Enhanced Mitochondrial DNA Repair and Cellular Survival after Oxidative Stress by Targeting the Human 8-Oxoguanine Glycosylase Repair Enzyme to Mitochondria
2000; Elsevier BV; Volume: 275; Issue: 48 Linguagem: Inglês
10.1074/jbc.m000831200
ISSN1083-351X
AutoresAllison W. Dobson, Yi Xu, Mark R. Kelley, Susan P. LeDoux, Glenn L. Wilson,
Tópico(s)Metabolism and Genetic Disorders
ResumoOxidative damage to mitochondrial DNA (mtDNA) has been implicated as a causative factor in many disease processes and in aging. We have recently discovered that different cell types vary in their capacity to repair this damage, and this variability correlates with their ability to withstand oxidative stress. To explore strategies to enhance repair of oxidative lesions in mtDNA, we have constructed a vector containing a mitochondrial transport sequence upstream of the sequence for human 8-oxoguanine DNA glycosylase. This enzyme is the glycosylase/AP lyase that participates in repair of purine lesions, such as 8-oxoguanine. Western blot analysis confirmed that this recombinant protein was targeted to mitochondria. Enzyme activity assays showed that mitochondrial extracts from cells transfected with the construct had increased enzyme activity compared with cells transfected with vector only, whereas nuclear enzyme activity was not changed. Repair assays showed that there was enhanced repair of oxidative lesions in mtDNA. Additional studies revealed that this augmented repair led to enhanced cellular viability as determined by reduction of the tetrazolium compound to formazan, trypan blue dye exclusion, and clonogenic assays. Therefore, targeting of DNA repair enzymes to mitochondria may be a viable approach for the protection of cells against some of the deleterious effects of oxidative stress. Oxidative damage to mitochondrial DNA (mtDNA) has been implicated as a causative factor in many disease processes and in aging. We have recently discovered that different cell types vary in their capacity to repair this damage, and this variability correlates with their ability to withstand oxidative stress. To explore strategies to enhance repair of oxidative lesions in mtDNA, we have constructed a vector containing a mitochondrial transport sequence upstream of the sequence for human 8-oxoguanine DNA glycosylase. This enzyme is the glycosylase/AP lyase that participates in repair of purine lesions, such as 8-oxoguanine. Western blot analysis confirmed that this recombinant protein was targeted to mitochondria. Enzyme activity assays showed that mitochondrial extracts from cells transfected with the construct had increased enzyme activity compared with cells transfected with vector only, whereas nuclear enzyme activity was not changed. Repair assays showed that there was enhanced repair of oxidative lesions in mtDNA. Additional studies revealed that this augmented repair led to enhanced cellular viability as determined by reduction of the tetrazolium compound to formazan, trypan blue dye exclusion, and clonogenic assays. Therefore, targeting of DNA repair enzymes to mitochondria may be a viable approach for the protection of cells against some of the deleterious effects of oxidative stress. mitochondrial DNA 8-oxoguanine DNA glycosylase human 8-oxoguanine DNA glycosylase polymerase chain reaction mitochondrial targeting sequence apurinic/apyrimidinic manganese superoxide dismutase trans-epoxysuccinyl-l-leucyl-amido(4- guanidino)butane A variety of diseases have been associated with alterations in mitochondrial DNA (mtDNA)1including diabetes mellitus (1Rotig A. Bonnefont J.P. Munnich A. Diabetes Metab. 1996; 22: 291-298PubMed Google Scholar, 2Vialettes B. Flucklinger P. Bendahan D. Diabetes Metab. 1997; Suppl. 23: 52-56Google Scholar), Alzheimer's disease (3Hutchin T. Cortopassi G. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 6892-6895Crossref PubMed Scopus (174) Google Scholar, 4Davis R.E. Miller S. Herrnstadt C. Ghosh S.S. Fahy E. Shinobu L.A. Galasko D. Thal L.J. Beal M.F. Howell N. Parker Jr., W.D. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 4526-4531Crossref PubMed Scopus (315) Google Scholar, 5Mecocci P. MacGarvey U. Beal M.F. Ann. Neurol. 1994; 36: 747-751Crossref PubMed Scopus (930) Google Scholar, 6Corral-Debrinski M. Horton T. Lott M.T. Shoffner J.M. McKee A.C. Beal M.F. Graham B.H. Wallace D.C. Genomics. 1994; 23: 471-476Crossref PubMed Scopus (254) Google Scholar), and Parkinson's disease (7Schapira A.H. Biochim. Biophys. Acta. 1999; 1410: 159-170Crossref PubMed Scopus (285) Google Scholar, 8Beal M.F. Ann. Neurol. 1995; 38: 357-366Crossref PubMed Scopus (1246) Google Scholar, 9Bandmann O. Sweeney M.G. Daniel S.E. Marsden C.D. Wood N.W. J. Neurol. 1997; 244: 262-265Crossref PubMed Scopus (48) Google Scholar, 10Schnopp N.M. Kosel S. Egensperger R. Graeber M.B. Clin. Neuropathol. 1996; 15: 348-352PubMed Google Scholar, 11Wooten G.F. Currie L.J. Bennett J.P. Harrison M.B. Trugman J.M. Parker W.D. Ann. Neurol. 1997; 41: 265-268Crossref PubMed Scopus (88) Google Scholar). Additionally, deleterious phenotypes associated with the normal process of aging have been correlated with these lesions (12Ozawa T. Physiol. Rev. 1997; 77: 425-464Crossref PubMed Scopus (290) Google Scholar, 13Papa S. Skulachev V.P. Mol. Cell. Biochem. 1997; 174: 305-319Crossref PubMed Scopus (435) Google Scholar, 14Schon E.A. Bonilla E. Dimauro S. J. Bioenerg. Biomembr. 1997; 29: 131-149Crossref PubMed Scopus (381) Google Scholar, 15Shigenaga M.K. Hagen T.M. Ames B.N. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 10771-10778Crossref PubMed Scopus (1807) Google Scholar, 16Hudson E.K. Hogue B.A. Souza-Pinto N.C. Croteau D.L. Anson R.M. Bohr V.A. Hansford R.G. Free Radic. Res. 1998; 29: 573-579Crossref PubMed Scopus (135) Google Scholar, 17Tanhauser S.M. Laipis P.J. J. Biol. Chem. 1995; 270: 24769-24775Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar). Because errors in mtDNA lead to erroneous translation of important subunits of the electron transport chain, the result can be a deficiency in the production of ATP along with the “leak” of electrons from the various protein complexes involved in oxidative phosphorylation. These electrons cause damage to proteins, lipids, and DNA through formation of intermediate reactive oxygen species. As more damage is sustained, the mitochondria become more dysfunctional, and a self-propagating detrimental cycle ultimately ensues. Finally, if and when sufficient damage is produced, an apoptotic program can be initiated in the affected cell, or the cell may die by necrosis (13Papa S. Skulachev V.P. Mol. Cell. Biochem. 1997; 174: 305-319Crossref PubMed Scopus (435) Google Scholar, 18Singh K.K. Russell J. Sigala B. Zhang Y. Williams J. Keshav K.F. Oncogene. 1999; 18: 6641-6646Crossref PubMed Scopus (161) Google Scholar, 19Green D. Kroemer G. Trends Cell Biol. 1998; 8: 267-271Abstract Full Text Full Text PDF PubMed Scopus (702) Google Scholar). Mitochondrial DNA is particularly susceptible to damage by reactive oxygen species because of its close proximity to the electron transport chain and its lack of protective histones. Previous studies by our laboratory and others (20Yakes F.M. Van Houten B. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 514-519Crossref PubMed Scopus (1413) Google Scholar, 21Zastawny T.H. Dabrowska M. Jaskolski T. Klimarczyk M. Kulinski L. Koszela A. Szczesniewicz M. Sliwinska M. Witkowski P. Olinski R. Free Radic. Biol. Med. 1998; 24: 722-725Crossref PubMed Scopus (59) Google Scholar, 22Croteau D.L. Bohr V.A. J. Biol. Chem. 1997; 272: 25409-25412Abstract Full Text Full Text PDF PubMed Scopus (413) Google Scholar, 23Wilson G.L. Patton N.J. LeDoux S.P. Diabetes. 