Produção Nacional
Revisado por pares
Autophagy Is Involved in Nutritional Stress Response and Differentiation in Trypanosoma cruzi
2007; Elsevier BV; Volume: 283; Issue: 6 Linguagem: Inglês
10.1074/jbc.m708474200
ISSN1083-351X
AutoresVanina E. Álvarez, Gregor Kosec, Celso Sant’Anna, Vito Türk, Juan José Cazzulo, Boris Turk,
Tópico(s)Lysosomal Storage Disorders Research
ResumoAutophagy is the major mechanism used by eukaryotic cells to degrade and recycle proteins and organelles. Bioinformatics analysis of the genome of the protozoan parasite Trypanosoma cruzi revealed the presence of all components of the Atg8 conjugation system, whereas Atg12, Atg5, and Atg10 as the major components of the Atg12 pathway could not be identified. The two TcATG4 (autophagin) homologs present in the genome were found to correctly process the two ATG8 homologs after the conserved Gly residue. Functional studies revealed that both ATG4 homologues but only one T. cruzi ATG8 homolog (TcATG8.1) complemented yeast deletion strains. During starvation of the parasite, TcAtg8.1, but not TcAtg8.2, was found by immunofluorescence to be located in autophagosome-like vesicles. This confirms its function as an Atg8/LC3 homolog and its potential to be used as an autophagosomal marker. Most importantly, autophagy is involved in differentiation between developmental stages of T. cruzi, a process that is essential for parasite maintenance and survival. These findings suggest that the autophagy pathway could represent a target for a novel chemotherapeutic strategy against Chagas disease. Autophagy is the major mechanism used by eukaryotic cells to degrade and recycle proteins and organelles. Bioinformatics analysis of the genome of the protozoan parasite Trypanosoma cruzi revealed the presence of all components of the Atg8 conjugation system, whereas Atg12, Atg5, and Atg10 as the major components of the Atg12 pathway could not be identified. The two TcATG4 (autophagin) homologs present in the genome were found to correctly process the two ATG8 homologs after the conserved Gly residue. Functional studies revealed that both ATG4 homologues but only one T. cruzi ATG8 homolog (TcATG8.1) complemented yeast deletion strains. During starvation of the parasite, TcAtg8.1, but not TcAtg8.2, was found by immunofluorescence to be located in autophagosome-like vesicles. This confirms its function as an Atg8/LC3 homolog and its potential to be used as an autophagosomal marker. Most importantly, autophagy is involved in differentiation between developmental stages of T. cruzi, a process that is essential for parasite maintenance and survival. These findings suggest that the autophagy pathway could represent a target for a novel chemotherapeutic strategy against Chagas disease. Autophagy is a major mechanism for bulk degradation of proteins and organelles and is essential for maintaining cellular homeostasis and for cellular development during differentiation, metamorphosis, and aging. Although the process is believed to have arisen primarily as a response to starvation and stress in unicellular organisms, such as yeast, in multicellular organisms autophagy has been also linked to neurodegeneration, cardiomyopathies, pathogen infection, muscular disorders, cancer, and non-apoptotic cell death. During autophagy portions of cytoplasm are engulfed in double membrane vesicles called autophagosomes, which subsequently fuse with the lysosomes/vacuoles, thereby enabling degradation of engulfed material by lysosomal hydrolases (1Shintani T. Klionsky D.J. Science. 