination of biological effects (9Bartz S.R. Zhang Z. Burchard J. Imakura M. Martin M. Palmieri A. Needham R. Guo J. Gordon M. Chung N. Warrener P. Jackson A.L. Carleton M. Oatley M. Locco L. Santini F. Smith T. Kunapuli P. Ferrer M. Strulovici B. Friend S.H. Linsley P.S. Mol. Cell. Biol. 2006; 26: 9377-9386Crossref PubMed Scopus (161) Google Scholar, 10Liang Z. IDrugs. 2005; 8: 924-926PubMed Google Scholar, 11Root D.E. Hacohen N. Hahn W.C. Lander E.S. Sabatini D.M. Nat. Methods. 2006; 3: 715-719Crossref PubMed Scopus (310) Google Scholar, 12Matsumoto S. Miyagishi M. Taira K. Methods Mol. Biol. 2007; 360: 131-142PubMed Google Scholar, 13Cullen L.M. Arndt G.M. Immunol. Cell Biol. 2005; 83: 217-223Crossref PubMed Scopus (175) Google Scholar, 14Blow N. Nat. Meth. 2008; 5: 361-368Crossref Scopus (8) Google Scholar). Recently, RNAi screens in model organisms and human cells have successfully identified genes that modulate cell growth, apoptosis, chemoresistance, and chemosensitivity (9Bartz S.R. Zhang Z. Burchard J. Imakura M. Martin M. Palmieri A. Needham R. Guo J. Gordon M. Chung N. Warrener P. Jackson A.L. Carleton M. Oatley M. Locco L. Santini F. Smith T. Kunapuli P. Ferrer M. Strulovici B. Friend S.H. Linsley P.S. Mol. Cell. Biol. 2006; 26: 9377-9386Crossref PubMed Scopus (161) Google Scholar, 15Huang R.Y. Eddy M. Vujcic M. Kowalski D. Cancer Res. 2005; 65: 5890-5897Crossref PubMed Scopus (48) Google Scholar, 16Aza-Blanc P. Cooper C.L. Wagner K. Batalov S. Deveraux Q.L. Cooke M.P. Mol. Cell. 2003; 12: 627-637Abstract Full Text Full Text PDF PubMed Scopus (315) Google Scholar, 17MacKeigan J.P. Murphy L.O. Blenis J. Nat. Cell Biol. 2005; 7: 591-600Crossref PubMed Scopus (475) Google Scholar, 18Silva J.M. Marran K. Parker J.S. Silva J. Golding M. Schlabach M.R. Elledge S.J. Hannon G.J. Chang K. Science. 2008; 319: 617-620Crossref PubMed Scopus (256) Google Scholar, 19Schlabach M.R. Luo J. Solimini N.L. Hu G. Xu Q. Li M.Z. Zhao Z. Smogorzewska A. Sowa M.E. Ang X.L. Westbrook T.F. Liang A.C. Chang K. Hackett J.A. Harper J.W. Hannon G.J. Elledge S.J. Science. 2008; 319: 620-624Crossref PubMed Scopus (324) Google Scholar). This approach has been particularly successful for the isolation of several genes that encode proteins involved in cancer-relevant pathways such as the p53 and NF-κB pathways, phosphatidylinositol 3-kinase signaling, and RAS-dependent transformation (20Bernards R. Brummelkamp T.R. Beijersbergen R.L. Nat. Methods. 2006; 3: 701-706Crossref PubMed Scopus (114) Google Scholar, 21Berns K. Hijmans E.M. Mullenders J. Brummelkamp T.R. Velds A. Heimerikx M. Kerkhoven R.M. Madiredjo M. Nijkamp W. Weigelt B. Agami R. Ge W. Cavet G. Linsley P.S. Beijersbergen R.L. Bernards R. Nature. 2004; 428: 431-437Crossref PubMed Scopus (949) Google Scholar, 22Ngo V.N. Davis R.E. Lamy L. Yu X. Zhao H. Lenz G. Lam L.T. Dave S. Yang L. Powell J. Staudt L.M. Nature. 2006; 441: 106-110Crossref PubMed Scopus (523) Google Scholar, 23Kolfschoten I.G. van Leeuwen B. Berns K. Mullenders J. Beijersbergen R.L. Bernards R. Voorhoeve P.M. Agami R. Cell. 2005; 121: 849-858Abstract Full Text Full Text PDF PubMed Scopus (248) Google Scholar, 24Westbrook T.F. Martin E.S. Schlabach M.R. Leng Y. Liang A.C. Feng B. Zhao J.J. Roberts T.M. Mandel G. Hannon G.J. Depinho R.A. Chin L. Elledge S.J. Cell. 2005; 121: 837-848Abstract Full Text Full Text PDF PubMed Scopus (424) Google Scholar). We hypothesized that siRNA (small interfering RNA) library screens could identify genes whose loss of function would confer decreased sensitivity to chemotherapy drugs. Identification of such