Location and Function of STIM1 in the Activation of Ca2+ Entry Signals
2008; Elsevier BV; Volume: 283; Issue: 38 Linguagem: Inglês
10.1074/jbc.m802239200
ISSN1083-351X
AutoresThamara Hewavitharana, Xiaoxiang Deng, Youjun Wang, Michael Ritchie, Gannareddy V. Girish, Jonathan Soboloff, Donald L. Gill,
Tópico(s)Ion channel regulation and function
ResumoStore-operated channels (SOCs) mediate Ca2+ entry signals in response to endoplasmic reticulum (ER) Ca2+ depletion in most cells. STIM1 senses decreased ER luminal Ca2+ through its EF-hand Ca2+-binding motif and aggregates in near-plasma membrane (PM) ER junctions to activate PM Orai1, the functional SOC. STIM1 is also present in the PM, although its role there is unknown. STIM1-mediated coupling was examined using the stable EF20 HEK293 cell line expressing the STIM1-D76A/E87A EF-hand mutant (STIM1EF) deficient in Ca2+ binding. EF20 cells were viable despite constitutive Ca2+ entry, allowing study of SOC activation without depleting ER Ca2+. STIM1EF was exclusively in stable near-PM junctions, 3.5-fold larger than formed with STIM1WT. STIMEF-expressing cells had normal ER Ca2+ levels but substantially reduced ER Ca2+ leak. Expression of antiapoptotic Bcl-2 proteins (BCl-2, MCL-1, BCL-XL) were increased 2-fold in EF20 cells, probably reflecting survival of EF20 cells but not accounting for decreased ER Ca2+ leak. Surface biotinylation and streptavidin pull-down of cells expressing STIM1WT or STIM1EF revealed strong PM interactions of both proteins. Although surface expression of STIM1WT was clearly detectable, STIM1EF was undetectable at the cell surface. Thus, the Ca2+ binding-defective STIM1EF mutant exists exclusively in aggregates within near-PM junctions but, unlike STIM1WT, is not trafficked to the PM. Although not inserted in the PM, external application of a monoclonal anti-N-terminal STIM1 antibody blocked constitutive STIMEF-mediated Ca2+ entry, but only in cells expressing endogenous STIM1WT and not in DT40 STIM1 knock-out cells devoid of STIMWT. This suggests that PM-STIM1 may play a regulatory role in SOC activation. Store-operated channels (SOCs) mediate Ca2+ entry signals in response to endoplasmic reticulum (ER) Ca2+ depletion in most cells. STIM1 senses decreased ER luminal Ca2+ through its EF-hand Ca2+-binding motif and aggregates in near-plasma membrane (PM) ER junctions to activate PM Orai1, the functional SOC. STIM1 is also present in the PM, although its role there is unknown. STIM1-mediated coupling was examined using the stable EF20 HEK293 cell line expressing the STIM1-D76A/E87A EF-hand mutant (STIM1EF) deficient in Ca2+ binding. EF20 cells were viable despite constitutive Ca2+ entry, allowing study of SOC activation without depleting ER Ca2+. STIM1EF was exclusively in stable near-PM junctions, 3.5-fold larger than formed with STIM1WT. STIMEF-expressing cells had normal ER Ca2+ levels but substantially reduced ER Ca2+ leak. Expression of antiapoptotic Bcl-2 proteins (BCl-2, MCL-1, BCL-XL) were increased 2-fold in EF20 cells, probably reflecting survival of EF20 cells but not accounting for decreased ER Ca2+ leak. Surface biotinylation and streptavidin pull-down of cells expressing STIM1WT or STIM1EF revealed strong PM interactions of both proteins. Although surface expression of STIM1WT was clearly detectable, STIM1EF was undetectable at the cell surface. Thus, the Ca2+ binding-defective STIM1EF mutant exists exclusively in aggregates within near-PM junctions but, unlike STIM1WT, is not trafficked to the PM. Although not inserted in the PM, external application of a monoclonal anti-N-terminal STIM1 antibody blocked constitutive STIMEF-mediated Ca2+ entry, but only in cells expressing endogenous STIM1WT and not in DT40 STIM1 knock-out cells devoid of STIMWT. This