2004; 306: 990-995Crossref PubMed Scopus (2134) Google Scholar, 2Klionsky D.J. J. Cell Sci. 2005; 118: 7-18Crossref PubMed Scopus (756) Google Scholar, 3Klionsky D.J. Ohsumi Y. Annu. Rev. Cell Dev. Biol. 1999; 15: 1-32Crossref PubMed Scopus (388) Google Scholar).The molecular basis of autophagy was elucidated through Saccharomyces cerevisiae genetic screens, where 16 essential genes (ATGs) were identified (4Klionsky D.J. Cregg J.M. Dunn Jr., W.A. Emr S.D. Sakai Y. Sandoval I.V. Sibirny A. Subramani S. Thumm M. Veenhuis M. Ohsumi Y. Dev. Cell. 2003; 5: 539-545Abstract Full Text Full Text PDF PubMed Scopus (1001) Google Scholar). Among these genes, two unique ubiquitin-like systems play an important role in the early stages of autophagosome biogenesis (5Ohsumi Y. Mizushima N. Semin. Cell Dev. Biol. 2004; 15: 231-236Crossref PubMed Scopus (253) Google Scholar). The first one is the Atg12 system, where the ubiquitin-like Atg12 protein is conjugated to Atg5 protein in a process mediated by Atg7, an E1 6The abbreviations used are: E1ubiquitin-activating enzymeE2ubiquitin-conjugating enzymePEphosphatidylethanolamineCvt pathwaycytoplasm-to-vacuole targeting pathwayBHTbrain-heart-tryptosePBSphosphate-buffered salineNi-NTAnickel-nitrilotriacetic acidTBSTris-buffered saline bufferE-64trans-epoxysuccinyl-l-leucilamido-(4-guanidino)butaneAbzortho-aminobenzoic acidpAPIproaminopeptidase ImAPImature aminopeptidase IHAhemagglutininDAPI4′,6-diamidino-2-phenylindole. 6The abbreviations used are: E1ubiquitin-activating enzymeE2ubiquitin-conjugating enzymePEphosphatidylethanolamineCvt pathwaycytoplasm-to-vacuole targeting pathwayBHTbrain-heart-tryptosePBSphosphate-buffered salineNi-NTAnickel-nitrilotriacetic acidTBSTris-buffered saline bufferE-64trans-epoxysuccinyl-l-leucilamido-(4-guanidino)butaneAbzortho-aminobenzoic acidpAPIproaminopeptidase ImAPImature aminopeptidase IHAhemagglutininDAPI4′,6-diamidino-2-phenylindole.-like enzyme (ubiquitin-activating enzyme), and Atg10, an E2-like enzyme (ubiquitin-conjugating enzyme). The Atg12-Atg5 conjugate forms a complex with Atg16 protein (6Kuma A. Mizushima N. Ishihara N. Ohsumi Y. J. Biol. Chem. 2002; 277: 18619-18625Abstract Full Text Full Text PDF PubMed Scopus (340) Google Scholar) that is thought to form a transient coat that drives the deformation of the sequestering membrane during vesicle formation. The second ubiquitin-like protein that acts on vesicle expansion and completion is Atg8. This protein is proteolytically processed by the Atg4 protease (autophagin), thereby exposing a Gly residue which is then covalently attached to a phosphatidylethanolamine (PE) moiety by the concerted action of Atg7 and Atg3 proteins, the latter being a specific E2-like conjugating enzyme (7Ichimura Y. Kirisako T. Takao T. Satomi Y. Shimonishi Y. Ishihara N. Mizushima N. Tanida I. Kominami E. Ohsumi M. Noda T. Ohsumi Y. Nature. 2000; 408: 488-492Crossref PubMed Scopus (1479) Google Scholar). This enables the previously cytosolic Atg8 protein to tightly associate with the membranes (8Kirisako T. Baba M. Ishihara N. Miyazawa K. Ohsumi M. Yoshimori T. Noda T. Ohsumi Y. J. Cell Biol. 1999; 147: 435-446Crossref PubMed Scopus (708) Google Scholar) making Atg8-PE a suitable autophagosomal membrane marker. Before fusion with the vacuole, Atg8 is deconjugated from PE in the outer membrane by Atg4 and released to the cytosol to be reused for new vesicle formation (9Kirisako T. Ichimura Y. Okada H. Kabeya Y. Mizushima N. Yoshimori T. Ohsumi M. Takao T. Noda T. Ohsumi Y. J. Cell Biol. 2000; 151: 263-276Crossref PubMed Scopus (724) Google Scholar). In yeast, autophagy overlaps with a biosynthetic process termed the cytoplasm-to-vacuole targeting (Cvt) pathway. The Cvt pathway is an example of a specific type of autophagy where some proteins that are destined to become resident vacuolar hydrolases are synthesized in the cytosol followed by specific packaging into vesicles and delivery to the vacuole (10Harding T.M. Hefner-Gravink A. Thumm M. Klionsky D.J. J. Biol. Chem. 1996; 271: 17621-17624Abstract Full Text Full Text PDF PubMed Scopus (216) Google Scholar, 11Scott S.V. Hefner-Gravink A. Morano K.A. Noda T. Ohsumi Y. Klionsky D.J. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 12304-12308Crossref PubMed Scopus (213) Google Scholar). The molecular mechanism of autophagy was found to be strikingly similar in mammalian cells, with conservation of all the genes essential for the autophagosome formation (12Wang C.W. Klionsky D.J. Mol. Med. 2003; 9: 65-76Crossref PubMed Google Scholar).Very little is known about autophagy in primitive unicellular organisms such as protozoan parasites, known to infect hosts of diverse origin. The recent completion of the genome sequencing projects of several trypanosomatids (13El-Sayed N.M. Myler P.J. Blandin G. Berriman M. Crabtree J. Aggarwal G. Caler E. Renauld H. Worthey E.A. Hertz-Fowler C. Ghedin E. Peacock C. Bartholomeu D.C. Haas B.J. Tran A.N. Wortman J.R. Alsmark U.C. Angiuoli S. Anupama A. Badger J. Bringaud F. Cadag E. Carlton J.M. Cerqueira G.C. Creasy T. Delcher A.L. Djikeng A. Embley T.M. Hauser C. Ivens A.C. Kummerfeld S.K. Pereira-Leal J.B. Nilsson D. Peterson J. Salzberg S.L. Shallom J. Silva J.C. Sundaram J. Westenberger S. White O. Melville S.E. Donelson J.E. Andersson B. Stuart K.D. Hall N. Science. 2005; 309: 404-409Crossref PubMed Scopus (627) Google Scholar) now offers new opportunities to study autophagy on the molecular level also in these evolutionarily ancient eukaryotes. One of them is Trypanosoma cruzi, the causative agent of the American trypanosomiasis or Chagas disease, whose genome was completed in 2005 (14El-Sayed N.M. Myler P.J. Bartholomeu D.C. Nilsson D. Aggarwal G. Tran A.N. Ghedin E. Worthey E.A. Delcher A.L. Blandin G. Westenberger S.J. Caler E. Cerqueira G.C. Branche C. Haas B. Anupama A. Arner E. Aslund L. Attipoe P. Bontempi E. Bringaud F. Burton P. Cadag E. Campbell D.A. Carrington M. Crabtree J. Darban H. da Silveira J.F. de Jong P. Edwards K. Englund P.T. Fazelina G. Feldblyum T. Ferella M. Frasch A.C. Gull K. Horn D. Hou L. Huang Y. Kindlund E. Klingbeil M. Kluge S. Koo H. Lacerda D. Levin M.J. Lorenzi H. Louie T. Machado C.R. McCulloch R. McKenna A. Mizuno Y. Mottram J.C. Nelson S. Ochaya S. Osoegawa K. Pai G. Parsons M. Pentony M. Pettersson U. Pop M. Ramirez J.L. Rinta J. Robertson L. Salzberg S.L. Sanchez D.O. Seyler A. Sharma R. Shetty J. Simpson A.J. Sisk E. Tammi M.T. Tarleton R. Teixeira S. Van Aken S. Vogt C. Ward P.N. Wickstead B. Wortman J. White O. Fraser C.M. Stuart K.D. Andersson B. Science. 2005; 309: 409-415Crossref PubMed Scopus (1133) Google Scholar). T. cruzi has a complex life cycle, including two replicative forms, the epimastigote present in the gut of the insect vector and the amastigote, an intracellular form in the infected mammal, and two infective, non-replicative forms, the metacyclic trypomastigote in the insect vector and the bloodstream trypomastigote released from infected cells into the blood of the mammal (15De Souza W. Curr. Pharm. Des. 2002; 8: 269-285Crossref PubMed Scopus (188) Google Scholar). Transitions between the hosts as well as changes in the replicative environment are accompanied by extensive metabolic and morphological changes of the parasite. Proteasome and cruzipain were suggested to be involved in these differentiation processes (16Gonzalez J. Ramalho-Pinto F.J. Frevert U. Ghiso J. Tomlinson S. Scharfstein J. Corey E.J. Nussenzweig V. J. Exp. Med. 1996; 184: 1909-1918Crossref PubMed Scopus (98) Google Scholar, 17Cazzulo J.J. Curr. Top. Med. Chem. 2002; 2: 1261-1271Crossref PubMed Scopus (134) Google Scholar); however, the molecular mechanism has not been elucidated. Because differentiation in higher organisms is known to involve