genes could possibly provide targets for gene therapy that, either alone or in combination with conventional chemotherapeutic agents, might help to reverse drug resistance (9Bartz S.R. Zhang Z. Burchard J. Imakura M. Martin M. Palmieri A. Needham R. Guo J. Gordon M. Chung N. Warrener P. Jackson A.L. Carleton M. Oatley M. Locco L. Santini F. Smith T. Kunapuli P. Ferrer M. Strulovici B. Friend S.H. Linsley P.S. Mol. Cell. Biol. 2006; 26: 9377-9386Crossref PubMed Scopus (161) Google Scholar). Here we constructed a partially randomized siRNA retrovirus library and performed RNAi screens in the presence of epirubicin to identify genes whose loss of function de-sensitized gastric cancer cells to chemotherapeutic agent-induced cell death. For the first time, to the best of our knowledge, we have successfully screened hits targeting functional genes related to a special phenotype (drug resistance in our work) using a randomized siRNA library-based strategy. We further provide evidence that GAS1 (growth-arrest-specific 1), a putative tumor suppressor gene, plays a previously unappreciated role in regulating cellular drug chemosensitivity. This study strongly supports the feasibility of this novel approach to the identification of drug resistance-related genes. PhoenixTM-Eco packaging cells were purchased from Orbigen (catalog number RVK-10001). The human gastric adenocarcinoma cell line SGC7901 was obtained from the Academy of Military Medical Science (Beijing, China). Other gastric cancer cell lines, MKN28, MKN45 and AGS, were purchased from the ATCC (Manassas, VA). Multidrug-resistant cell variants, SGC7901/VCR and SGC7901/ADR, were established and maintained in our laboratory. Cells were maintained in Dulbecco's modified Eagle's medium containing 10% heat-inactivated fetal calf serum at 37 °C in a humidified atmosphere of 5% CO2 and 95% air. All transfections were performed by Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. SGC7901-rec, a SGC7901 variant to facilitate retrovirus infection, was generated by transfection of an ecotropic receptor as described previously (21Berns K. Hijmans E.M. Mullenders J. Brummelkamp T.R. Velds A. Heimerikx M. Kerkhoven R.M. Madiredjo M. Nijkamp W. Weigelt B. Agami R. Ge W. Cavet G. Linsley P.S. Beijersbergen R.L. Bernards R. Nature. 2004; 428: 431-437Crossref PubMed Scopus (949) Google Scholar). Ecotropic retroviral supernatants were collected 48 h after transient transfection of PhoenixTM-Eco cells, and cells were incubated at 32 °C to obtain higher yields of virus after transfection. Viral supernatants were filtered through a 0.45-μm filter, and infections were performed in the presence of 4 μg/ml Polybrene (Sigma). Fluorescent microscopy was used to detect the transfection and infection efficiency 48 h post-transfection and 72 h post-infection. Before constructing the random siRNA library, the siRNA retrovirus expression vector psiRNA-lib was constructed, and psiRNA-lib harboring the Cdc2 siRNA sequence (psiRNA-lib-Cdc2) was established to validate the effectiveness of the vector (see supplemental Fig. S1). Fig. 1 outlines our procedure for constructing the siRNA retrovirus plasmid library, which can roughly be divided into four steps. siRNA sequences were designed with an algorithm developed to increase the silencing efficiency of the siRNAs as follows: T at position 1, T at position 2, T at position 7, A at position 10, T at position 11, C at position 19, and G at position 21 are characteristic of active siRNAs (25Huesken D. Lange J. Mickanin C. Weiler J. Asselbergs F. Warner J. Meloon B. Engel S. Rosenberg A. Cohen D. Labow M. Reinhardt M. Natt F. Hall J. Nat. Biotechnol. 