Portal de Periódicos da CAPES

Exchange of Subunit Interfaces between Recombinant Adult and Fetal Hemoglobins

1997; Elsevier BV; Volume: 272; Issue: 50 Linguagem: Inglês

10.1074/jbc.272.50.31326

1083-351X

Antoine Dumoulin, Lois R. Manning, W. Terry Jenkins, Robert M. Winslow, James M. Manning,

Erythrocyte Function and Pathophysiology

The inter-relationship between the interior subunit interfaces and the exterior diphosphoglycerate (DPG) binding region of the hemoglobin tetramer and the effects of a specific N-terminal acetylation on tetramer assembly have been evaluated. Tetrameric fetal hemoglobin F in the liganded state was found to dissociate to dimers much less than previously appreciated,i.e. about 70 times less than adult hemoglobin A (K d = 0.01 μm and 0.68 μm, for HbF and HbA, at pH 7.5, respectively) over the pH range 6.2–7.5, whereas HbF1, in which the N termini of the γ-chains are acetylated, dissociates like HbA. To determine whether this feature of HbF could be transferred to hemoglobin A, the single amino acid difference in their α1β2/α1γ2interfaces and the 4 amino acid differences in their α1β1/α1γ1interfaces have been substituted in HbA to those in HbF. This pentasubstituted recombinant HbA/F had the correct molecular weight as determined by mass spectrometry, the expected mobility on isoelectric focusing, the calculated amino acid composition, and normal circular dichroism properties, oxygen binding, and cooperativity. Although HbA/F has the same amino acid side chains that bind DPG as HbA, its diminished response to 2,3-DPG resembled that of HbF. However, its tetramer-dimer dissociation constant (K d = 0.14 μm) was between that of HbA and HbF despite the fact that it was composed entirely of HbF subunit interfaces. The results indicate that regions of the tetramer distant from the tetramer-dimer interface influence its dissociation and, reciprocally, that the interfaces affect regions involved in the binding of allosteric regulators, suggesting flexible long range inter-relationships in hemoglobin. The inter-relationship between the interior subunit interfaces and the exterior diphosphoglycerate (DPG) binding region of the hemoglobin tetramer and the effects of a specific N-terminal acetylation on tetramer assembly have been evaluated. Tetrameric fetal hemoglobin F in the liganded state was found to dissociate to dimers much less than previously appreciated,i.e. about 70 times less than adult hemoglobin A (K d = 0.01 μm and 0.68 μm, for HbF and HbA, at pH 7.5, respectively) over the pH range 6.2–7.5, whereas HbF1, in which the N termini of the γ-chains are acetylated, dissociates like HbA. To determine whether this feature of HbF could be transferred to hemoglobin A, the single amino acid difference in their α1β2/α1γ2interfaces and the 4 amino acid differences in their α1β1/α1γ1interfaces have been substituted in HbA to those in HbF. This pentasubstituted recombinant HbA/F had the correct molecular weight as determined by mass spectrometry, the expected mobility on isoelectric focusing, the calculated amino acid composition, and normal circular dichroism properties, oxygen binding, and cooperativity. Although HbA/F has the same amino acid side chains that bind DPG as HbA, its diminished response to 2,3-DPG resembled that of HbF. However, its tetramer-dimer dissociation constant (K d = 0.14 μm) was between that of HbA and HbF despite the fact that it was composed entirely of HbF subunit interfaces. The results indicate that regions of the tetramer distant from the tetramer-dimer interface influence its dissociation and, reciprocally, that the interfaces affect regions involved in the binding of allosteric regulators, suggesting flexible long range inter-relationships in hemoglobin. Some