autophagy, it was reasonable to hypothesize that autophagy could be involved in T. cruzi differentiation.In this work we report that the T. cruzi genome contains all the major genes of the Atg8 conjugation system (Atg3, Atg4, Atg7, Atg8), whereas the major components of the Atg12-Atg5 conjugation system (Atg12, Atg5, Atg10) are apparently lacking. The two recombinant T. cruzi autophagins (Atg4 proteases) were found to process the two recombinant Atg8 homologues at the Gly residue. Moreover, all the T. cruzi Atg4, and to a lesser extent Atg8 homologues were found to substitute the yeast homologues in functional assays. Apart from starvation, autophagy was also substantially enhanced during differentiation of the parasite, a process that is essential for survival of the parasite.EXPERIMENTAL PROCEDURESParasitesThe different forms of T. cruzi CL Brener cloned stock (18Zingales B. Pereira M.E. Almeida K.A. Umezawa E.S. Nehme N.S. Oliveira R.P. Macedo A. Souto R.P. Mem. Inst. Oswaldo Cruz. 1997; 92: 811-814Crossref PubMed Scopus (49) Google Scholar) were obtained as previously described (19Franke de Cazzulo B.M. Martinez J. North M.J. Coombs G.H. Cazzulo J.J. FEMS Microbiol. Lett. 1994; 124: 81-86Crossref PubMed Scopus (100) Google Scholar). Epimastigotes were routinely grown in brain-heart-tryptose (BHT) medium with 10% heat-inactivated fetal calf serum. For starvation induction, mid-log parasites (50 × 106/ml) were washed twice with PBS (10 mm Na2HPO4, 150 mm NaCl, pH 7.2), resuspended in the same buffer at equal cell concentration, and incubated for 16 h at 28 °C as previously described (20Sylvester D. Krassner S.M. Comp. Biochem. Physiol. B. 1976; 55: 443-447Crossref PubMed Scopus (61) Google Scholar).Bioinformatics Analysis of T. cruzi GenomeBLAST searches were performed against the predicted ATG-related proteins contained in version 3 of the T. cruzi genome sequences (14El-Sayed N.M. Myler P.J. Bartholomeu D.C. Nilsson D. Aggarwal G. Tran A.N. Ghedin E. Worthey E.A. Delcher A.L. Blandin G. Westenberger S.J. Caler E. Cerqueira G.C. Branche C. Haas B. Anupama A. Arner E. Aslund L. Attipoe P. Bontempi E. Bringaud F. Burton P. Cadag E. Campbell D.A. Carrington M. Crabtree J. Darban H. da Silveira J.F. de Jong P. Edwards K. Englund P.T. Fazelina G. Feldblyum T. Ferella M. Frasch A.C. Gull K. Horn D. Hou L. Huang Y. Kindlund E. Klingbeil M. Kluge S. Koo H. Lacerda D. Levin M.J. Lorenzi H. Louie T. Machado C.R. McCulloch R. McKenna A. Mizuno Y. Mottram J.C. Nelson S. Ochaya S. Osoegawa K. Pai G. Parsons M. Pentony M. Pettersson U. Pop M. Ramirez J.L. Rinta J. Robertson L. Salzberg S.L. Sanchez D.O. Seyler A. Sharma R. Shetty J. Simpson A.J. Sisk E. Tammi M.T. Tarleton R. Teixeira S. Van Aken S. Vogt C. Ward P.N. Wickstead B. Wortman J. White O. Fraser C.M. Stuart K.D. Andersson B. Science. 2005; 309: 409-415Crossref PubMed Scopus (1133) Google Scholar). Amino acid sequences corresponding to the C54 family peptidase domain (21Rawlings N.D. Morton F.R. Barrett A.J. Nucleic Acids Res. 2006; 34: 270-272Crossref PubMed Scopus (464) Google Scholar) in ATG4-like genes were used for alignment with ClustalW program, and their score values were taken as percentage of identity between two sequences. A similar analysis was performed for the ATG8-like genes analysis on the basis of the deduced amino acid sequences from the N-terminal Met to the conserved Gly residue at the predicted autophagin cleavage site.Expression and Purification of Recombinant Atg4 and Atg8 ProteinsThe sequences corresponding to TcATG4.1, TcATG4.2, TcATG8.1, and TcATG8.2 were obtained by high fidelity PCR with genomic DNA from T. cruzi epimastigotes as template (GenBank™ accession numbers DQ768297, DQ768298, DQ768299, and DQ768300). DNA was prepared using the conventional proteinase K phenol-chloroform method (22Sambrook J. Fritsch E.F. Maniatis T. 2nd Ed. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989: 9.14-9.19Google Scholar). Primers were designed according to the sequence data obtained from the T. cruzi Genome Project data base search. For TcATG4.1 and TcATG4.2 the primers introduced an NdeI site 5′ to the start codon and a BamHI site 3′ to the stop codon. Similarly, cloning sites for NcoI and BamHI were added to TcATG8.1 and TcATG8.2. The sequences of the primers were as follows: TcATG4.1 sense primer 5′-AACATATGCAAGGTACAATGACG-3′ and reverse primer 5′-AAGGATCCTCAAGAAGAAAAAGTGTCCTC-3′; TcATG4.2 sense primer 5′-AACATATGGAGTGGTTGAAAATTG-3′ and reverse primer 5′-AAGGATCCTACTCCGCCACGTCC-3′; TcATG8.1 sense primer 5′-AACCATGGCGCAAAGAAATTG-3′ and reverse primer 5′-AAGGATCCCACCAAGAACCAAAAGTTG-3′; TcATG8.2 sense primer 5′-AACCATGGCACGCAAATATCGCTACCA-3′ and reverse primer 5′-AAGGATCCGAATTCCGCCGCACAGCCG-3′. Each resulting DNA fragment was gel-purified by Qiaquick columns (Qiagen), cloned into pGEM-T Easy vector (Promega), and completely sequenced (Macrogen, DNA sequencing service, Seoul, Korea). Inserts were liberated with the appropriate restriction enzymes (New England Biolabs) and cloned into the pET-28a(+) bacterial expression vector (Novagen). A His6 tag was added to the N termini of TcATG4.1 and TcATG4.2, whereas 21 amino acid residues including a His6 tag were added to the C termini of TcATG8.1 and TcATG8.2. These constructs were used to transform Escherichia coli BL21(DE3) pLysS cells followed by the induction of protein expression by 0.5 mm isopropyl-β-d-thiogalactopyranoside at 18 °C for 8 h for TcAtg4.1 and TcAtg4.2 and at 28 °C for 4.5 h for TcAtg8.1 and TcAtg8.2, respectively. Cells were then harvested by centrifugation at 3000 × g for 10 min and frozen. After thawing at 4 °C, cells were resuspended in buffer 50 mm Tris-HCl, pH 7.6, 500 mm NaCl, lysed, and sonicated, and cell debris was removed by centrifugation at 20,000 × g for 25 min at 4 °C. Supernatants were directly applied to fast flow Ni-NTA columns (Amersham Biosciences) followed by a washing step with 50 mm Tris-HCl, pH 7.6, 500 mm NaCl. Finally, proteins were eluted with the same buffer containing 150 mm imidazole. Eluates containing the recombinant proteins were pooled, and buffer was changed to TBS (Tris-HCl 50 mm, NaCl 150 mm, pH 7.6) using PD-10 columns (Amersham Biosciences). TcAtg8.1 and TcAtg8.2 were further purified using size exclusion chromatography (Superdex 75; Amersham Biosciences).Production of Polyclonal AntiseraAnti-TcAtg8.1 and anti-TcAtg8.2 antibodies were raised in rabbits by standard protocols using the purified recombinant proteins.In Vitro Cleavage Assay of Recombinant TcAtg8 by Recombinant TcAtg4 ProteinsPurified TcAtg8.1 or TcAtg8.2 (17.2 μg) recombinant proteins were mixed with different amounts of purified recombinant autophagins (750 ng-7.5 pg for autophagin-1 and 1.0-0.01 μg for autophagin-2) in 100 μl of TBS containing 1 mm EDTA and 1 mm 1,4-dithiothreitol. The reaction mixtures containing autophagin-1 were incubated at room temperature for 35 min and those containing autophagin-2 for 18 h. The reactions were stopped by the addition of Laemmli sample buffer and 5 min of boiling. 