Expression of Alternatively Spliced Sodium Channel α-Subunit Genes
2004; Elsevier BV; Volume: 279; Issue: 44 Linguagem: Inglês
10.1074/jbc.m406387200
ISSN1083-351X
AutoresChristopher K. Raymond, John C. Castle, Philip W. Garrett-Engele, Christopher D. Armour, Zhengyan Kan, Nicholas F. Tsinoremas, Jason M. Johnson,
Tópico(s)Signaling Pathways in Disease
ResumoMolecular medicine requires the precise definition of drug targets, and tools are now in place to provide genome-wide information on the expression and alternative splicing patterns of any known gene. DNA microarrays were used to monitor transcript levels of the nine well-characterized α-subunit sodium channel genes across a broad range of tissues from cynomolgus monkey, a non-human primate model. Alternative splicing of human transcripts for a subset of the genes that are expressed in dorsal root ganglia, SCN8A (Nav1.6), SCN9A (Nav1.7), and SCN11A (Nav1.9) was characterized in detail. Genomic sequence analysis among gene family paralogs and between cross-species orthologs suggested specific alternative splicing events within transcripts of these genes, all of which were experimentally confirmed in human tissues. Quantitative PCR revealed that certain alternative splice events are uniquely expressed in dorsal root ganglia. In addition to characterization of human transcripts, alternatively spliced sodium channel transcripts were monitored in a rat model for neuropathic pain. Consistent down-regulation of all transcripts was observed, as well as significant changes in the splicing patterns of SCN8A and SCN9A. Molecular medicine requires the precise definition of drug targets, and tools are now in place to provide genome-wide information on the expression and alternative splicing patterns of any known gene. DNA microarrays were used to monitor transcript levels of the nine well-characterized α-subunit sodium channel genes across a broad range of tissues from cynomolgus monkey, a non-human primate model. Alternative splicing of human transcripts for a subset of the genes that are expressed in dorsal root ganglia, SCN8A (Nav1.6), SCN9A (Nav1.7), and SCN11A (Nav1.9) was characterized in detail. Genomic sequence analysis among gene family paralogs and between cross-species orthologs suggested specific alternative splicing events within transcripts of these genes, all of which were experimentally confirmed in human tissues. Quantitative PCR revealed that certain alternative splice events are uniquely expressed in dorsal root ganglia. In addition to characterization of human transcripts, alternatively spliced sodium channel transcripts were monitored in a rat model for neuropathic pain. Consistent down-regulation of all transcripts was observed, as well as significant changes in the splicing patterns of SCN8A and SCN9A. Alternative splicing of primary gene transcripts provides a mechanism to generate functionally distinct protein isoforms from a single gene. For the development of safe and efficacious therapeutic compounds, it is necessary to identify the repertoire of proteins that can arise from a gene targeted for therapeutic intervention and determine their tissue distribution within the body. The completion of several mammalian genome sequences, coupled with rich resources provided by extensive expressed sequence tag (EST) and cDNA sequencing, present opportunities for computational prediction of alternative splicing (1Thanaraj T.A. Clark F. Muilu J. Nucleic Acids Res. 2003; 31: 2544-2552Crossref PubMed Scopus (102) Google Scholar, 2Modrek B. Lee C.J. Nat. Genet. 2003; 34: 177-180Crossref PubMed Scopus (425) Google Scholar, 3Kan Z. Castle J. Johnson J.M. Tsinoremas N.F. Pac. Symp. Biocomput. 