1997; 46: 1291-1295Crossref PubMed Google Scholar, 24LeDoux S.P. Driggers W.J. Hollensworth B.S. Wilson G.L. Mutat. Res. 1999; 434: 149-159Crossref PubMed Scopus (85) Google Scholar) show that this DNA is considerably more vulnerable to exogenously generated damage than is nuclear DNA. Oxidative damage to mtDNA can be repaired efficiently by some cell types (24LeDoux S.P. Driggers W.J. Hollensworth B.S. Wilson G.L. Mutat. Res. 1999; 434: 149-159Crossref PubMed Scopus (85) Google Scholar, 25Driggers W.J. LeDoux S.P. Wilson G.L. J. Biol. Chem. 1993; 268: 22042-22045Abstract Full Text PDF PubMed Google Scholar, 26Shen C.C. Wertelecki W. Driggers W.J. LeDoux S.P. Wilson G.L. Mutat. Res. 1995; 337: 19-23Crossref PubMed Scopus (54) Google Scholar). However, other cell types such as certain types of glial cells and neurons (24LeDoux S.P. Driggers W.J. Hollensworth B.S. Wilson G.L. Mutat. Res. 1999; 434: 149-159Crossref PubMed Scopus (85) Google Scholar, 27LeDoux S.P. Shen C.C. Grishko V.I. Fields P.A. Gard A.L. Wilson G.L. Glia. 1998; 24: 304-312Crossref PubMed Scopus (36) Google Scholar) are much less proficient at repairing this damage. To date, the mechanisms involved in this repair have not been well defined. Since the discovery of mammalian 8-oxoguanine DNA glycosylase (OGG) (28Rosenquist T.A. Zharkov D.O. Grollman A.P. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 7429-7434Crossref PubMed Scopus (456) Google Scholar), variant splices of OGG, MYH (the human homologue of Escherichia coli MutY, which excises mispaired adenine opposite 8-oxoguanine), and NTH1 (the human homologue ofE. coli endonuclease III) have been localized to mitochondria (29Takao M. Aburatani H. Kobayashi K. Yasui A. Nucleic Acids Res. 1998; 26: 2917-2922Crossref PubMed Scopus (242) Google Scholar). Recent evidence shows that there is an increase in the level of 8-oxoguanine lesions in mtDNA with age (16Hudson E.K. Hogue B.A. Souza-Pinto N.C. Croteau D.L. Anson R.M. Bohr V.A. Hansford R.G. Free Radic. Res. 1998; 29: 573-579Crossref PubMed Scopus (135) Google Scholar). Another study shows that there is an age-associated increase specifically in OGG activity in mitochondria and not in other repair enzymes (30Souza-Pinto N.C. Croteau D.L. Hudson E.K. Hansford R.G. Bohr V.A. Nucleic Acids Res. 1999; 27: 1935-1942Crossref PubMed Scopus (110) Google Scholar). Taken together, these findings suggest that the DNA repair system in mitochondria may be differentially regulated and that the OGG enzyme may play a pivotal role in this regulation. However, much remains to be learned about the components and processes involved in mtDNA repair of oxidative damage. A plausible explanation for why various cell types possess different inherent capacities for repairing mtDNA (24LeDoux S.P. Driggers W.J. Hollensworth B.S. Wilson G.L. Mutat. Res. 1999; 434: 149-159Crossref PubMed Scopus (85) Google Scholar, 25Driggers W.J. LeDoux S.P. Wilson G.L. J. Biol. Chem. 1993; 268: 22042-22045Abstract Full Text PDF PubMed Google Scholar, 26Shen C.C. Wertelecki W. Driggers W.J. LeDoux S.P. Wilson G.L. Mutat. Res. 1995; 337: 19-23Crossref PubMed Scopus (54) Google Scholar, 27LeDoux S.P. Shen C.C. Grishko V.I. Fields P.A. Gard A.L. Wilson G.L. Glia. 1998; 24: 304-312Crossref PubMed Scopus (36) Google Scholar) is that there are differences in the expression of specific components involved in DNA repair. To explore this possibility, we sought to increase the DNA repair capacity of a cell line that we have found to be relatively inefficient at repairing oxidative damage to its mtDNA. Because 8-oxoguanine has been considered to be one of the most