20 μl of each sample were separated on a 15% SDS-PAGE gel and stained with Coomassie Brilliant Blue. To determine the protease class, the experiments were carried out in the presence of different inhibitors (2 mm iodoacetamide, 2.5 mm N-ethylmaleimide, 100 μm E-64, 39 ng/μl cystatin C, 2.5 mm EDTA, 2 mm o-phenanthroline, or 10 μm pepstatin). To determine the exact cleavage site in TcAtg8 proteins, similar reaction solutions were applied to a C8 reverse phase Aquapore RP-300 Brownlee™ column (Applied Biosystems) equilibrated with 0.1% trifluoroacetic acid. Peptides were eluted with an acetonitrile gradient 0-90% (v/v) in 0.1% trifluoroacetic acid (v/v). The fraction corresponding to the peak that only appeared after treatment with autophagin was freeze-dried. N-terminal amino acid sequence was determined with Procise Protein Sequencing System 492 (Applied Biosystems) following the manufacturer's instructions.Enzymatic AssaysEnzymatic activity of recombinant autophagins was tested using Abz-TFGQ-EDDnp, where Abz is the ortho-aminobenzoic acid fluorescent group, and EDDnp is N-(ethylenediamine)-2,4-dinitrophenylamide, a quenching group (kindly provided by Dr. Luiz Juliano, Sao Paulo, Brazil) (23Melo R.L. Alves L.C. Del Nery E. Juliano L. Juliano M.A. Anal. Biochem. 2001; 293: 71-77Crossref PubMed Scopus (36) Google Scholar). This peptide was designed based on the TcAtg8.1 cleavage site (TFG ↓). Activity measurements were performed in 96-well plates in TBS buffer containing 2 mm 1,4-dithiothreitol, 1 mm EDTA, 1 mm phenylmethylsulfonyl fluoride, and 10 μg/ml substrate (final concentration) at 30 °C. The reactions were started by the addition of 2 μg of either autophagin to the reaction mixture. Fluorescence was measured in a Safire plate reader (Tecan) for 30 min at excitation and emission wavelengths of 320 and 420 nm, respectively.Detection of Autophagin Activity in T. cruzi Cell-free ExtractsExtracts of the four T. cruzi developmental stages were prepared by resuspending the parasites in TBS containing 1 mm 1,4-dithiothreitol, 100 μm E-64, 2 mm phenylmethylsulfonyl fluoride, and 2.5 mm EDTA. Cells were broken by three cycles of freezing at -20 °C and thawing, and the cell-free extracts were obtained by centrifugation at 26,900 × g. Lysates (100 μg of protein) were then added to 17.2 μg of recombinant TcAtg8.1 or TcAtg8.2 in TBS containing 1 mm 1,4-dithiothreitol, 2 mm phenylmethylsulfonyl fluoride, 2 mm EDTA, 2 mm o-phenanthroline, and 10 μm E-64. Where indicated, equivalent reactions were inhibited by 3 mm iodoacetamide. The reactions were incubated for 18 h at room temperature and stopped with Laemmli sample buffer. One-third of each mixture was loaded on a 15% SDS-PAGE gel and transferred to a nitrocellulose membrane (Amersham Biosciences). To detect the cleavage fragments, antisera raised against recombinant TcAtg8.1 or TcAtg8.2 were used as primary antibodies, and alkaline phosphatase-conjugated goat anti-rabbit antibody was used as secondary antibody. The blots were developed using 5-bromo-4-chloro-3-indolyl phosphate p-toluidine salt and nitro blue tetrazolium chloride.Yeast Complementation StudiesBamHI and NotI sites were introduced at the 5′- and the 3′-ends of TcATG4.1, TcATG4.2, TcATG8.1, and TcATG8.2 genes by PCR using the following primers: for TcATG4.1, sense primer 5′-TTAGGATCCATGCAAGGTACAATGACG-3′ and reverse primer 5′-AATGCGGCCGCTCAAGAAAAAGTGTC-3′; for TcATG4.2, sense primer 5′-TTAGGATCCATGGAGTGGTTGAAAATTG-3′ and reverse primer 5′-AATGCGGCCGCTACTCCGCCACGTCC-3′; for TcATG8.1, sense primer 5′-TTAGGATCCATGGCGCCAAAGAAA-3′ and reverse primer 5′-AATGCGGCCGCTCACCAAGAACCAAAAGTTG-3′; for TcATG8.2, sense primer 5′-TTAGGATCCATGGCACGCAAATATC-3′ and reverse primer 5′-AATGCGGCCGCTCAATTCCGCCGCACAGC-3′. Inserts were cloned into the pCM190 vector (24Gari E. Piedrafita L. Aldea M. Herrero E. Yeast. 