2004; : 42-53PubMed Google Scholar, 4Kan Z. States D. Gish W. Genome Res. 2002; 12: 1837-1845Crossref PubMed Scopus (148) Google Scholar). The UCSC genome browser (genome.ucsc.edu), which displays overlapping tracks of mRNAs, ESTs, and comparative genomic conservation, can also facilitate the identification of potential alternative splice events. DNA microarrays that monitor exon-exon junctions directly across a broad range of transcripts provide an additional resource to detect alternative splicing on a genome-wide scale (5Johnson J.M. Castle J. Garrett-Engele P. Kan Z. Loerch P.M. Armour C.D. Santos R. Schadt E.E. Stoughton R. Shoemaker D.D. Science. 2003; 302: 2141-2144Crossref PubMed Scopus (1185) Google Scholar, 6Castle J. Garrett-Engele P. Armour C.D. Duenwald S.J. Loerch P.M. Meyer M.R. Schadt E.E. Stoughton R. Parrish M.L. Shoemaker D.D. Johnson J.M. Genome Biol. 2003; 4: R66Crossref PubMed Google Scholar). These combined computational and experimental approaches, coupled with traditional laboratory validation, provide a wealth of information about alternative splicing and tissue-specific expression, which are essential to define a drug target at the molecular level.Sodium channels are multisubunit protein complexes that play a pivotal role in the propagation of action potentials along neurons (7Catterall W.A. Neuron. 2000; 26: 13-25Abstract Full Text Full Text PDF PubMed Scopus (1685) Google Scholar, 8Yu F.H. Catterall W.A. Genome Biol. 2003; 4: 207Crossref PubMed Scopus (502) Google Scholar). The α-subunit genes encode the primary channel-forming pores within the cell membrane that allow ion-specific translocation. The α-subunit gene family contains nine paralogs (and one additional sodium channel-like gene, Nax) that are highly conserved across vertebrate species (9Goldin A.L. Barchi R.L. Caldwell J.H. Hofmann F. Howe J.R. Hunter J.C. Kallen R.G. Mandel G. Meisler M.H. Netter Y.B. Noda M. Tamkun M.M. Waxman S.G. Wood J.N. Catterall W.A. Neuron. 2000; 28: 365-368Abstract Full Text Full Text PDF PubMed Scopus (649) Google Scholar). The channel protein structure includes four highly similar clusters of transmembrane helices that are connected by intracellular loops. A similar structure is found in calcium and potassium channels, indicating that this ion channel superfamily arose from a single primordial ion channel gene (8Yu F.H. Catterall W.A. Genome Biol. 2003; 4: 207Crossref PubMed Scopus (502) Google Scholar, 10Plummer N.W. Meisler M.H. Genomics. 1999; 57: 323-331Crossref PubMed Scopus (172) Google Scholar). Voltage-gated sodium channels perform a broad spectrum of functions within vertebrate cells, as is evident from the large number of paralogous genes and their tissue-selective expression patterns. For a particular sodium channel gene, subtle differences in channel properties can be attributed to alternative splicing, post-translational modification, changes in the expression of ancillary β-subunits, and mutation (7Catterall W.A. Neuron. 2000; 26: 13-25Abstract Full Text Full Text PDF PubMed Scopus (1685) Google Scholar, 8Yu F.H. Catterall W.A. Genome Biol. 2003; 4: 207Crossref PubMed Scopus (502) Google Scholar). Importantly, alternative splicing of transcripts derived from a common gene has been shown to generate biochemically and pharmacologically distinct sodium channel isoforms (11Tan J. Liu Z. Nomura Y. Goldin A.L. Dong K. J. Neurosci. 2002; 22: 5300-5309Crossref PubMed Google Scholar, 12Dietrich P.S. McGivern J.G. Delgado S.G. Koch B.D. Eglen R.M. Hunter J.C. Sangameswaran L. J. Neurochem. 1998; 70: 2262-2272Crossref PubMed Scopus (103) Google Scholar).We chose to focus our attention on sodium channels expressed in dorsal root ganglia (DRG), 1The abbreviations used are: DRG, dorsal root ganglia; PNS, peripheral nervous system; nt, nucleotides; RT, reverse transcriptase; CNS, central nervous system.1The abbreviations used are: DRG, dorsal root ganglia; PNS, peripheral nervous system; nt, nucleotides; RT, reverse transcriptase; CNS, central nervous system. peripheral nervous system (PNS) structures found just outside the spinal column that play key roles in sensory transmission from the periphery to the brain. Channels expressed in DRG are known to play key roles in nociception (7Catterall W.A. Neuron. 