mutagenic of oxidative lesions in DNA due to its strong tendency to mispair with adenine (31Bjoras M. Luna L. Johnsen B. Hoff E. Haug T. Rognes T. Seeberg E. EMBO J. 1997; 16: 6314-6322Crossref PubMed Scopus (330) Google Scholar), we targeted the glycosylase/AP lyase that repairs this lesion in the nucleus of human cells, hOGG, to the mitochondria. We investigated the effect of the targeted recombinant protein on mtDNA repair, cell survival, and the ability to proliferate. The results indicate that this protein enhances the repair of oxidative damage to mtDNA and increases the capacity for cells to survive and continue to divide after an oxidative insult. HeLa cells were obtained from American Type Culture Collection. The cells were maintained in Eagle's minimal essential medium with Earle's salts (Life Technologies, Inc.); supplemented with 10% fetal bovine serum (HyClone Laboratories), 50 μg/ml penicillin/streptomycin (Sigma), and 2 mml-glutamine (Life Technologies, Inc.) in 5% CO2 at 37 °C; and passaged every 3–4 days. For transfections, cells were grown in 75-cm2 flasks until they reached 75% confluence. They were then transfected with Fugene 6 reagent (Roche, Molecular Biochemicals) according to the manufacturer's recommendations. After 24 h, selection with 0.6 mg/ml G418 (Geneticin) ensued. After 2 weeks of selection, the cells were maintained in 0.4 mg/ml G418. Oligonucleotides were designed to serve as primers to amplify OGG1 from a cDNA plasmid. Additionally, the 5′ primer, GGAATTCATGTTGAGCCGGGCAGTGTGCGGCACCAGCAGGCAGCTGGCTCCGGCTTTGGGGTATCTGGGCTCCAGGCAGATGCCTGAATTACCCGAAGTT, contained the mitochondrial targeting sequence (MTS from MnSOD; Ref. 32Shimoda-Matsubayashi S. Matsumine H. Kobayashi T. Nakagawa- Hattori Y. Shimizu Y. Mizuno Y. Biochem. Cell Biol. 1996; 226: 561-565Google Scholar) and an EcoRI restriction site, and the 3′ primer, CGCCGCTCGAGGCCTTCCGGCCCTTTGGA, contained an XhoI restriction site. The cDNA was amplified using a high-fidelity thermostable DNA polymerase by PCR in a thermal cycler under the following conditions: 30-s denaturation (94° C), 1-min annealing (55° C), and 2-min extension (72° C). The resulting PCR fragment consisted of an EcoRI site, the MTS, the OGG coding region, and an XhoI site. The PCR product was subjected to double restriction enzyme digestion with EcoRI andXhoI overnight at 37 °C. The restriction fragment was subcloned into the EcoRI and XhoI sites of pcDNA3.0neo and sequenced to confirm fidelity. The predicted protein is approximately 39 kDa. Three 75-cm2flasks of each cell type (MTS-OGG- and control vector-transfected cells) at confluence were harvested and treated with ice-cold digitonin (325 mm digitonin, 2.5 mm EDTA, 250 mm mannitol, and 17 mm4-morpholinepropanesulfonic acid, pH 7.4) for 80 s. The lysed cells were then added to mannitol-sucrose buffer for a final strength of 1× (210 mm mannitol, 70 mm sucrose, 5 mm EDTA, 5 mm Tris, pH 7.5). The ice-cold suspension was then centrifuged for 10 min at 800 ×g to pellet nuclei. The supernatant was saved, the pelleted material was resuspended in 1× mannitol-sucrose buffer, and centrifugation was repeated. This was repeated three more times. The combined supernatants were then centrifuged to pellet any remaining nuclei, and the resulting supernatant was centrifuged at 10,000 ×g to pellet mitochondria. The combined supernatants were concentrated (Amicon protein concentrators) for cytosolic fractions. Isolated mitochondria and nuclei were suspended in a buffer of 20 mm HEPES, pH 7.6, 1 mm EDTA, 5 mmdithiothreitol, 300 mm KCl, and 5% glycerol. These preparations were briefly sonicated on ice, and 5 μl of protease inhibitor mixture from Sigma (for mammalian cell extracts, 100 mm AEBSF (4-(2-aminoethyl)benzenesulfonyl fluoride), 4 mm