suggests that PM-STIM1 may play a regulatory role in SOC activation. Ca2+ signals control a vast array of cellular functions ranging from short term responses, such as contraction and secretion, to longer term regulation of cell growth and proliferation (1Berridge M.J. Lipp P. Bootman M.D. Nat. Rev. Mol. Cell. Biol. 2000; 1: 11-21Crossref PubMed Scopus (4370) Google Scholar, 2Berridge M.J. Bootman M.D. Roderick H.L. Nat. Rev. Mol. Cell. Biol. 2003; 4: 517-529Crossref PubMed Scopus (4113) Google Scholar). Receptor-induced Ca2+ signals involve two closely coupled components. The initial phase is a rapid, inositol 1,4,5-triphosphate-mediated release of Ca2+ from ER 4The abbreviations used are: ERendoplasmic reticulumPMplasma membraneSOCstore-operated channelWTwild typeHEKhuman embryonic kidneyPIPES1,4-piperazinediethanesulfonic acidTIRFtotal internal reflection fluorescenceInsP3inositol 1,4,5-trisphosphateGFPgreen fluorescent proteinCFPcyan fluorescent protein. 4The abbreviations used are: ERendoplasmic reticulumPMplasma membraneSOCstore-operated channelWTwild typeHEKhuman embryonic kidneyPIPES1,4-piperazinediethanesulfonic acidTIRFtotal internal reflection fluorescenceInsP3inositol 1,4,5-trisphosphateGFPgreen fluorescent proteinCFPcyan fluorescent protein. stores. The depletion of stores triggers Ca2+ entry across the plasma membrane through store-operated channels (SOCs) (3Parekh A.B. Penner R. Physiol. Rev. 1997; 77: 901-930Crossref PubMed Scopus (1285) Google Scholar, 4Venkatachalam K. van Rossum D.B. Patterson R.L. Ma H.T. Gill D.L. Nat. Cell Biol. 2002; 4: E263-E272Crossref PubMed Scopus (335) Google Scholar, 5Parekh A.B. Putney Jr., J.W. Physiol. Rev. 2005; 85: 757-810Crossref PubMed Scopus (1781) Google Scholar). The activation of SOCs is crucial to mediating longer term cytosolic Ca2+ signals and for replenishing intracellular stores (4Venkatachalam K. van Rossum D.B. Patterson R.L. Ma H.T. Gill D.L. Nat. Cell Biol. 2002; 4: E263-E272Crossref PubMed Scopus (335) Google Scholar, 5Parekh A.B. Putney Jr., J.W. Physiol. Rev. 2005; 85: 757-810Crossref PubMed Scopus (1781) Google Scholar).Recent studies have identified the type 1A transmembrane protein, STIM1, as a key mediator of SOC activation (6Roos J. DiGregorio P.J. Yeromin A.V. Ohlsen K. Lioudyno M. Zhang S. Safrina O. Kozak J.A. Wagner S.L. Cahalan M.D. Velicelebi G. Stauderman K.A. J. Cell Biol. 2005; 169: 435-445Crossref PubMed Scopus (1494) Google Scholar, 7Liou J. Kim M.L. Heo W.D. Jones J.T. Myers J.W. Ferrell Jr., J.E. Meyer T. Curr. Biol. 2005; 15: 1235-1241Abstract Full Text Full Text PDF PubMed Scopus (1724) Google Scholar, 8Spassova M.A. Soboloff J. He L.P. Xu W. Dziadek M.A. Gill D.L. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 4040-4045Crossref PubMed Scopus (276) Google Scholar, 9Zhang S.L. Yu Y. Roos J. Kozak J.A. Deerinck T.J. Ellisman M.H. Stauderman K.A. Cahalan M.D. Nature. 2005; 437: 902-905Crossref PubMed Scopus (1117) Google Scholar). The protein is believed to function as the sensor of Ca2+ within stores (6Roos J. DiGregorio P.J. Yeromin A.V. Ohlsen K. Lioudyno M. Zhang S. Safrina O. Kozak J.A. Wagner S.L. Cahalan M.D. Velicelebi G. Stauderman K.A. J. Cell Biol. 2005; 169: 435-445Crossref PubMed Scopus (1494) Google Scholar, 7Liou J. Kim M.L. Heo W.D. Jones J.T. Myers J.W. Ferrell Jr., J.E. Meyer T. Curr. Biol. 2005; 15: 1235-1241Abstract Full Text Full Text PDF PubMed Scopus (1724) Google Scholar). Located in the ER membrane, STIM1 contains an intraluminal N-terminal EF-hand Ca2+ binding domain, which is shown to have low affinity for Ca2+ with a Kd of ∼0.4 mm (10Stathopulos P.B. Li G.Y. Plevin M.J. Ames J.B. Ikura M. J. Biol. Chem. 2006; 281: 35855-35862Abstract Full Text Full Text PDF PubMed Scopus (337) Google Scholar). Upon depletion