functional properties of HbF (α2γ2), such as its oxygen affinity and its interaction with allosteric regulators such as 2,3-DPG 1The abbreviations used are: DPG, diphosphoglycerate; HPLC, high performance liquid chromatography. differ considerably from the corresponding values of HbA (α2β2) (1Poyart C. Burseaux E. Guesnon P. Teisseire B. Pflugers Arch. 1978; 376: 169-175Crossref PubMed Scopus (7) Google Scholar). The reasons for these differences, which play a very important physiological role in the transfer of O2 from maternal to fetal blood, are not yet fully understood in structural terms (2Frier J.A. Perutz M.F. J. Mol. Biol. 1977; 112: 97-112Crossref PubMed Scopus (102) Google Scholar, 3Perutz M. Mechanism of Cooperativity and Allosteric Regulations in Proteins. Cambridge University Press, Cambridge, United Kingdom1990: 7-28Google Scholar). Whether they are due in part to the relative extents of tetramer-dimer dissociations of HbA and HbF is not known because the dissociation constant of HbF has not been reported, although it has been generally assumed to be similar to that of HbA. In this report, we show that these values differ considerably, as reported in preliminary form (4Manning J.M. Manning L.R. Jenkins W.T. Winslow R.M. Protein Sci. 1997; 6: 103Google Scholar). Another important function of HbF involves its role in the amelioration of the crises associated with sickle cell anemia by administration of therapeutic agents that result in its increased synthesis; the basis for this therapy is that sickle cell anemia patients with hereditary persistence of fetal hemoglobin have a clinically mild disease. There are two mechanisms by which HbF could inhibit HbS polymerization in the deoxy state where sickling occurs, i.e. through the formation of mixed hybrids of HbF and HbS (α2βγ) or by a direct “sparing” effect on the solubility of HbS by the HbF tetramers themselves (5Nagel R.L. Bookchin R.M. Balazs T. Nature. 1975; 256: 667-668Crossref PubMed Scopus (60) Google Scholar, 6Goldberg M.A. Husson M.A. Bunn H.F. J. Biol. Chem. 1977; 252: 3414-3421Abstract Full Text PDF PubMed Google Scholar, 7Benesch R.E. Edalji R. Benesch R. Kwong S. Proc. Natl. Acad. Sci. U. S. A. 1990; 77: 5130-5134Crossref Scopus (54) Google Scholar, 8Eaton W.A. Hofrichter J. Science. 1995; 268: 1142-1143Crossref PubMed Scopus (95) Google Scholar). A prerequisite in the first mechanism is that there be a similar proportion of dimers of oxy-HbF and oxy-HbS (which dissociates like HbA; Ref. 9Manning L.R. Jenkins W.T. Hess J.R. Vandegriff K. Winslow R.M. Manning J.M. Protein Sci. 1996; 5: 775-781Crossref PubMed Scopus (77) Google Scholar), which then re-associate randomly in the deoxy state to give HbS and HbF tetramers as well as the mixed hybrid. Indeed, mixed hybrid tetramer formation is demonstrable only with deoxyhemoglobin (10Park C.M. Ann. N. Y. Acad. Sci. 1973; 209: 237Crossref PubMed Scopus (65) Google Scholar, 11Bunn H.F. McDonough M. Biochemistry. 1974; 13: 988-993Crossref PubMed Scopus (81) Google Scholar, 12Ip C.Y. Asakura T. Anal. Biochem. 1986; 156: 348-353Crossref PubMed Scopus (6) Google Scholar) but not with oxyhemoglobin. Thus, the relative extents of dimer formation from HbS and HbF in the oxy state dictate the amount of mixed hybrid in the deoxy sickling conformation, but this value for HbF is not known. A question of general interest that we have addressed is whether there exists any functional inter-relationship between the two types of subunit interfaces in hemoglobin, i.e. the dimer α1β1 or α1γ1interface and the tetramer α1β2 or α1γ2 interface either with each other or with the binding region for the allosteric regulator, 2,3-DPG. The converse of the latter linkage, i.e. the shift induced by DPG on the