2005; 23: 995-1001Crossref PubMed Scopus (302) Google Scholar). Based on these rules, a partially randomized library primer with a SalI site and AAAAA at the 5′ end and TTTTT as well as a ClaI site at the 3′ end was synthesized. Double-stranded DNA was formed by annealing with a short extension primer (AAAAATAGCTAATGATG) that was complementary to the 3′-terminal sequence. Fifty microliters of reaction mixture was prepared (2 μl of polymerase TaqDNA polymerase (Promega), 9 μl of 10 μmol/liter library primer, 18 μl of 50 μmol/liter extension primer, 6 μl of dNTP). Extension was carried out with the following parameters: 95 °C for 2 min, gradual increase from 35 to 72 °C (5 °C every 8 s), and extension at 55 °C for 2 h. The resulting DNA duplexes were cleaved with SalI and ClaI, followed by purification with a QIAquick nucleotide removal kit (Qiagen, Germany). A 15% polyacrylamide gel was used to determine the size of resulting DNA products. Purified DNA duplexes as inserts were ligated into psiRNA-lib vectors by DNA ligase (New England Biolabs). Ligation reactions were transformed into competent DH5a bacteria. Bacterial cultures were grown overnight on 10-cm Petri dish, and all clones were collected for plasmid DNA isolation, thus generating the siRNA plasmid library. Meanwhile, 20 independent clones were picked for EcoRI digestion and sequence analysis for library identification. PhoenixTM-Eco cells were seeded in four 10-cm plates at a density of 5.5 × 106 cells per plate at 18 h prior to transfection. For each plate, the cells were transfected with 12 μg of siRNA library plasmid (equivalent to 106 plasmids). Ecotropic retroviral supernatants were collected 48 h post-transfection and used to transduce four 10-cm dishes of SGC7901-rec cells in the presence of 4 μg/ml Polybrene. A plasmid encoding a negative control siRNA duplex denoting psiRNA-lib-cont was established (sense, 5′-TTCAGCTAGATTCTAAGTCTG-3′; antisense, 5′-CAGACTTAGAATCTAGCTGAA-3′); it does not target any known mRNA in mammalian cells evaluated by blast search. This negative control plasmid was introduced into SGC7901-rec cells under the same conditions as those of the siRNA library. Three days post-infection, pools of transduced SGC7901-rec cells were trypsinized and resuspended in four 10-cm dishes in medium containing 1.9 μg/ml epirubicin (EPI), a concentration that was lethal to parental SGC7901 and SGC7901-rec cells (data not shown). After 8 weeks of plating, all the surviving colonies from four dishes were trypsinized, collected, pooled, and then transferred into a 10-cm dish. In all, the resistant colonies were cultured and expanded for about 8 weeks before sequence identification and analysis. The screen was repeated eight times totally. Genomic DNA was isolated from expanded colonies using DNAzol (Invitrogen). PCR amplification of the siRNA inserts was performed using primers adjacent to the siRNA cloning site with forward primer 5′-GGATCTCGAGAAGATCCTTTGAT-3′ and reverse primer 5′-GGATCTCGAGAAGATCCTTTGAT-3′. PCR products were digested with XhoI and cloned back into pRetro-GFP digested by SalI. Products were sequenced using a psiRNA-lib-seq primer, 5′-GCATGGACGAGCTGTACAAG-3. Ligation reactions were transformed into competent DH5a bacteria. Bacterial cultures were grown overnight, and plasmid DNA was isolated and subjected to sequencing. Western blotting was performed as described (26Pan Y. Zhao L. Liang J. Liu J. Shi Y. Liu N. Zhang G. Jin H. Gao J. Xie H. Wang J. Liu Z. Fan D. FASEB J. 2006; 20: 