of Ca2+ from stores, the STIM1 protein in the ER undergoes a profound change from a diffuse labeling pattern across the ER to an aggregated or “punctate” appearance (6Roos J. DiGregorio P.J. Yeromin A.V. Ohlsen K. Lioudyno M. Zhang S. Safrina O. Kozak J.A. Wagner S.L. Cahalan M.D. Velicelebi G. Stauderman K.A. J. Cell Biol. 2005; 169: 435-445Crossref PubMed Scopus (1494) Google Scholar, 7Liou J. Kim M.L. Heo W.D. Jones J.T. Myers J.W. Ferrell Jr., J.E. Meyer T. Curr. Biol. 2005; 15: 1235-1241Abstract Full Text Full Text PDF PubMed Scopus (1724) Google Scholar). The time course of this translocation of STIM1 correlates well with the activation of SOCs (7Liou J. Kim M.L. Heo W.D. Jones J.T. Myers J.W. Ferrell Jr., J.E. Meyer T. Curr. Biol. 2005; 15: 1235-1241Abstract Full Text Full Text PDF PubMed Scopus (1724) Google Scholar, 11Wu M.M. Buchanan J. Luik R.M. Lewis R.S. J. Cell Biol. 2006; 174: 803-813Crossref PubMed Scopus (653) Google Scholar). The aggregated STIM1 appears to be within ER that is closely associated with the plasma membrane (7Liou J. Kim M.L. Heo W.D. Jones J.T. Myers J.W. Ferrell Jr., J.E. Meyer T. Curr. Biol. 2005; 15: 1235-1241Abstract Full Text Full Text PDF PubMed Scopus (1724) Google Scholar, 11Wu M.M. Buchanan J. Luik R.M. Lewis R.S. J. Cell Biol. 2006; 174: 803-813Crossref PubMed Scopus (653) Google Scholar, 12Varnai P. Toth B. Toth D. Hunyady L. Balla T. J. Biol. Chem. 2007; 282: 29678-29690Abstract Full Text Full Text PDF PubMed Scopus (210) Google Scholar). It was reported that STIM1 may become inserted into the PM following store depletion and hence activate SOCs (9Zhang S.L. Yu Y. Roos J. Kozak J.A. Deerinck T.J. Ellisman M.H. Stauderman K.A. Cahalan M.D. Nature. 2005; 437: 902-905Crossref PubMed Scopus (1117) Google Scholar). However, other studies have not confirmed this insertional model (7Liou J. Kim M.L. Heo W.D. Jones J.T. Myers J.W. Ferrell Jr., J.E. Meyer T. Curr. Biol. 2005; 15: 1235-1241Abstract Full Text Full Text PDF PubMed Scopus (1724) Google Scholar, 11Wu M.M. Buchanan J. Luik R.M. Lewis R.S. J. Cell Biol. 2006; 174: 803-813Crossref PubMed Scopus (653) Google Scholar, 13Soboloff J. Spassova M.A. Hewavitharana T. He L.P. Xu W. Johnstone L.S. Dziadek M.A. Gill D.L. Curr. Biol. 2006; 16: 1465-1470Abstract Full Text Full Text PDF PubMed Scopus (207) Google Scholar, 14Mercer J.C. Dehaven W.I. Smyth J.T. Wedel B. Boyles R.R. Bird G.S. Putney Jr., J.W. J. Biol. Chem. 2006; 281: 24979-24990Abstract Full Text Full Text PDF PubMed Scopus (470) Google Scholar). Despite this, there is good evidence that STIM1 translocates within the ER into junctional domains that are juxtaposed with the PM and close enough (within 10-25 nm) that direct interactions may occur with the plasma membrane (7Liou J. Kim M.L. Heo W.D. Jones J.T. Myers J.W. Ferrell Jr., J.E. Meyer T. Curr. Biol. 2005; 15: 1235-1241Abstract Full Text Full Text PDF PubMed Scopus (1724) Google Scholar, 11Wu M.M. Buchanan J. Luik R.M. Lewis R.S. J. Cell Biol. 2006; 174: 803-813Crossref PubMed Scopus (653) Google Scholar, 12Varnai P. Toth B. Toth D. Hunyady L. Balla T. J. Biol. Chem. 2007; 282: 29678-29690Abstract Full Text Full Text PDF PubMed Scopus (210) Google Scholar). Further screens of gene products involved in the store-operated Ca2+ entry pathway revealed the role of the Orai1 (or CRACM1) protein (15Feske S. Gwack Y. Prakriya M. Srikanth S. Puppel S.H. Tanasa B. Hogan P.G. Lewis R.S. Daly M. Rao A. Nature. 2006; 441: 179-185Crossref PubMed Scopus (1820) Google Scholar, 16Vig M. Peinelt C. Beck A. Koomoa D.L. Rabah D. Koblan-Huberson M. Kraft S. Turner H. Fleig A. Penner R. Kinet J.P. Science. 2006; 312: 1220-1223Crossref PubMed Scopus (1137) Google Scholar, 17Zhang S.L. Yeromin A.V. Zhang X.H. Yu Y. Safrina O. Penna A. Roos J. Stauderman K.A. Cahalan M.D. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 9357-9362Crossref PubMed Scopus (736) Google Scholar). Orai1 is a tetraspanning membrane protein localized to the plasma membrane and appears to be the functional store-operated channel moiety (18Yeromin A.V. Zhang S.L. Jiang W. Yu Y. Safrina O. Cahalan M.D. Nature. 2006; 443: 226-229Crossref PubMed Scopus (686) Google Scholar, 19Prakriya M. Feske S. Gwack Y. Srikanth S. Rao A. Hogan P.G. Nature. 2006; 443: 230-233Crossref PubMed Scopus (1090) Google Scholar, 20Vig M. Beck A. Billingsley J.M. Lis A. Parvez S. Peinelt C. Koomoa D.L. Soboloff J. Gill D.L. Fleig A. Kinet J.P. Penner R. Curr. Biol. 2006; 16: 2073-2079Abstract Full Text Full Text PDF PubMed Scopus (482) Google Scholar). Orai1 coexpressed with STIM1 reconstitutes massive levels of the highly Ca2+-selective Ca2+ release-activated Ca2+ current (14Mercer J.C. Dehaven W.I. Smyth J.T. Wedel B. Boyles R.R. Bird G.S. Putney Jr., J.W. J. Biol. Chem. 2006; 281: 24979-24990Abstract Full Text Full Text PDF PubMed Scopus (470) Google Scholar, 17Zhang S.L. Yeromin A.V. Zhang X.H. Yu Y. Safrina O. Penna A. Roos J. Stauderman K.A. Cahalan M.D. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 9357-9362Crossref PubMed Scopus (736) Google Scholar, 21Peinelt C. Vig M. Koomoa D.L. Beck A. Nadler M.J. Koblan-Huberson M. Lis A. Fleig A. Penner R. Kinet J.P. Nat. Cell Biol. 2006; 8: 771-773Crossref PubMed Scopus (509) Google Scholar, 22Soboloff J. Spassova M.A. Tang X.D. Hewavitharana T. Xu W. Gill D.L. J. Biol. Chem. 2006; 281: 20661-20665Abstract Full Text Full Text PDF PubMed Scopus (481) Google Scholar), the hallmark of store-operated channel function (3Parekh A.B. Penner R. Physiol. Rev. 1997; 77: 901-930Crossref PubMed Scopus (1285) Google Scholar, 4Venkatachalam K. van Rossum D.B. Patterson R.L. Ma H.T. Gill D.L. Nat. Cell Biol. 2002; 4: E263-E272Crossref PubMed Scopus (335) Google Scholar, 5Parekh A.B. Putney Jr., J.W. Physiol. Rev. 2005; 85: 757-810Crossref PubMed Scopus (1781) Google Scholar). Indeed, mutation of the Orai1 protein at key acidic residues alters the ion selectivity of the channel (18Yeromin A.V. Zhang S.L. Jiang W. Yu Y. Safrina O. Cahalan M.D. Nature. 2006; 443: 226-229Crossref PubMed Scopus (686) Google Scholar, 19Prakriya M. Feske S. Gwack Y. Srikanth S. Rao A. Hogan P.G. Nature. 2006; 443: 230-233Crossref PubMed Scopus (1090) Google Scholar, 20Vig M. Beck A. Billingsley J.M. Lis A. Parvez S. Peinelt C. Koomoa D.L. Soboloff J. Gill D.L. Fleig A. Kinet J.P. Penner R. Curr. Biol. 2006; 16: 2073-2079Abstract Full Text Full Text PDF PubMed Scopus (482) Google Scholar), indicating that Orai1 is the pore-forming entity in SOCs. Orai and STIM appear to co-migrate, possibly with other coupling proteins, to form junctional ER-PM coupling domains that are the functional sites of store-operated Ca2+ entry (11Wu M.M. Buchanan J. Luik R.M. Lewis R.S. J. Cell Biol. 2006; 174: 803-813Crossref PubMed Scopus (653) Google Scholar, 12Varnai P. Toth B. Toth D. Hunyady L. Balla T. J. Biol. Chem. 2007; 282: 29678-29690Abstract Full Text Full Text PDF PubMed Scopus (210) Google Scholar).Although Orai1 appears to be exclusively located in the PM, STIM1 is not exclusive to the ER. Indeed, STIM1 was originally discovered through a novel screening strategy to identify extracellularly expressed PM proteins in stromal cells promoting the proliferation of pre-B cells in culture (23Oritani K. Kincade P.W. J. Cell Biol. 1996; 134: 771-782Crossref PubMed Scopus (161) Google Scholar). STIM1 was characterized as a plasma membrane protein involved in controlling cell growth (24Williams R.T. Senior P.V. Van Stekelenburg L. Layton J.E. Smith P.J. Dziadek M.A. Biochim. Biophys. Acta. 2002; 1596: 131-137Crossref PubMed Scopus (123) Google Scholar, 25Williams R.T. Manji S.S. Parker N.J. Hancock M.S. Van Stekelenburg L. Eid J.P. Senior P.V. Kazenwadel J.S. Shandala T. Saint R. Smith P.J. Dziadek M.A. Biochem. J. 2001; 357: 673-685Crossref PubMed Scopus (263) Google Scholar, 26Manji S.S. Parker N.J. Williams R.T. Van Stekelenburg L. Pearson R.B. Dziadek M.A. Smith P.J. Biochim. Biophys. Acta. 2000; 1481: 147-155Crossref PubMed Scopus (200) Google Scholar, 27Dziadek M.A. Johnstone L.S. Cell Calcium. 