oxy to deoxy equilibrium and hence on subunit interfaces, has been known for some time (3Perutz M. Mechanism of Cooperativity and Allosteric Regulations in Proteins. Cambridge University Press, Cambridge, United Kingdom1990: 7-28Google Scholar). Another question that we also address here concerns the role of N-terminal acetylation of proteins, which is poorly understood (see Ref. 13Scaloni A. Barra D. Jones W.M. Manning J.M. J. Biol. Chem. 1994; 269: 15076-15084Abstract Full Text PDF PubMed Google Scholar, and references therein). Since there is a form of fetal hemoglobin (HbF1) also present in human blood in which the N termini of its γ-chains are acetylated, we studied its tetramer-dimer dissociation properties, and we report here that this modification endows fetal hemoglobin with a significant increase in its tetramer-dimer dissociation properties. A possible general function for N-terminal acetylation is discussed. To answer these questions, we employed a rapid and sensitive method for estimation of tetramer-dimer dissociation constants by high resolution gel filtration on Superose-12 (9Manning L.R. Jenkins W.T. Hess J.R. Vandegriff K. Winslow R.M. Manning J.M. Protein Sci. 1996; 5: 775-781Crossref PubMed Scopus (77) Google Scholar). Since the eluted peaks were narrow and symmetrical with little skewing, the data derived solely from the peak positions could be subjected to a comprehensive mathematical analysis that yielded measurements of tetramer-dimer dissociation constants (K d ) that were in the range of published values obtained by a variety of techniques (14Ackers G.K. Thompson T.E. Biochemistry. 1965; 53: 342-349Google Scholar, 15Chiancone E. Gilbert L.M. Gilbert G.A. Kellett G.L. J. Biol. Chem. 1968; 243: 1212-1219Abstract Full Text PDF PubMed Google Scholar, 16Fronticelli C. Gattoni M. Lu A.L. Brinigar W.S. Bucci J.L.G. Chiancone E. Biophys. Chem. 1994; 51: 53-57Crossref PubMed Scopus (26) Google Scholar, 17Benesch R.E. Kwong S. J. Biol. Chem. 1995; 270: 13785-13786Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar, 18Williams Jr., R.C. Kim H. Biochemistry. 1976; 15: 2207-2211Crossref PubMed Scopus (9) Google Scholar). In the present study, we further evaluate this procedure itself, and we used it to study the relative extents of dissociation of tetramers made up of αβ dimers (HbA) compared with αγ dimers (HbF and HbF1). This study of a functional inter-relationship between different regions of the tetramer was possible because of the significant difference we found between the tetramer dissociations of HbF and HbA. To accomplish this objective, we constructed a recombinant pentasubstituted hemoglobin (referred to as HbA/F) composed of HbF subunit interfaces side chains but otherwise containing the HbA sequence. HbA (sometimes referred to as HbAo) was purified as described previously (9Manning L.R. Jenkins W.T. Hess J.R. Vandegriff K. Winslow R.M. Manning J.M. Protein Sci. 1996; 5: 775-781Crossref PubMed Scopus (77) Google Scholar). HbF (sometimes called HbFo), which was kindly donated by Dr. Robert Bookchin (Albert Einstein College of Medicine), was isolated from postpartum umbilical cord blood. After purification it was >95% pure as ascertained by isoelectric focusing and by FPLC on a Mono S column; no acetylated HbF1 was detected. Amino acid analysis gave the correct composition for α2γ2 including 8 Ile, an amino acid absent in HbA. Analysis by mass spectrometry showed the correct molecular weight (α-chain, 15,126; γ-chain, 15,995; kindly performed by Dr. Urooj Mirza and Dr. Brian Chait, Rockefeller University). HbF1, purified from the same source, eluted before HbF on a Pharmacia Mono S column and showed a single band upon isoelectric focusing. It had the correct mass (α-chain (calculated, 15,126; found, 15,126 ± 3) and γ-Ac chain (calculated, 16,037; found, 16,042 ± 7), thus confirming the presence of a single acetyl group per γ-chain). The construction of the five mutations was done by combining the amplified sequences bearing the relevant mutations using the strategy shown in Fig.1. Since the interface residues that were mutated were clustered in two regions (residues 43 and 51 and residues 112, 116, and 125), we designed two pairs of oligonucleotides overlapping each of these regions. Their respective sequences were TTGACTCCTTTGGGGATCTGTCCACTGCTGA and GGTCACTGTGCTGGCCATTCACTTTGGCAAAGAATTCACCCCAGAAGTGC. A second pair with their corresponding complementary sequence was also synthesized. Two other oligonucleotides were used, each overlapping one extremity of the β-coding sequence and containing a restriction site. A two-step amplification procedure adapted from the overlap extension method (19Horton R.M. Pease L.R. McPherson M.J. Directed Mutagenesis. IRL Press, Oxford, UK1991: 217-247Google Scholar) was employed. The first amplification step was done in three different tubes to obtain the three parts of the β coding sequence having the complementary mutated zones. The correct size of each amplified DNA was verified on agarose gel and purified using Geneclean (BIO 101, Inc., Vista, CA). During the second amplification step, the three parts resulting from the first amplification step were combined and amplified. The size of the total resulting coding sequence was checked on an agarose gel, purified, and digested with the appropriate restriction enzyme to be inserted into the pGS190 plasmid containing the α wild-type cDNA expression cassette. Because of the frequency of mismatches during the two-step amplification by polymerase chain reaction, it was essential to check the entire β mutated coding sequence. The full β cDNA was sequenced and the presence of only the five desired mutations was confirmed as GAG → GAT, CCT → GCT, TGT → ACT, CAT → ATT, and CCA → GAA, respectively. In pGS190, the relative orientation of the α and β expression cassettes was not relevant; thus, cloning of the β cassette into pGS190α with only one restriction enzyme was a more efficient method. Both α and β cassettes were extracted together from the pGS190αβ plasmid with a NotI digestion and inserted into the shuttle Escherichia coli/yeast plasmid pGS389, previously dephosphorylated. Once these expression cassettes were inserted, the resulting pGS389αβ plasmid was prepared in large quantity (Midi Prep, Qiagen, Chatsworth, CA) and transformed into the GSY112 Saccharomyces cerevisiae strain as described (20Wagenbach M. O'Rourke K. Vitay L. Weiczorek A. Hoffman S. Durfee S. Tedesco J. Stetler G. Biotechnology. 1991; 9: 57-61Crossref PubMed Scopus (111) Google Scholar, 21Martin de Llano J.J. Manning J.M. Protein Sci. 1994; 3: 1206-1212Crossref PubMed Scopus (34) Google Scholar, 22Yanase H. Cahill S. Martin de Llano J.J. Manning L.R. Schneider K. Chait B.T. Vandegriff K.M. Winslow R.M. Manning J.M. Protein Sci. 1994; 3: 1213-1223Crossref PubMed Scopus (22) Google Scholar). The growth of yeast containing the plasmid was performed in a New Brunswick Bio-Flo IV 20 liter fermentor but otherwise under the same conditions used previously (21Martin de Llano J.J. Manning J.M. Protein Sci. 1994; 3: 1206-1212Crossref PubMed Scopus (34) Google Scholar, 22Yanase H. Cahill S. Martin de Llano J.J. Manning L.R. Schneider K. Chait B.T. Vandegriff K.M. Winslow R.M. Manning J.M. Protein Sci. 1994; 3: 1213-1223Crossref PubMed Scopus (22) Google Scholar). The loss of the plasmid is strongly restricted by the presence of two auxotrophic markers on the pGS389 plasmid. Therefore, the selective growth medium is depleted of uracil and leucine. Upon completion of growth, the yeast cells were harvested and broken as described previously (20Wagenbach M. O'Rourke K. Vitay L. Weiczorek A. Hoffman S. Durfee S. Tedesco J. Stetler G. Biotechnology. 