2000; 26: 13-25Abstract Full Text Full Text PDF PubMed Scopus (1685) Google Scholar, 8Yu F.H. Catterall W.A. Genome Biol. 2003; 4: 207Crossref PubMed Scopus (502) Google Scholar, 13Waxman S.G. Cummins T.R. Dib-Hajj S.D. Black J.A. J. Rehabil. Res. Dev. 2000; 37: 517-528PubMed Google Scholar). Modulation of DRG sodium channel activity may provide relief from neuropathic pain, a medical condition that is not well addressed by current medicinal therapies (13Waxman S.G. Cummins T.R. Dib-Hajj S.D. Black J.A. J. Rehabil. Res. Dev. 2000; 37: 517-528PubMed Google Scholar). Our goal was to catalog and quantify alternative splicing events that occur in SCN8A (encoding Nav1.6, PN4), SCN9A (encoding Nav 1.7, PN1), and SCN11A (encoding Nav 1.9, PN5). As an example, previous research had shown alternative splicing of SCN8A transcripts (14Plummer N.W. McBurney M.W. Meisler M.H. J. Biol. Chem. 1997; 272: 24008-24015Abstract Full Text Full Text PDF PubMed Scopus (133) Google Scholar, 15Plummer N.W. Galt J. Jones J.M. Burgess D.L. Sprunger L.K. Kohrman D.C. Meisler M.H. Genomics. 1998; 54: 287-296Crossref PubMed Scopus (80) Google Scholar). In rat DRG, alternative splicing extends the reading frame of exon 11, resulting in a channel that has altered kinetics of inactivation and reactivation relative to the non-extended isoform (12Dietrich P.S. McGivern J.G. Delgado S.G. Koch B.D. Eglen R.M. Hunter J.C. Sangameswaran L. J. Neurochem. 1998; 70: 2262-2272Crossref PubMed Scopus (103) Google Scholar). Developmentally regulated alternative splicing of SCN8A coding exon 18 in mouse and human results in a transcript that encodes a truncated, nonfunctional channel that appears in fetal tissue but vanishes just after birth (14Plummer N.W. McBurney M.W. Meisler M.H. J. Biol. Chem. 1997; 272: 24008-24015Abstract Full Text Full Text PDF PubMed Scopus (133) Google Scholar). Finally, a splicing event involving a mutually exclusive alternative exon 6 was inferred from human genomic sequence (15Plummer N.W. Galt J. Jones J.M. Burgess D.L. Sprunger L.K. Kohrman D.C. Meisler M.H. Genomics. 1998; 54: 287-296Crossref PubMed Scopus (80) Google Scholar). A recent report of DRG-selective expression of an alternatively spliced, functionally distinct variant of the voltage-gated calcium channel CACNA1B (Cav2.2) suggests that DRG-specific alternative splicing may generate a unique constellation of ion channels within this physiologically important PNS subregion (16Bell T.J. Thaler C. Castiglioni A.J. Helton T.D. Lipscombe D. Neuron. 2004; 41: 127-138Abstract Full Text Full Text PDF PubMed Scopus (180) Google Scholar). In this study, we were able to detect both known and novel sodium channel transcripts in DRG that arise by alternative splicing. Quantitative PCR was used to assess the expression patterns of these alternatively spliced isoforms, and we found that alternative splicing of sodium channel mRNAs was most pronounced in DRG. These data indicate that effective treatment of neuropathic pain via antagonism of sodium channels must account for multiple channel isoforms.MATERIALS AND METHODSSodium Channel Expression Compendium (Body Atlas)—Gene expression profiling of cynomolgus monkey mRNA was performed on ink-jet synthesized oligonucleotide microarrays designed to monitor ∼47,000 human transcripts. This two-array set (Hu50K) is an updated version of human microarrays described previously (17Hughes T.R. Mao M. Jones A.R. Burchard J. Marton M.J. Shannon K.W. Lefkowitz S.M. Ziman M. Schelter J.M. Meyer M.R. Kobayashi S. Davis C. Dai H. He Y.D. Stephaniants S.B. Cavet G. Walker W.L. West A. Coffey E. Shoemaker D.D. Stoughton R. Blanchard A.P. Friend S.H. Linsley P.S. Nat. Biotechnol. 