1997; 13: 837-848Crossref PubMed Scopus (500) Google Scholar) and used to transform atg4Δ and atg8Δ WCG strains of S. cerevisiae (kindly provided by Dr. M. Thumm) by the lithium acetate method (25Ausubel F. Current Protocols in Molecular Biology. John Wiley & Sons, Inc., 1998: 13.7.1-13.7.10Google Scholar). Transformant cultures and wild type control WCG yeast strain were grown in yeast nitrogen base media containing 0.5% ammonium sulfate containing amino acids but lacking uracil until an optical density of 1 at 600 nm was reached. Cells were subsequently split into two aliquots. The first was centrifuged, and cells were resuspended in 1% potassium acetate and grown for additional 7 h to induce starvation response. Fresh growth medium was added to the second aliquot as a control. Cultures were centrifuged, Laemmli sample buffer and glass beads were added to the harvested cells, and the mixture was vortexed vigorously to break cell walls. Yeast proteins were separated on a 10% SDS-PAGE gel and transferred to a nitrocellulose membrane. Immunodetection was performed with anti-(pro)aminopeptidase I primary antibodies (gift from I. V. Sandoval and M. J. Mazón) and horseradish peroxidase-conjugated anti-rabbit secondary antibodies. The antigens were visualized with ECL™ detection system (Amersham Biosciences).Generation of ATG8 Transfectant EpimastigotesHemagglutinin (HA) tags and restriction sites for BamHI and XhoI were introduced at the N termini of TcATG8.1 and TcATG8.2 using the following primers: TcATG8.1 sense primer 5′-TAGGATCCATGTACCCATACGATGTTCCAGATTACGCGCCAAAGAAATTGGAGAGC-3′ and reverse primer 5′-ATCTCGAGTCACCAAGAACCAAAAGTTGCCTC-3′; TcATG8.2 sense primer 5′-TAGGATCCATGTACCCATACGATGTTCCAGATTACGCTCCACGCAAATATCGCTACCAGCG and reverse primer 5′-TTCTCGAGCTAATTCCGCCGCACAGCCGCAC-3′. The corresponding DNA fragments were cloned into the pRibotex plasmid (26Martinez-Calvillo S. Lopez I. Hernandez R. Gene (Amst.). 1997; 199: 71-76Crossref PubMed Scopus (64) Google Scholar) and completely sequenced. Plasmid constructs for TcATG8.1G121A and TcATG8.2G131A were generated by site-directed mutagenesis using the Quik-Change site-directed mutagenesis kit (Stratagene) The following primers were used: for pRibotex-HA-ATG8.1G121A, sense primer 5′-GGTGAGGCAACTTTTGCTTCTTGGTGACTCGAG-3′ and its reverse complement as reverse primer; for p-Ribotex-HA-ATG8.2G131A, sense primer 5′-ATTGAGAGCGCCTTTGCCGGTGCGCTGTGCGG-3′ and its reverse complement as reverse primer. Mutation was verified by automatic DNA sequencing. These four constructs were used to transfect T. cruzi epimastigotes as previously described (27Kosec G. Alvarez V.E. Aguero F. Sanchez D. Dolinar M. Turk B. Turk V. Cazzulo J.J. Mol. Biochem. Parasitol. 2006; 145: 18-28Crossref PubMed Scopus (81) Google Scholar).Immunofluorescence StudiesThe parasites were fixed in 4% paraformaldehyde in PBS for 15 min. Next, the cells were washed twice with PBS, incubated for 10 min with 25 mm ammonium chloride, and washed again twice with PBS. Coverslides were saturated in the blocking buffer (2% bovine serum albumin, 0.1% saponin in PBS) containing 3% goat serum for 30 min and incubated for 2 h with the primary antibody diluted in the blocking buffer. Parasites were then washed with PBS and incubated with the appropriate secondary antibody diluted in the blocking buffer for 1 h. After extensive washing with PBS, coverslides were mounted using Fluor-Save™ reagent (Calbiochem) containing 5 μg/ml DAPI. The following primary antibodies were used: rat anti-HA high affinity monoclonal antibodies (Roche Applied Science) (1/500 dilution), rabbit anti-Atg8.1 polyclonal antibodies (1/700 dilution), and mouse anti-TcSCP (T. cruzi serine carboxypeptidase) polyclonal antibodies as a lysosomal/reservosomal marker (1/1000) (28Parussini F. Garcia M. Mucci J. Aguero F. Sanchez D. Hellman U. Aslund L. Cazzulo J.J. Mol. Biochem. Parasitol. 