bestatin, 1.4 mm E 64, 2.2 mm leupeptin, 1.5 mm pepstatin, and 80 μm aprotinin) was added per milliliter of buffer. The fractions were centrifuged once more at 5,000 × g to pellet any remaining cell debris, and supernatant protein was used for Western blots and OGG activity assays. Protein concentrations were determined using the Bio-Rad protein dye micro-assay according to manufacturer's recommendations (Bradford method). The organelle-enriched fractions from each cell type were lysed and quantitated as described above. Fifty μg of each sample was loaded onto 12% SDS-polyacrylamide gels and electrophoresed to resolve proteins. The proteins were then transferred to Immobilon P polyvinylidene difluoride transfer membranes (Millipore) and blocked in 50 mm Tris-HCl, pH 7.5, 150 mmNaCl, and 6% nonfat dry milk. The membrane was incubated with a 1:1000 dilution of anti-hOGG primary antibody, which was kindly provided by Dr. Sankar Mitra (University of Texas Medical Branch, Galveston, TX), overnight at 4 °C in the same solution. The membrane was then washed four times in 50 mm Tris-HCl, 150 mm NaCl, and 0.05% Tween 20 and two times in the same solution without Tween 20. The horseradish peroxidase-labeled anti-rabbit secondary antibody was incubated with the membrane for 4 h at 4 °C, the washes were repeated as described above, and the membrane was reacted with chemiluminescent reagents (SuperSignal; Pierce) and processed for autoradiography. Monoclonal cytochromec antibody was purchased from PharMingen, and blotting procedures were performed as described above with anti-mouse secondary antibody. A 24-mer oligonucleotide with 8-oxoguanine at the 10th position (Trevigen) was end-labeled. An identical 24-mer without 8-oxoguanine also was used in parallel reactions. The labeling reaction contained 5 pmol of single-strand 8-oxoguanine oligonucleotide, 5 pmol of γ-32P, T4 polynucleotide kinase, and appropriate kinase buffer in a total volume of 20 μl (37 °C for 30 min, 90 °C for 2 min). Complementary oligonucleotide (also 5 pmol) was then added to form duplex DNA. Equal amounts of protein from the fractions isolated from both cell types were then used in assays with labeled duplex oligonucleotide. Activity assays contained 0.2 pmol of labeled duplex oligonucleotide, 3 μl of 10× REC buffer (100 mm HEPES, pH 7.4, 1 m KCl, 100 mm EDTA, and 1 mg/ml BSA), and organelle extracts or control formamidopyrimidine DNA glycosylase enzyme in a total volume of 30 μl (37 °C for 1 h). Organelle extracts contributed less than 20% of the total reaction volume (50 μg of mitochondrial, 20 μg of nuclear, and 50 μg of cytosolic protein). Bromphenol blue dye was added, and the reaction contents were resolved on 20% acrylamide, 8 m urea gels in 1× Tris-borate EDTA. Menadione (Sigma), a redox cycler (33Thor H. Smith M.T. Hartzell P. Bellomo G. Jewell S.A. Orrenius S. J. Biol. Chem. 1982; 257: 12419-12425Abstract Full Text PDF PubMed Google Scholar, 34Frei B. Winterhalter K.H. Richter C. Biochemistry. 1986; 25: 4438-4443Crossref PubMed Scopus (89) Google Scholar), was dissolved in Eagle's minimal essential medium with Earle's salts only (no serum) at a concentration of 400 μm for DNA repair studies. This was applied to MTS-OGG-transfected and control-transfected cells at approximately 75% confluence in 60-mm culture plates for 1 h in 5% CO2 at 37 °C. Cells were lysed immediately (10 mm Tris-HCl, pH 8.0, 1 mm EDTA, 0.5% SDS, and 0.3 mg/ml proteinase K), or regular growth media was replaced, and repair time was allowed in the incubator before lysis of cells. Control cultures were exposed to drug diluent only. Lower doses of menadione were used in clonogenic assays due to higher sensitivity of sparsely plated cells. Cell lysates from the treatment described above were