2001; 19: 342-347Crossref PubMed Scopus (1045) Google Scholar). Probes for the nine voltage-gated sodium channel transcripts reported here were present on these arrays. Additional results from these experiments will be described in future publications. Microarray probe sequences were designed to hybridize near the transcript 3′-end. Messenger RNA amplification and hybridization conditions were performed as described previously (17Hughes T.R. Mao M. Jones A.R. Burchard J. Marton M.J. Shannon K.W. Lefkowitz S.M. Ziman M. Schelter J.M. Meyer M.R. Kobayashi S. Davis C. Dai H. He Y.D. Stephaniants S.B. Cavet G. Walker W.L. West A. Coffey E. Shoemaker D.D. Stoughton R. Blanchard A.P. Friend S.H. Linsley P.S. Nat. Biotechnol. 2001; 19: 342-347Crossref PubMed Scopus (1045) Google Scholar). Individual samples were labeled with either fluorescent Cy3 or Cy5 dye and hybridized to a human microarray in replicate against a mass-balanced control pool of 220 individual tissue RNA samples. Each experiment was repeated with the Cy3 and Cy5 dyes reversed (a dye swap). Microarrays were purchased from Agilent Technologies (Palo Alto, CA). The housing, necropsy, and extraction of RNA from organs and tissues of all animals used in the monkey expression experiments was performed by MPI Research Inc. (Mattawan, MI), with the sole exception of RNA extraction from bone samples. Four cynomolgus (Macaca fascicularis) monkeys, 2 male and 2 female, were the source of the organs and tissues. All animals were matched for age, weight, and diet (Lab Diet® Certified Primate Diet 5048, PMI Nutrition International, Inc.) available ad libitum. Monkeys were fasted for 16 h pre-euthanasia and sedated with ketamine, followed by overdose of sodium pentobarbital solution and exsanguination. All samples were harvested, trimmed, and snap frozen in liquid nitrogen within 30 min with the majority of samples being frozen within 15 min.Each sample was hybridized to 8 microarrays: 4 individuals and 2 microarrays for the dye-swap. For each gene, a log10 ratio of individual sample to pool was generated by combining dye-swap microarray pairs. These 4 values, one for each individual, were then averaged in an error-weighted fashion (18He Y.D. Dai H. Schadt E.E. Cavet G. Edwards S.W. Stepaniants S.B. Duenwald S. Kleinhanz R. Jones A.R. Shoemaker D.D. Stoughton R.B. Bioinformatics. 2003; 19: 956-965Crossref PubMed Scopus (77) Google Scholar) to produce a log10 error-weighted average (tissue-to-pool) ratio for each gene. Error bars estimate the one standard deviation of this average combine the modeled errors calculated for each sample and the replicate error (18He Y.D. Dai H. Schadt E.E. Cavet G. Edwards S.W. Stepaniants S.B. Duenwald S. Kleinhanz R. Jones A.R. Shoemaker D.D. Stoughton R.B. Bioinformatics. 2003; 19: 956-965Crossref PubMed Scopus (77) Google Scholar) Finally, for each gene, we transformed the log ratios to ratios and normalized linearly by scaling the largest tissue ratio to 1.RT-PCR and Quantitative Real Time PCR (TaqMan®)—Reverse transcription-polymerase chain reaction (RT-PCR) amplification from tissue-specific mRNA or total RNA was performed as described previously (5Johnson J.M. Castle J. Garrett-Engele P. Kan Z. Loerch P.M. Armour C.D. Santos R. Schadt E.E. Stoughton R. Shoemaker D.D. Science. 