1991; 9: 57-61Crossref PubMed Scopus (111) Google Scholar, 21Martin de Llano J.J. Manning J.M. Protein Sci. 1994; 3: 1206-1212Crossref PubMed Scopus (34) Google Scholar, 22Yanase H. Cahill S. Martin de Llano J.J. Manning L.R. Schneider K. Chait B.T. Vandegriff K.M. Winslow R.M. Manning J.M. Protein Sci. 1994; 3: 1213-1223Crossref PubMed Scopus (22) Google Scholar). Purification of Hb to homogeneity was achieved on CM-52 as the CO form, as also described previously (21Martin de Llano J.J. Manning J.M. Protein Sci. 1994; 3: 1206-1212Crossref PubMed Scopus (34) Google Scholar,22Yanase H. Cahill S. Martin de Llano J.J. Manning L.R. Schneider K. Chait B.T. Vandegriff K.M. Winslow R.M. Manning J.M. Protein Sci. 1994; 3: 1213-1223Crossref PubMed Scopus (22) Google Scholar), and subsequently on a Mono S column (Pharmacia) attached to a FPLC system. We refer to this pentasubstituted recombinant hemoglobin as HbA/F. The dissociation constants (K d ) were determined by the hemoglobin concentration dependence of peak positions on a Superose-12 HR10/30 as it eluted between the positions of cross-linked tetrameric Hb and the natural dimeric Hb Rothschild as described previously in detail (9Manning L.R. Jenkins W.T. Hess J.R. Vandegriff K. Winslow R.M. Manning J.M. Protein Sci. 1996; 5: 775-781Crossref PubMed Scopus (77) Google Scholar). The peak position used to determine the K d values was accurately measured by the Pharmacia FPLC Director software for each liganded (CO or O2) Hb concentration; the mathematical analysis of the curves has been reported (9Manning L.R. Jenkins W.T. Hess J.R. Vandegriff K. Winslow R.M. Manning J.M. Protein Sci. 1996; 5: 775-781Crossref PubMed Scopus (77) Google Scholar). The elution positions had a high degree of precision (± 0.04 ml) and have been reproducible using the same column over at least a 2-year period. Each analysis on the Superose column took approximately 1 h for completion. Since small zone gel filtration studies on Sephadex supports have been criticized because of the possibility of sample dilution on the column and peak broadening leading to erroneous K d values (23Ackers G.K. Neurath H. Hill R.L. 3rd Ed. The Proteins. I. Academic Press, New York1975: 2-94Google Scholar), we have tested the extent to which this occurs on the Superose support used in our studies. Two types of analysis were performed as described below: one using Hb concentrations within theK d range (Fig. 6) and another using Hb concentrations higher than the K d (Table I). The values for peak widths and positions were determined by the FPLC software packages; reproducibility was 1% or better (see TableI).Table IEffect of sample volume and hemoglobin concentration on elution profiles[Hb] loadedVolume loadedPeak positionPeak width at half-heightμmμlmlμlA.20.010013.19510 20.05013.26510 20.02513.24520B.10.010013.26510 20.05013.19520 40.02513.23510Average:13.23 ± 0.04513 ± 7Either a constant HbA concentration was loaded in varying volumes (A) or varying HbA concentrations were loaded in varying volumes (B) to evaluate the effect on peak position and peak width. In B, the concentration and volume were varied as necessary so that the same total amount of Hb was loaded each time. Open table in a new tab Either a constant HbA concentration was loaded in varying volumes (A) or varying HbA concentrations were loaded in varying volumes (B) to evaluate the effect on peak position and peak width. In B, the concentration and volume were varied as necessary so that the same total amount of Hb was loaded each time. The