2007; 42: 123-132Crossref PubMed Scopus (87) Google Scholar). It was estimated in myeloid cell lines that as much as 25% of total STIM1 was expressed on the cell surface with its N terminus accessible to the cell exterior (26Manji S.S. Parker N.J. Williams R.T. Van Stekelenburg L. Pearson R.B. Dziadek M.A. Smith P.J. Biochim. Biophys. Acta. 2000; 1481: 147-155Crossref PubMed Scopus (200) Google Scholar), although clearly the expression of STIM1 in the ER predominates over plasma membrane expression (13Soboloff J. Spassova M.A. Hewavitharana T. He L.P. Xu W. Johnstone L.S. Dziadek M.A. Gill D.L. Curr. Biol. 2006; 16: 1465-1470Abstract Full Text Full Text PDF PubMed Scopus (207) Google Scholar, 26Manji S.S. Parker N.J. Williams R.T. Van Stekelenburg L. Pearson R.B. Dziadek M.A. Smith P.J. Biochim. Biophys. Acta. 2000; 1481: 147-155Crossref PubMed Scopus (200) Google Scholar). In the current study, we have addressed the question of the location, translocation, and function of STIM1 by generating stable cell lines expressing STIM1 with mutated acidic residues to prevent Ca2+ binding in the EF-hand domain. Earlier studies revealed that such mutants of STIM1 could constitutively activate store-operated Ca2+ entry, mimicking the store-depleted condition (7Liou J. Kim M.L. Heo W.D. Jones J.T. Myers J.W. Ferrell Jr., J.E. Meyer T. Curr. Biol. 2005; 15: 1235-1241Abstract Full Text Full Text PDF PubMed Scopus (1724) Google Scholar, 8Spassova M.A. Soboloff J. He L.P. Xu W. Dziadek M.A. Gill D.L. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 4040-4045Crossref PubMed Scopus (276) Google Scholar, 9Zhang S.L. Yu Y. Roos J. Kozak J.A. Deerinck T.J. Ellisman M.H. Stauderman K.A. Cahalan M.D. Nature. 2005; 437: 902-905Crossref PubMed Scopus (1117) Google Scholar). Examination of the function of the EF-hand-mutated STIM1 molecule is particularly important in these cells, since the activation process for SOCs can be studied under conditions in which ER Ca2+ stores are not depleted, thus bypassing the severe stress effects of depleting Ca2+ from within the ER (1Berridge M.J. Lipp P. Bootman M.D. Nat. Rev. Mol. Cell. Biol. 2000; 1: 11-21Crossref PubMed Scopus (4370) Google Scholar, 28Berridge M.J. Cell Calcium. 2002; 32: 235-249Crossref PubMed Scopus (775) Google Scholar). The establishment of cell lines with constitutively active STIM1 was remarkable, since the prolonged entry of Ca2+ would have been predicted to be highly damaging to the cells. Our results reveal that important compensatory Ca2+ homeostatic mechanisms probably counteract the increased entry, and we document that one such compensation is a turn-off of the powerful but enigmatic ER Ca2+ leak pathway. We establish that, unlike wild type STIM1, the STIM1 EF-hand mutant is exclusively expressed in the ER and can activate plasma membrane Orai1 without becoming inserted into the plasma membrane. Although not inserted in the membrane during store depletion, the STIM1 mutant undergoes a strong interaction with the plasma membrane. In contrast to the EF-hand mutant, wild type STIM1 is clearly expressed in the plasma membrane as well as ER. Although plasma membrane STIM1 may not be essential for Orai1 channel activation, the results indicate that it may play a role in regulating the activation of store-operated