incubated overnight at 37 °C, 0.2 volume of 5m NaCl was added, and high molecular weight DNA was extracted with equal volumes of chloroform three times, followed by precipitation with ammonium acetate and ethanol. DNA was then resuspended in distilled H2O, treated with RNase (final concentration, 1 mg/ml) for 2 h, and digested withXhoI overnight at 37 °C. Digested samples were precipitated, resuspended in TE buffer (10 mm Tris, pH 8.0, 1 mm EDTA), and precisely quantified using a Hoefer TKO 100 minifluorometer and TKO standard kit. Samples containing 5 μg of total DNA were heated for 15 min at 70 °C and cooled at room temperature. NaOH was then added to a final concentration of 0.1 N, and samples were incubated at 37 °C for 15 min. Samples were then mixed with alkaline loading dye, loaded onto a horizontal 0.6% alkaline agarose gel, and electrophoresed at 30 V (1.5 V/cm gel length) for 16 h. After ethidium bromide staining to confirm even loading and standard gel washes, the DNA was transferred to Zeta-Probe GT nylon membranes (Bio-Rad). The membranes were cross-linked and hybridized with a 32P-labeled human mtDNA-specific PCR-generated probe. Hybridization and subsequent washes were performed according to manufacturer's recommendations. DNA damage and repair were determined as described previously (25Driggers W.J. LeDoux S.P. Wilson G.L. J. Biol. Chem. 1993; 268: 22042-22045Abstract Full Text PDF PubMed Google Scholar, 35Driggers W.J. Holmquist G.P. LeDoux S.P. Wilson G.L. Nucleic Acids Res. 1997; 25: 4362-4369Crossref PubMed Scopus (71) Google Scholar). The neutral Southern blot was performed the same way, except that there was no alkaline pretreatment of samples and no NaOH in the loading dye, the 0.6% agarose gel, or the electrophoresis buffer. DNA samples were digested withXhoI and EcoRI, and hybridization was performed with a 32P-labeled nick-translated MTS-OGG fragment. The CellTiter 96 assay (Promega), which assesses mitochondrial function, was done according to the manufacturer's recommendations 24 h after a 1-h exposure to 200, 300, 400, and 500 μm menadione. Briefly, the reagent is added to culture wells, and the cells are incubated for 2 h. The tetrazolium compound is converted to a colored formazan product that is measured at 490 nm in a 96-well plate reader. Trypan blue exclusion studies were also performed on controls and samples treated with menadione and allowed a 6-h recovery in growth media. Additionally, a clonogenic survival assay was used to determine cell survival as well as the capacity of surviving cells to proliferate. MTS-OGG transfectants and control vector (pcDNA3) transfectants were carefully counted with a hemocytometer, and 400 cells were plated into each 60-mm culture plate. These cells were allowed 24 h in normal culture medium to adhere, and then they were exposed to menadione exactly as described above, except that concentrations of 25, 50, 75, and 100 μm were used due to the increased sensitivity of cells to oxidative stress when plated at the low density required for the clonogenic assay. Each cell type was assayed at control (no menadione) and all four concentration levels in triplicate. After exposure for 1 h, normal culture medium was replaced, and plates were incubated (5% CO2 at 37 °C) for 10 days. Then plates were rinsed with warm phosphate-buffered saline and fixed with a solution of 3 parts methanol:1 part acetic acid for 10 min. Finally, the plates were stained with hematoxylin, and colonies were counted. All statistical analyses were performed using Student's t test to compare individual means with significant differences at a confidence level of p< 0.05. To increase repair of oxidative damage in mtDNA, a construct with the hOGG gene fused to the mitochondrial targeting sequence