buffer routinely used for the study of the tetramer-dimer dissociations of HbA, HbF, HbF1, and HbA/F was made by adjusting the pH of 150 mm Tris base to pH 7.5 with glacial acetic acid. For lower pH values, the appropriate amount of glacial acetic acid was added. The concentrations of hemoglobins, which were determined by amino acid analysis of hydrolyzed samples, agreed within 3% with the concentrations determined by their visible spectra. For the K d analyses, accurate dilutions were made with the Tris acetate buffers. The globin chains of HbA, HbF, and HbA/F were separated by reverse phase HPLC on a Vydac C4 column attached to a Shimadzu HPLC unit using a gradient of 20–60% acetonitrile containing 0.1% trifluoroacetic acid. The effluent was monitored at 220 nm, and the peak retention times were determined with a Shimadzu CR 501 integrator. Amino acid analysis of the globin chains thus isolated was performed on a Beckman 6300 instrument with a System Gold data handling system. Electrospray mass spectrometric analysis of HbA/F was kindly performed on a Finnigan-MAT TSQ-700 triple quadrupole mass spectrometer by Dr. Urooj Mirza and Dr. Brian Chait. Fifty pmol of the hemoglobin sample was loaded onto a desalting protein cartridge (Michrom BioResources, Inc., Auburn, CA) and washed with 1 ml of deionized water. The sample was eluted from the cartridge using a solution of water/acetonitrile/acetic acid, 30/67.5/2.5 (v/v/v) and electrosprayed directly into the mass spectrometer. The flow rate was maintained at 6 μl/min through a 100-μm inner diameter fused silica capillary. Oxygen binding curves were determined at 37° on a modified Hem O Scan instrument (Aminco) after converting the Hb from the CO form in which it was purified to the O2form. This measurement on the Hem O Scan has been shown to give reliable results for a number of chemically modified and recombinant hemoglobins in our laboratory (21Martin de Llano J.J. Manning J.M. Protein Sci. 1994; 3: 1206-1212Crossref PubMed Scopus (34) Google Scholar, 22Yanase H. Cahill S. Martin de Llano J.J. Manning L.R. Schneider K. Chait B.T. Vandegriff K.M. Winslow R.M. Manning J.M. Protein Sci. 1994; 3: 1213-1223Crossref PubMed Scopus (22) Google Scholar, 28Martin de Llano J.J. Schneewind O. Stetler G. Manning J.M. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 918-922Crossref PubMed Scopus (41) Google Scholar, 29Martin de Llano J.J. Jones W. Schneider K. Chait B.T. Manning J.M. Rodgers G. Benjamin L.J. Weksler B. J. Biol. Chem. 1993; 268: 27004-27011Abstract Full Text PDF PubMed Google Scholar). The Hb concentration used for the measurements was 0.5–0.8 mm (tetramer) in 50 mm bis-Tris-Ac, pH 7.5. We chose a relatively high concentration of HbA and HbF to ensure that they would remain tetrameric. The Hill coefficient was calculated as described previously (21Martin de Llano J.J. Manning J.M. Protein Sci. 1994; 3: 1206-1212Crossref PubMed Scopus (34) Google Scholar, 22Yanase H. Cahill S. Martin de Llano J.J. Manning L.R. Schneider K. Chait B.T. Vandegriff K.M. Winslow R.M. Manning J.M. Protein Sci. 1994; 3: 1213-1223Crossref PubMed Scopus (22) Google Scholar). When 2,3-DPG was present, its final concentration varied between 2 and 6 mm. The recombinant HbA/F was found to be pure by chromatography on a Pharmacia FPLC Mono S column. It showed one sharp band upon isoelectric focusing in the Isolab Resolve pH 6–8 system (20Wagenbach M. O'Rourke K. Vitay L. Weiczorek A. Hoffman S. Durfee S. Tedesco J. Stetler G. Biotechnology. 