2003; 131: 11-23Crossref PubMed Scopus (50) Google Scholar). The secondary antibodies used were AlexaFluor 546-conjugated goat anti-rat, AlexaFluor 546-conjugated goat anti-rabbit, AlexaFluor 488-conjugated goat anti-rabbit, and AlexaFluor 546-conjugated goat anti-mouse immunoglobulins (Molecular Probes), all diluted 1/1000. Preparations were analyzed using a fluorescence microscope (Nikon Eclipse E600), and image capture was performed by a Spot RT Slider Model 2.3.1 digital camera (Diagnostic Instruments). The number of Atg8.1 positive vesicles within untransfected T. cruzi epimastigotes was quantified by observing at least 70 cells from three independent experiments.Transmission Electron MicroscopyParasites were fixed for 1 h at room temperature with 2.5% glutaraldehyde in 0.1 m phosphate buffer, pH 7.2, post-fixed for 30 min with 1% OsO4, 1.25% potassium ferrocyanide, and 5 mm CaCl2 in 0.1 m cacodylate buffer, pH 7.2, dehydrated in an ascending ethanol series, and embedded in Epon resin. Ultrathin sections were stained with uranyl acetate and lead citrate and then examined in a Zeiss 902 electron microscope operating at 80 kV.RESULTSIdentification of Candidate Autophagosome Formation Genes in the T. cruzi GenomeThe remarkable conservation of the genes involved in autophagy from yeast to human provides an excellent starting point toward identification of the autophagy-related genes in various organisms. Using BLAST analysis, the T. cruzi genome (14El-Sayed N.M. Myler P.J. Bartholomeu D.C. Nilsson D. Aggarwal G. Tran A.N. Ghedin E. Worthey E.A. Delcher A.L. Blandin G. Westenberger S.J. Caler E. Cerqueira G.C. Branche C. Haas B. Anupama A. Arner E. Aslund L. Attipoe P. Bontempi E. Bringaud F. Burton P. Cadag E. Campbell D.A. Carrington M. Crabtree J. Darban H. da Silveira J.F. de Jong P. Edwards K. Englund P.T. Fazelina G. Feldblyum T. Ferella M. Frasch A.C. Gull K. Horn D. Hou L. Huang Y. Kindlund E. Klingbeil M. Kluge S. Koo H. Lacerda D. Levin M.J. Lorenzi H. Louie T. Machado C.R. McCulloch R. McKenna A. Mizuno Y. Mottram J.C. Nelson S. Ochaya S. Osoegawa K. Pai G. Parsons M. Pentony M. Pettersson U. Pop M. Ramirez J.L. Rinta J. Robertson L. Salzberg S.L. Sanchez D.O. Seyler A. Sharma R. Shetty J. Simpson A.J. Sisk E. Tammi M.T. Tarleton R. Teixeira S. Van Aken S. Vogt C. Ward P.N. Wickstead B. Wortman J. White O. Fraser C.M. Stuart K.D. Andersson B. Science. 2005; 309: 409-415Crossref PubMed Scopus (1133) Google Scholar) was searched for sequences related to the Atg8-PE and Atg12-Atg5 conjugation systems, which represent the two major components of the autophagic machinery.Surprisingly, BLAST analysis failed to identify most of the genes specifically involved in Atg12 conjugation. These included the ATG12 gene encoding an ubiquitin-like protein, which is the most important, as well as the genes encoding two other components of this pathway, ATG5 and ATG10. The only two sequences identified were both homologous to ATG16, which is, however, a downstream gene in the pathway (supplemental Table 1). This further suggests that the Atg-12-Atg5 conjugation system is most likely lacking in T. cruzi or at least significantly diverse from the yeast system.However, all the essential genes involved in the Atg8 conjugation system could be identified in the T. cruzi genome using the same approach (supplemental Table 1). The analysis, thus, revealed single genes homologous to the E1-enzyme Atg7 (34% identity with yeast Atg7) and the E2-enzyme Atg3 (28% identity with yeast Atg3). In contrast, two candidate genes were identified for each of the two early genes of the pathway, the ubiquitin-like modifier Atg8 and its processing protease Atg4. A detailed analysis of the two candidate genes for Atg4 protease (TcATG4.1 and TcATG4.2) revealed that they encode proteins with 30 and 20% identity to the yeast Atg4, respectively. The two genes are 21% identical with each other within the region corresponding to the catalytic domains characteristic for C54 (autophagin) family (supplemental Fig. 1). Both candidate proteases were found to contai
Referência(s)