1886-1888Crossref PubMed Scopus (100) Google Scholar). Anti-Cdc2 antibody was from Amersham Biosciences. Anti-human GAS1 polyclonal antibody was purchased from R & D Systems (catalog number AF2636). Anti-human PTEN, Bcl-2, Bax, MRP1, P-pg, and BCRP antibodies were purchased from Santa Cruz Biotechnology. Western blotting for β-tubulin (Sigma T4026) was used as an internal control. Each experiment was repeated three times, and the ratios of various proteins against β-tubulin were calculated. SGC7901 cells transfected with psiRNA-lib-cont (SGC7901/cont) were used as a control in all experimental procedures. Each experiment was repeated three times. The mRNA expression and silencing effects were quantified by quantitative real time RT-PCR on a Bio-Rad Chromo 4 instrument with a SYBR Green real time RT-PCR master mix kit (Takara, China) for detection of GAS1. GAPDH was used as an endogenous control. Forward (F) and reverse (R) primer sequences were as follows: GAS1 (F) 5′-CTGGGGTTTGTTACCAGTTG-3′ and GAS1 (R) 5′-GGGGGAAAGGTGTAATATGG-3′; PTEN (F) 5′-CCGAAAGGTTTTGCTACCATTCT-3′ and PTEN (R) 5′-AAAATTATTTCCTTTCTGAGCATTCC-3′; GAPDH (F) 5′-ATCACCATCTTCCAGGAGCGA-3′ and GAPDH (R) 5′-AGCCTTCTCCATGGTGGTGAA-3′. PCR was performed for 20 s at 95 °C and 30 s at 60 °C for 45 cycles. The fold change for each mRNA from SGC7901-derived cells compared with control (SGC7901/cont cells) was calculated using the 2−ΔΔCT method (27Livak K.J. Schmittgen T.D. Methods. 2001; 25: 402-408Crossref PubMed Scopus (133248) Google Scholar). PCR was performed in triplicate, and the average 2−ΔΔCT value in addition to S.D. was calculated for each sample relative to the normal control. EPI, ADR, VCR, cisplatin (CDDP), and 5-fluorouracil (5-FU) were all freshly prepared before each experiment. The sensitivity of SGC7901-derived cells to anticancer agents was evaluated using MTT assay. Cells underwent 72 h of incubation in the absence or presence of various concentrations of the anticancer agents. Dose-effect curves of anticancer drugs were drawn on semi-logarithm coordinate paper, and IC50 values were determined. Each experiment was repeated three times. The fluorescence intensity of intracellular EPI was determined using flow cytometry as described previously (28Dorn A. Graf N. Pees H.W. Padiatr. Padol. 1993; 28: 157-163PubMed Google Scholar). In brief, SGC7901/cont and SGC7901/siGAS1 cells in log phase were plated onto 6-well plates (1 × 106 cells/well). After the addition of EPI to a final concentration of 1.9 μg/ml, cells were cultured for 1 h. Then cells were harvested to detect EPI accumulation or were continuously cultured in drug-free medium for another 2 h, followed by harvesting to detect EPI retention. Finally, cells were washed twice with cold phosphate-buffered saline, and the mean fluorescence intensity of intracellular EPI was detected using flow cytometry with an excitation wavelength of 488 nm and emission wavelength of 575 nm. Twenty four hours after transfection, EPI was added into SGC7901-derived cells to a final concentration of 0.8 μg/ml. 18 h later, cells were harvested and washed twice with precooled phosphate-buffered saline. After incubation with a mixture containing annexin V and propidium iodide (Roche Diagnostics) in binding buffer for 15 min, the fluorescences of cells were measured using flow cytometer (BD FACScantoTM). Annexin V binds to those cells that express phosphatidylserine on the outer layer of the cell membrane, and propidium iodide stains the cellular DNA of those cells with a compromised cell membrane. Data are expressed as means ± S.D. Differences between means were analyzed with Student's t test. All statistical analyses were performed using SPSS11.0 software (Chicago). Differences were considered significant at p < 0.05. After siRNA retrovirus expression vector psiRNA-lib was constructed, and the effectiveness was confirmed by introducing Cdc2 siRNA sequence (see supplemental Fig. S1). We cloned the primer extension product of the synthesized 21-nucleotide partially randomized sequence into the cloning site of psiRNA-lib. Library construction steps are summarized in Fig. 1. To increase the likelihood of obtaining a significant inhibition of gene expression, the 21-bp partially randomized siRNA library primer was synthesized based on guidelines suggested by Huesken et al. (25Huesken D. Lange J. Mickanin C. Weiler J. Asselbergs F. Warner J. Meloon B. Engel S. Rosenberg A. Cohen D. Labow M. Reinhardt M. Natt F. Hall J. Nat. Biotechnol. 2005; 23: 995-1001Crossref PubMed Scopus (302) Google Scholar). Thereafter, the 21-bp library primer was annealed with the extension primer, and primer extension was performed to form complementary DNA duplexes that were further ligated with psiRNA-lib. For each 10-cm Petri dish, as many as 8 × 103 clones were obtained when using 50-ng vector at a ratio of 1:10 relative to the siRNA insert (data not shown). In total, ligation products were plated in 500 Petri dishes, and 4 × 106 clones were obtained finally. To validate the library, we isolated 20 independent clones for EcoRI digestion (data not shown), and sequence information of the inserts was obtained (Fig. 2). Of these, 18 constructs contained inserts of the appropriate size and all were unique, although one clone had no insert and one clone had a TTTTT termination sequence. Average G + C content was 41.1%. These results suggest that the library we constructed contained sufficient complexity (4 × 106) for screening purposes. After library validation, we collected the pools of clones and extracted the plasmids. To validate the random siRNA screening approach, we developed a cell system to screen for EPI-resistant molecules in gastric cancer cells. PhoenixTM-Eco cells were transfected with 12 μg of siRNA library plasmid (equivalent to 106 plasmids) per 10-cm plate to generate the siRNA retrovirus library. In total, four plates of the virus library should then be used to infect four plates of SGC7901-rec cells and selected with 1.9 μg/ml EPI to ensure relatively low plasmid/cell ratio (roughly 1:1) and enough coverage of library capacity. Fluorescence microscopy showed that the infection frequency was ∼20% by analysis of GFP fluorescence (see supplemental Fig. S1). The first resistant pools of colonies were observed 2 weeks after retroviral transduction and, considering that some cells might survive whereas others might die gradually, we allowed all colonies to proliferate for 8 weeks under EPI selection pressure before further characterization. A plate of SGC7901-rec cells infected with the psiRNA-lib-cont virus was included as a parallel negative control to eliminate the possibility of acquired resistance because of prolonged culture with EPI. The screen was repeated eight times to collect as many surviving clones as possible. Twelve clones were collected a from total of 32 plates in the presence of 1.9 μg/ml EPI, and no spontaneously resistant clones grew under these selective culture conditions. Subsequently, the genomic DNA of surviving cells was isolated individually, and PCR was performed to amplify the siRNA expression cassettes; 12 siRNA sequences were obtained (Table 1). To detect