1991; 9: 57-61Crossref PubMed Scopus (111) Google Scholar, 21Martin de Llano J.J. Manning J.M. Protein Sci. 1994; 3: 1206-1212Crossref PubMed Scopus (34) Google Scholar, 22Yanase H. Cahill S. Martin de Llano J.J. Manning L.R. Schneider K. Chait B.T. Vandegriff K.M. Winslow R.M. Manning J.M. Protein Sci. 1994; 3: 1213-1223Crossref PubMed Scopus (22) Google Scholar), and its migration was consistent with a net gain of four negative charges per tetramer. By SDS-polyacrylamide gel electrophoresis, there was a single band at 16 kDa in the same position as the denatured subunits of HbA and HbF. Mass spectrometric analysis of the recombinant HbA/F gave the expected mass for both subunits. Thus, the substitution in the α1β2 interface of Glu-43(β) by Asp and in the α1β1interface Pro-51(β) by Ala, Cys-112(β) by Thr, His-116(β) by Ile, and Pro-125(β) by Glu gives a calculated mass of 15,832, which was the value found by mass spectrometry. The α-chain of HbA/F did not involve any amino acid replacements, and its mass, 15,125, agreed with the calculated value. In the far ultraviolet (220–225 nm), the circular dichroism profiles of the pentasubstituted recombinant HbA/F were practically superimposable with those of recombinant HbS and of native HbA that we reported previously (21Martin de Llano J.J. Manning J.M. Protein Sci. 1994; 3: 1206-1212Crossref PubMed Scopus (34) Google Scholar), indicating that there were no adverse effects of the mutations or of the expression system on the secondary structure of the recombinant Hb. In the Soret region, the maximum ellipticity was at 424 nm, which was identical to that of natural HbA. Except for the slightly lower ellipticity at 412 nm, which was also found for some other hemoglobins (21Martin de Llano J.J. Manning J.M. Protein Sci. 1994; 3: 1206-1212Crossref PubMed Scopus (34) Google Scholar), the overall profiles in the Soret were identical, indicating no adverse effects on the heme pocket by the amino acid replacements. Separation of the globin subunits of HbA/F by HPLC (Fig. 2) indicated that the recombinant β/γ subunit containing the 5 amino acid substitutions eluted in a much more retarded position than the natural β-chain of HbA. Its elution position was close to that of the γ-chain of HbF. Amino acid analysis of each subunit isolated by HPLC (Table II) gave the expected composition, consistent with the substitution of the 5 amino acids in the recombinant subunit. For the βγ recombinant subunit, the presence of one Ile introduced by site-directed mutagenesis was diagnostic since the β-chain of HbA lacks Ile.Table IIAmino acid composition of HbA/F chainsAmino acidα-Chainβ-Chain calculatedβγ-ChainCalculatedFoundCalculatedFoundLys1110.9111111.4His109.5987.6Arg32.9332.8Asp1213.7131414.5Thr2-aThese amino acids are partially or completely destroyed during acid hydrolysis.98787.4Ser2-aThese amino acids are partially or completely destroyed during acid hydrolysis.1111.3556.7Glu57111111Pro77.3755.5Gly78.6131312.7Ala2118.6151614.61/2Cys2-aThese amino acids are partially or completely destroyed during acid hydrolysis.20.5210.5Val2-bDuring the 20 h of acid hydrolysis, Val-Val sequences are incompletely hydrolyzed.1311.5181813.92-bDuring the 20 h of acid hydrolysis, Val-Val sequences are incompletely hydrolyzed.Met2-aThese amino acids are partially or completely destroyed during acid hydrolysis.20110Ile0002-dThe values for Ile are diagnostic for a difference between the β-chain and the β/γ-chain.12-dThe values for Ile are diagnostic for a difference between the β-chain and the β/γ-chain.1.12-dThe values for Ile are diagnostic for a difference between the β-chain and the β/γ-chain.Leu18[18]2-cThe amino acids were calculated relative to the value found for Leu, which was set at 18.1818[18]2-cThe amino acids were calculated relative to the value found for Leu, which was set at 18.Tyr2-aThese amino acids are partially or completely destroyed during acid hydrolysis.32.3330.7Phe76.7887.42-a These amino acids are partially or