from human MnSOD (32Shimoda-Matsubayashi S. Matsumine H. Kobayashi T. Nakagawa- Hattori Y. Shimizu Y. Mizuno Y. Biochem. Cell Biol. 1996; 226: 561-565Google Scholar) was prepared (Fig. 1 A). After transfection of HeLa cells with the MTS-OGG construct or control vector (pcDNA3) and 2 weeks of selection, DNA was isolated from pcDNA3 (vector only)-transfected cells and MTS-OGG cells, and a neutral Southern blot was performed to check for integration of the transfected DNA. Fig. 1 B shows that the MTS-OGG sequence was recognized only in the MTS-OGG-transfected cells, where the predicted 1.1-kilobase band can be seen. Mitochondrial, nuclear, and cytoplasmic fractions were isolated from vector only transfectants and MTS-OGG transfectants by differential centrifugation, and Western blots were performed with a polyclonal antibody to human OGG1. Fig. 2shows an additional 39-kDa recombinant protein in the mitochondria of the MTS-OGG-transfected sample. No differences in protein bands were detected in lanes containing nucleus- or cytosolic-enriched fractions. Even loading was confirmed with Coomassie Blue staining. To further establish that the recombinant protein is in mitochondria, we also performed Western blot analysis for the mitochondrial protein cytochrome c and found it in the mitochondria (but not nucleus or cytosol) with equal amounts in both the vector- and MTS-OGG-transfected samples (Fig. 2). Thus, it can be concluded that the construct is functional in targeting additional human OGG to mitochondria. To analyze the enzymatic activity of the additional OGG protein in the mitochondria of stable transfectants, an oligonucleotide cleavage assay was used. A 24-base pair oligonucleotide with 8-oxoguanine at the 10th nucleotide was incubated with purified bacterial formamidopyrimidine DNA glycosylase (control) or extracts from isolated mitochondria or nuclei from MTS-OGG- and vector-transfected cells, as described under “Experimental Procedures.” Fig. 3 shows the intact DNA and cleavage products from each of these reactions. Equal amounts of protein were used in each comparison between vector- and MTS-OGG-transfected cells. The mitochondrial extracts from MTS-OGG-transfected cells are better able to cleave the DNA than are the control cells. The nuclear extracts, on the other hand, show equal enzyme activity levels. None of the extracts or purified formamidopyrimidine DNA glycosylase was able to cleave an identical oligonucleotide duplex with normal guanine at position 10. Based on this assay, we conclude that the additional OGG protein targeted to mitochondria is indeed functional in removal of 8-oxoguanine and strand cleavage. Because the MTS-OGG cells have an elevated level of mitochondrial human OGG, which contains lyase activity, it is possible that repair of damage to the sugar-phosphate backbone is enhanced. To test for this, dose-response studies were performed using different concentrations of menadione, which redox cycles with complex I of the electron transport chain to form superoxide radical (33Thor H. Smith M.T. Hartzell P. Bellomo G. Jewell S.A. Orrenius S. J. Biol. Chem. 1982; 257: 12419-12425Abstract Full Text PDF PubMed Google Scholar, 34Frei B. Winterhalter K.H. Richter C. Biochemistry. 