genes involved in drug resistance, we compared the sensitivities of SGC7901 cells transfected with psiRNA-lib plasmids harboring every candidate siRNA and psiRNA-lib-cont (SGC7901/cont) with different concentrations of EPI by MTT assay. Normalized by transfection efficiency, IC50 values of SGC7901 cells transfected with all siRNAs were higher than those of SGC7901/cont cells, with siRNA 001 (4.3-fold) and siRNA 003 (3.9-fold) the most significant (Fig. 3), indicating these siRNAs might suppress genes involved in EPI resistance. BLAST was used to compare nucleotide sequences with human transcript data bases and to calculate the statistical significance of matches. Of the 12 siRNA sequences obtained, siRNA 001 and siRNA 003 produced the most significant alignments, whereas the other 10 siRNAs failed to target any transcripts in the human genome. The sense strand of siRNA 001 (TTCATTTCCATGAAGCCACCG) has 95% homology to site 204–224 (TTCATTTCCAGGAAGCCACCG) of the human GAS1 (NM_002048.1) transcript, with only one nucleotide mismatch (T at position 11 instead of G) (Fig. 4A). The sense strand of siRNA 003 (TTTAACTGTATTATTTGGCAG) has 95% homology to site 5221–5241 (TTTAACTGTAGTATTTGGCAG) of the PTEN (NM_000314.4) transcript, with one nucleotide mismatch (T at position 11 instead of G) (Fig. 4B). These two genes are likely to be the target genes for our isolated clones, because previous findings have shown that several mismatches can be tolerated between siRNAs and targets (29Dahlgren C. Zhang H.Y. Du Q. Grahn M. Norstedt G. Wahlestedt C. Liang Z. Nucleic Acids Res. 2008; 36: e53Crossref PubMed Scopus (61) Google Scholar, 30Du Q. Thonberg H. Wang J. Wahlestedt C. Liang Z. Nucleic Acids Res. 2005; 33: 1671-1677Crossref PubMed Scopus (199) Google Scholar).TABLE 1Sequences of 12 siRNAs obtained by screening a partially randomized siRNA retrovirus libraryClone No.Sequence (5′–3′)siRNA 001TTCATTTCCATGAAGCCACCGsiRNA 002TTCGATTCGATCGTCATCCTGsiRNA 003TTTAACTGTATTATTTGGCAGsiRNA 004TTGGCCTAAATTCGATCGCGGsiRNA 005TTATCCTCCATTCTTACTACAGsiRNA 006TTTAGTTCAATATGTTGTCCGsiRNA 007TTCCGATCCATGCAATTCCAGsiRNA 008TTCTGATGTATTAGTGGCCCGsiRNA 009TTCGGATGGATAACGCCACTGsiRNA 010TTGCAATCCATGATTGGACAGsiRNA 011TTTAGCTGAATGATGATCCGGsiRNA 012TTATGCTGAATGTGATGGCAG Open table in a new tab FIGURE 4Sequence analysis and effectiveness confirmation of GAS1 or PTEN siRNA, and validation of their roles in EPI chemoresistance. A and B, sequence analysis of siRNAs obtained from the screening of a random siRNA library targeting GAS1 (A) and PTEN (B), respectively. Inhibition of GAS1 and PTEN expression in SGC7901 cells by transfection with psiRNA-lib-GAS1, psiRNA-lib-GAS1(+), psiRNA-lib-PTEN, and psiRNA-lib-PTEN(+), respectively, is shown. SGC7901/cont was established by transfection with psiRNA-lib-cont in SGC7901 cells. Relative expression levels of GAS1 (C) and PTEN (D) were determined by real time RT-PCR. All data were normalized by GAPDH. Means ± S.D. are shown. E, Western blot analysis of GAS1 expression in SGC7901/siGAS1 and SGC 7901/siGAS1(+) cells. F, Western blot analysis of PTEN expression in SGC 7901/siPTEN and SGC 7901/siPTEN(+) cells. SGC7901 and SGC7901/cont cells were used as controls; β-tubulin was used as a loading control. Chemosensitivities of GAS1 (G) and PTEN (H) siRNA plasmid-transfected SGC7901 cells to EPI was determined by MTT analysis. **, p < 0.05. (+) GAS1 or PTEN siRNA with one nucleotide mismatch.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Because PTEN has been intensively studied for its role in drug resistance to gastric cancer (31Yu H.G. Ai Y.W.