completely destroyed during acid hydrolysis.2-b During the 20 h of acid hydrolysis, Val-Val sequences are incompletely hydrolyzed.2-c The amino acids were calculated relative to the value found for Leu, which was set at 18.2-d The values for Ile are diagnostic for a difference between the β-chain and the β/γ-chain. Open table in a new tab The results shown in Fig.3 demonstrate the high resolving capability of the gel filtration system on Superose-12 and indicate that for the same concentrations of liganded HbF and HbA, HbF eluted close to the position of undissociable cross-linked tetrameric Hb, whereas HbA eluted close to the dimeric Hb Rothschild (9Manning L.R. Jenkins W.T. Hess J.R. Vandegriff K. Winslow R.M. Manning J.M. Protein Sci. 1996; 5: 775-781Crossref PubMed Scopus (77) Google Scholar). These results show that tetrameric fetal hemoglobin (HbF) does not dissociate to dimers as readily as adult hemoglobin A. The dissociation constants of HbA, HbF, HbF1, and HbA/F were determined by a plot of hemoglobin concentration versus percent tetramer using amounts of hemoglobin that spanned either side of the dissociation constant. An estimate of the tetramer-dimer dissociation constant (K d ) for each hemoglobin can be read directly from the log-log plots in the insets as the corresponding values on the x axis when y = 1 (9Manning L.R. Jenkins W.T. Hess J.R. Vandegriff K. Winslow R.M. Manning J.M. Protein Sci. 1996; 5: 775-781Crossref PubMed Scopus (77) Google Scholar). The tetramer-dimer dissociation constant of liganded HbA is shown in Fig.4 A. Its K d value, 0.68 μm, obtained by mathematical analysis of the data (inset) is in good agreement with values obtained by several different procedures (e.g. Turner et al. (24Turner G.J. Galacteros F. Doyle M.L. Hedlund B. Pettigrew O.W. Turner B.W. Smith F.R. Moopenn W. Rucknagel D.L. Ackers G.K. Protein Struct. Funct. Genet. 1992; 14: 333-350Crossref PubMed Scopus (75) Google Scholar) reported a value of 1.1 μm using the large-zone exclusion method on a Sephadex support, and Benesch and Kwong (17Benesch R.E. Kwong S. J. Biol. Chem. 1995; 270: 13785-13786Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar) found 0.7 μm using a method dependent on heme dissociation from dimers. From the data of Williams and Kim (18Williams Jr., R.C. Kim H. Biochemistry. 1976; 15: 2207-2211Crossref PubMed Scopus (9) Google Scholar), who used the highly precise ultracentrifugal method, a K d value of 0.3 μm for HbA at pH 7.0 can be calculated. The correlation between our value for the K d of HbA at pH 7.5 is consistent with their results. The range of published values for theK d of HbA is consistent with the validity of the high resolution method described here and the mathematical analysis of the data. To measure the dissociation constant of liganded HbF, much lower concentrations than those used for HbA were required as suggested by the results in Fig. 3. At pH 7.5, a K d value of 0.01 μm was calculated (Fig. 4 B), indicating that the HbF tetramer is about 70 times less dissociated to dimers than HbA. The different dissociations for these hemoglobins explain an earlier report that there was no detectable equilibration between HbF (α2γ2) and HbH (β4) to form α2β2 under conditions where β4 readily equilibrated with other hemoglobins containing αβ subunits (25Huehns E.R. Beaven G.H. Stevens B.L. Biochem. J. 1964; 92: 444-448Crossref PubMed Scopus (9) Google Scholar). Similarly, Hb Bart's (γ4) was found to be tightly associated and not subject to equilibration with other hemoglobins. Frier and Perutz (2Frier J.A. Perutz M.F. J. Mol. Biol. 1977; 112: 97-112Crossref PubMed Scopus (102) Google Scholar) have solved the structure of deoxy-HbF and located the 5 amino acid differences bet