channels.EXPERIMENTAL PROCEDURESDNA Constructs and Transfections—Wild type (WT) human STIM1 and STIM2 were subcloned into pIRESneo (Clontech, Palo Alto, CA) as previously described (25Williams R.T. Manji S.S. Parker N.J. Hancock M.S. Van Stekelenburg L. Eid J.P. Senior P.V. Kazenwadel J.S. Shandala T. Saint R. Smith P.J. Dziadek M.A. Biochem. J. 2001; 357: 673-685Crossref PubMed Scopus (263) Google Scholar). Human STIM1-D76A/E87A mutations were introduced using the QuikChange site-directed mutagenesis kit (Stratagene) and confirmed by sequencing. Orai1 knockdown was achieved using stealth small interfering RNA (Invitrogen) targeting position 901 (UGGUGCCCUUCGGCCUGAUCUUUAU) or 1381 (CCUCCUCCUGUCCUGUCCGUCUCAA). A scrambled RNA sequence (UGGCCUCCUGGCCGUUAUCUGUUAU) was used as a control. DNA constructs and RNA sequences were introduced by electroporation using the Gene Pulser II electroporation system (Bio-Rad) at 350 V, 960 microfarads, and infinite resistance, followed by 48 h in culture.Development of Stable Cell Lines—Human embryonic kidney 293 (HEK293) cells were maintained as previously described (13Soboloff J. Spassova M.A. Hewavitharana T. He L.P. Xu W. Johnstone L.S. Dziadek M.A. Gill D.L. Curr. Biol. 2006; 16: 1465-1470Abstract Full Text Full Text PDF PubMed Scopus (207) Google Scholar). HEK293 stable cell lines were generated by electroporation of the above described human STIM2 or STIM1 (WT or D76A/E87A) constructs, followed by selection with G418 and cloning as previously described (12Varnai P. Toth B. Toth D. Hunyady L. Balla T. J. Biol. Chem. 2007; 282: 29678-29690Abstract Full Text Full Text PDF PubMed Scopus (210) Google Scholar). Positive clones were selected based upon STIM1 expression and the level of store-operated Ca2+ entry.Intracellular Ca2+ Measurements—Ratiometric imaging of intracellular Ca2+ using fura-2 was as previously described (29Soboloff J. Spassova M.A. Xu W. He L.P. Cuesta N. Gill D.L. J. Biol. Chem. 2005; 280: 39786-39794Abstract Full Text Full Text PDF PubMed Scopus (142) Google Scholar). Cells grown on coverslips were placed in cation-safe solution (107 mm NaCl, 7.2 mm KCl, 1.2 mm MgCl2, 11.5 mm glucose, 20 mm Hepes-NaOH, pH 7.2) and loaded with fura-2/AM (2 μm) for 30 min at 20 °C. Cells were washed, and dye was allowed to de-esterify for a minimum of 30 min at 20 °C. Approximately 95% of the dye was confined to the cytoplasm, as determined by the signal remaining after saponin permeabilization (30Ma H.-T. Patterson R.L. van Rossum D.B. Birnbaumer L. Mikoshiba K. Gill D.L. Science. 2000; 287: 1647-1651Crossref PubMed Scopus (531) Google Scholar). Ca2+ measurements were made using an InCyt dual wavelength fluorescence imaging system (Intracellular Imaging Inc.). Fluorescence emission at 505 nm was monitored with excitation at 340 and 380 nm; intracellular Ca2+ measurements are shown as 340/380 nm ratios obtained from groups (35-45 cells each) of single cells. Resting intracellular free Ca2+ concentration was determined based on ratiometric measurements of cells maintained in 1 mm Ca2+ and calculated according to the following formula of Grynkiewcz et al. (31Grynkiewicz G. Poenie M. Tsien R.Y. J. Biol. Chem. 1985; 261: 3440-3450Abstract Full Text PDF Google Scholar), [Ca2+]i=Kd×(Fmin/Fmax)×(R-Rmin)/(Rmax-R)(Eq. 1) where R represents the ratio of the fluorescence intensities measured at 340 and 380 nm during the experiments, and F is the fluorescence intensity measured at 505 nm. Rmin, Rmax, Fmin, and Fmax were determined from in situ calibration of unlysed cells using 40 μm ionomycin in the absence (Rmin and Fmin; 10 mm EGTA) and presence (Rmax and Fmax) of Ca2+. Kd (135 nm) is the dissociation constant for fura-2 at room temperature. Measurements shown as means ± S.E. of traces from ∼30-40 individual cells and are representative of a minimum of three and in most cases a larger number of independent experiments.Luminal ER Ca2+ Measurements—CFP (436Ex/480Em) and FRETraw (436Ex/535Em) were imaged at 5 mHz in HEK293 cells transfected with the ER-targeted cameleon, D1ER (32Palmer A.E. Jin C. Reed J.C. Tsien R.Y. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 17404-17409Crossref PubMed Scopus (516) Google Scholar), using a Leica DMI 6000B fluorescence microscope controlled by Slide-Book 4.2 software (Olympus). Two-channel corrected FRET was calculated based on the formula, FRETc=(Fraw-Fd/Dd*FCFP)/FCFP(Eq. 2) where FRETc represents the corrected total amount of energy transfer, Fraw represents measured fluorescence measured through the CFP/YFP ET filter cube, FCFP represents measured CFP fluorescence, and Fd/Dd represents measured bleed-through of CFP through the YFP filter (0.592248). In order to determine absolute Ca2+ concentration, maximum FRETc (Rmax) was measured via the addition of 10 mm Ca2+ and 1 mm Mg2+/ATP to digitonin (25 μm)-permeabilized cells, whereas minimum FRETc was measured upon the subsequent addition of 3 μm Br-A23187 with 5 mm EGTA (33Palmer A.E. Tsien R.Y. Nat. Protoc. 2006; 1: 1057-1065Crossref PubMed Scopus (357) Google Scholar). ER Ca2+ content was then determined based on the following formula of Palmer and Tsien (33Palmer A.E. Tsien R.Y. Nat. Protoc. 2006; 1: 1057-1065Crossref PubMed Scopus (357) Google Scholar), &x0025;ΔR=(Rmax1[Ca2+]n1/(Kd1'n1+[Ca+2]n1))+(Rmax2[Ca2+]n2/(Kd2'n2+[Ca2+]n2))(Eq. 3) in which %ΔR = (R - Rmin)/Rmax - Rmin)*100, K′d1 = 0.58, K′d2 = 56.46, Rmax1 = 28, Rmax2 = 72, n1 = 1.18, and n2 = 1.67. Immunoprecipitation and Cell Lysis—Cells were lysed in Nonidet P-40 lysis buffer (1% (w/v) Nonidet P-40, 150 mm NaCl, 50 mm Tris-HCl, pH 8.0, with protease inhibitors), cleared by centrifugation, and normalized for protein content. For immunoprecipitation, lysates (200 μg) were mixed with 50 μl of a 50% protein G slurry (Calbiochem) that was precoated for 1 h with the indicated antibodies (5 μl/sample). The samples were incubated for 2 h at 4 °C with rotation and were then washed three times with lysis buffer. After the final wash, beads were resuspended in gel-loading buffer and boiled for 5 min.Surface Biotinylation—Biotinylation studies were performed on HEK293 cells using NHS-LC-Biotin (1 mg/ml; Pierce) for 30 min. Unbound biotin was quenched with Tris (75 mm) prior to lysis. Biotinylated proteins were either run on gels as whole lysates (15 μg/lane) or separated from unbiotinylated proteins using streptavidin-coated beads (100 μg/lane). STIM1 and STIM2 were detected by Western analysis using an anti-STIM1 monoclonal antibody that cross-reacts with STIM2 (BD Biosciences) (25Williams R.T. Manji S.S. Parker N.J. Hancock M.S. Van Stekelenburg L. Eid J.P. Senior P.V. Kazenwadel J.S. Shandala T. Saint R. Smith P.J. Dziadek M.A. Biochem. J. 2001; 357: 673-685Crossref PubMed Scopus (263) Google Scholar). The samples were incubated for 2 h at 4 °C with rotation and then washed three times with lysis buffer, resuspended in gel-loading buffer, and boiled for 5 min before loading on gels.Western Blot and Flow Cytometry—For Western blots, proteins were resolved on 6% SDS-polyacrylamide gels, transferred to nitrocellulose paper, and analyzed with the indicated antibodies, as previously described (29Soboloff J. Spassova M.A. Xu W. He L.P. Cuesta N. Gill D.L. J. Biol. Chem. 2005; 280: 39786-39794Abstract Full Text Full Text PDF PubMed Scopus (142) Google Scholar). For flow cytometry, HEK293 cell lines were labeled with anti-STIM1 (BD Biosciences), followed by phycoerythrin-conjugated anti-mouse IgG (Invitrogen). Cells were analyzed on a FACScan (BD Biosciences), using Cellquest software (BD