1986; 25: 4438-4443Crossref PubMed Scopus (89) Google Scholar). A concentration of 400 μmmenadione produced an appropriate amount of lesions (∼1 lesion per 104 normal nucleotides) in mtDNA from both MTS-OGG transfectants and control pcDNA3 transfectants. Damage to nuclear DNA was undetectable at this dose using Southern blots or quantitative extended length PCR (data not shown). Therefore, repair experiments were performed in which MTS-OGG transfectants and pcDNA3 transfectants were exposed to 400 μm menadione, followed by either immediate lysis or lysis after repair intervals of up to 6 h in normal culture medium. Control cultures were exposed to drug diluent only. DNA was isolated from the lysed cells, and quantitative Southern blots were performed to check overall damage levels and the subsequent repair of this damage. As shown in Fig.4 A, the pcDNA3 transfectants did not repair an appreciable amount of the damage to their mtDNA within the initial 6 h after drug removal, whereas the MTS-OGG transfectants repaired most of the damage in this time interval. The average amount of repair for each cell type is shown in Fig. 4 B. Based on these results, it can be concluded that the additional OGG targeted to the mitochondria is a functional enzyme and that mtDNA repair in these cells is more efficient than that in the control transfectants. To investigate whether the observed increase in mtDNA repair translates into enhanced viability after oxidative insult, three assays were used to evaluate the MTS-OGG transfectants as compared with the pcDNA3 transfectants. First, the mitochondrial function of these cells was analyzed 24 h after exposure to the menadione diluent (serum-free culture medium) or 200, 300, 400, and 500 μm menadione. Fig.5 A graphically demonstrates the average of three independent experiments. A progressive decrease in the ability of mitochondria to reduce tetrazolium compound to formazan was seen with increasing doses of menadione. A significant difference in conversion to formazan was observed between MTS-OGG cells and those transfected only with the vector at the 500 μm dose. A trypan blue exclusion assay was performed on cells treated likewise followed by 6 h of recovery time. A significantly greater percentage of the MTS-OGG cells were able to exclude the dye after 6 h (Fig. 5 B). However, because trypan blue dye exclusion and tetrazolium reduction are only transient measures of viability and are not necessarily indicative of long-term cell survival, a clonogenic survival assay also was used. Cells from the two transfected cell lines were carefully counted, and 400 cells were plated into 60-mm dishes. Due to the sparse plating conditions, these cells were more sensitive to the menadione than confluent cells. Therefore, the doses used in this assay were lower than the doses used for DNA repair studies. After 24 h in culture medium, the plates were treated with various doses of menadione for 1 h and then cultured for 10 days in normal culture medium. The resulting colonies represent cells that were not only viable but were also able to proliferate. Fig. 6 reveals that MTS-OGG cells were significantly better able to produce colonies at all concentrations tested. These viability data establish that MTS-OGG transfectants are better able to survive an oxidative challenge than the control cells.Figure 6MTS-OGG transfectants survive and multiply to form colonies after oxidative challenge. Cells were plated sparsely (400 cells per 60-mm dish) and allowed to adhere over a 24-h period. They were then treated with 25, 50, 75, or 100 μmmenadione for 1 h and placed in their normal media for 10 days. Colonies were then fixed, stained, and counted. An average of the results ± S.E. from four separate clonogenic assays is shown. An asterisk (∗) indicates a significant difference (p < 0.05).View Large Image Figure ViewerDownload (PPT) To our knowledge, this is the first report to describe the targeting of a recombinant repair enzyme to mitochondria in an effort to correct deficient repair of oxidative damage in the DNA in this organelle. The isolate of HeLa cells used for these studies was selected because it was discovered that these cells do not repair oxidative damage to their mtDNA proficiently and that they grow well in culture, so
Referência(s)