Biosciences). Results are histograms based upon 10,000 events/sample. Each experiment was repeated at least three times.Immunocytochemistry—HEK293 cells were transfected as described and plated onto 10-mm circular coverslips in OPTI medium supplemented with 10% fetal bovine serum, as previously described (13Soboloff J. Spassova M.A. Hewavitharana T. He L.P. Xu W. Johnstone L.S. Dziadek M.A. Gill D.L. Curr. Biol. 2006; 16: 1465-1470Abstract Full Text Full Text PDF PubMed Scopus (207) Google Scholar). Fixation and permeabilization were achieved by incubation (10 min) with 3.7% formaldehyde followed by permeabilization in the following buffer: 100 mm PIPES, 1 mm EGTA, 0.1% Triton X-100, 4% polyethylene glycol 8000, pH 6.9, with KOH. After blocking in bovine serum albumin (0.5%), cells were blocked with BSA and labeled with affinity-purified rabbit anti-STIM1 CT (1:50 dilution), followed by Alexa Fluor 488-conjugated goat anti-rabbit IgG (1:50 dilution; Invitrogen). For nonpermeabilized cells, labeling with antibodies was undertaken on live cells, followed by fixation with formaldehyde. Fixed and labeled cells were mounted onto slides in Cytoseal 60 (VWR) and examined with a Zeiss LSM410 confocal laser-scanning microscope, using a ×63/numerical aperture 1.4 objective.TIRF Microscopy—HEK293 cells were transfected with YFP-STIM1-WT or YFP-STIM1-D76A and plated onto 25-mm circular coverslips in OPTI medium supplemented with 10% fetal bovine serum, as previously described (13Soboloff J. Spassova M.A. Hewavitharana T. He L.P. Xu W. Johnstone L.S. Dziadek M.A. Gill D.L. Curr. Biol. 2006; 16: 1465-1470Abstract Full Text Full Text PDF PubMed Scopus (207) Google Scholar). On the day of the experiment, cells were transferred to cation-safe solution. The images were recorded on a high resolution Hamamatsu ORCA-ER camera using a through-the-lens ×60 TIRF objective in a Nikon Eclipse TE2000U microscope while exciting with a 488-nm argon ion laser set to TIRF mode. Store depletion was achieved with the addition of thapsigargin (2 μm) while recording. Image analysis of puncta was undertaken using Image J and SlideBook 4.2 (Olympus). Background was subtracted from the raw image, and noise (less than 10 consecutive pixels) was filtered out. Images were imported into SlideBook, and the size and number of puncta were measured using the mask function. The density of puncta was obtained by dividing the number of puncta by the size of the cell. Relative cell size was measured from cell profile using Image J.Quantitative PCR—Real time quantitative PCR was performed in a model 7300 sequence detector (Applied Biosystems) using Superscript II Platinum SYBR Green one-step quantitative reverse transcription-PCR kits, and the 7300 System SDS Software. Reaction mixtures contained reverse transcriptase and TaqDNA polymerase in a single enzyme mix with SYBR Green I fluorescent dye, ROX as reference dye, 30 ng of total RNA, and gene-specific primers. Both cDNA synthesis and PCR were performed in a single tube. Total RNA was isolated using TRIzol reagent (34Chomczynski P. BioTechniques. 1993; 15: 532-537PubMed Google Scholar). Primers (forward and reverse) designed using Primer Express 2.0 software (Applied Biosystems) were as follows: Bcl-2, TGCGGCCTCTGTTTGATTTC and GGGCCAAACTGAGCAGAGTCT; BCL-XL, CCATGGCAGCAGTAAAGCAA and CCGGTACCGCAGTTCAAACT; MCL-1, GCATCGAACCATTAGCAGAAAGT and GCCAGTCCCGTTTTGTCCTT; BIM, GCCCAGCACCCATGAGTT and GCCTGGCAAGGAGGACTTG; glyceraldehyde-3-phosphate dehydrogenase, ATGGAAATCCCATCACCATCTT and CGCCCCACTTGATTTTGG. The standard program included one cycle of 30 min at 50 °C for synthesis of cDNA, and amplification included 40 cycles of two steps, each comprising heating to 95 °C and heating to 60 °C, each 0.15 min and 1 min, respectivel
Referência(s)