2003; 302: 2141-2144Crossref PubMed Scopus (1185) Google Scholar). The oligonucleotides used in this study (Table I) were obtained from Qiagen (Valencia, CA). Amplicons were subcloned into pCR2.1 using a TOPO-TA cloning kit (Invitrogen). Sequencing was performed by a commercial vendor (Lark Technologies Inc., Houston, TX). The sequences of all isoforms described in this study were deposited into GenBank™ (Table II).Table IPCR primers used for RT-PCRPrimer name5′ to 3′ sequencePurposeSCN8.5FCAAGAGGTTTCTGCATAGATGGCTTTACAmplify human SCN8A exon 5 to exon 13SCN8.13RCATTATACTGTTGATTCTGTCCTTCCGCAmplify human SCN8A exon 5 to exon 13SCN9.4FTGTGTAGGAGAATTCACTTTTCTTCGTGAmplify human SCN9A exon 4 to exon 12SCN9.12RGGAGATAGGAACTACAACGCCTTTTCTTAmplify human SCN9A exon 4 to exon 12SCN11.15FGATGACGTTGAATTTTCTGGTGAAGATAAmplify human SCN11A exon 15 to exon 19SCN11.19RCAAATCCGAAGGCTACCCATTTTAGTAAmplify human SCN11A exon 15 to exon 19 Open table in a new tab Table IIGenBank™ accession numbers for deposited partial mRNA sequencesDNA sequenceGenBank™ accession numberHuman SCN8A - exon 6N to exon 12EXTAY682082Human SCN8A - exon 6A to exon 12RSAY682081Human SCN8A - exon 6A to exon 12EXTAY682083Human SCN9A - exon 5N to exon 11EXTAY682085Human SCN9A - exon 5A to exon 11RSAY682084Human SCN9A - exon 5A to exon 11EXTAY682086Human SCN11A - exon 16 skipAY686224 Open table in a new tab TaqMan® is a registered trademark of Roche Applied Science. TaqMan® primer probe reagents were obtained through the Applied Biosystems Assays-by-Design custom assay service (Foster City, CA). The primer-probe sets used in this study are shown in Table III. Probe sequences were designed to straddle the unique splice junctions characteristic of each alternative splice form. TaqMan® assays were performed on an ABI 7900 real time PCR instrument in 10-μl assays that were run in triplicate in a 384-well format optical PCR plate. The assays were calibrated with isoform-specific RT-PCR clones using the standard curve method. 2Essentials of Real Time PCR, www.appliedbiosystems.com/support/tutorials/pdf/essentials_of_real_time_pcr.pdf. Standard curves generated from plasmid clones were linear across at least six orders of magnitude, and all reported values derived for total tissue RNA fell within the range of these standard curves.Table IIITaqMan® primer probe sets used to quantify alternative splicingTaqMan® assay5′–3′ Forward primer sequence 5′–3′ Reverse primer sequence 5′–3′ Probe sequenceACAGAGTTTGTAAACCTAGGCAATGTHuman SCN8A exon 6NGGCCTGGGATTACCGAAATAGTTTTFAMaFAM, FAM fluorophore–CTGAAAGTGCGTAGAGCTG–NFQbNFQ, non-fluorescent quencherGTGGACCTGGGCAATGTCTHuman SCN8A exon 6AAGAGATAGTTTTCAAAGCTCGGAGAACFAM–CAGCGCTGAGAACAT–NFQCCCCGGCTCCCACATCHuman SCN8A exon 12wtCCAGGGCCTTTCTTCTTAATTTCCAFAM–TCCTGCCAGAGGCTAC–NFQCTGCCAGAGGTGAAAATTGATAAGGHuman SCN8A exon 12extCCAGGGCCTTTCTTCTTAATTTCCAFAM–CCGATGACAGTGCTACAAC–NFQCTGGATTTTGTCGTCATTGTTTTTGHuman SCN9A exon 5NCAAAGCCCCTACAATTGTCTTCAGFAM–TTTCAGCTCTTCGAACTT–NFQCTGGATTTTGTCGTCATTGTTTTTGHuman SCN9A exon 5ACAAAGCCCCTACAATTGTCTTCAGVICcVIC, VIC fluorophore–AGCATTGAGAACATTCAG–NFQTCCCCAATGGACAGCTTCTGHuman SCN9A exon 11wtGGAGATAGGAACTACAACGCCTTTTFAM–CCAGAGGGCACGACCAA–NFQAGCTTCTGCCAGAGGTGATAATAGAHuman SCN9A exon 11extGGAGATAGGAACTACAACGCCTTTTFAM–ACAGCGGCACGACCAA–NFQTCACACAACCTGAGCCTGAACHuman SCN11A wild-typeGTGGGCTTCTTGTTCTCCTGATFAM–AACAGGCCTATGAGCTCC–NFQACAGCGCATCACACAACCTHuman SCN11A exon 16 skipCTGAAGATCAATGGTGCTACATTCTGFAM–CCTGAACAACAGAAGTCT–NFQACAGAGTTTGTAAACCTAGGCAATGTRat SCN8A exon 5NGGCCTGGGATTACCGAAATAGTTTTFAM–CTGAAAGTGCGTAGAGCTG–NFQCAGGGTTCTCCGAGCTTTGARat SCN8A exon 5ACGCCCACGATTGTCTTCAGFAM–CCTGGAATTACAGAGATAGTTT–NFQGGCCCGGCTCACACATRat SCN8A exon 11wtCCAGGGCCTTTCTTCTTAATTTCCAFAM–CTGCCTGAGGCAACG–NFQCTCCTGCCTGAGGTGAAAATAGATARat SCN8A exon 11extCCAGGGCCTTTCTTCTTAATTTCCAFAM–TCAGTCGTTGCGCTGTC–NFQTGTTGTCATTGTTTTTGCGTATTTAACAGAARat SCN9A exon 5NCCTGGGATTACAGAAATAGTTTTCAAAGCFAM–TTCAGCTCTTCGAACTTT–NFQACATTCAGAGTTCTCCGAGCATTGRat SCN9A exon 5ACCCCCACGATGGTCTTTAGTFAM–CCTGGAATGACTGATATTGT–NFQGCTCCCCAATGGACAGCTTRat SCN9A exon 11wtGACAAGAAGTAAGAACTAGAGAGCCTTTTFAM–CCAGAGGGCACGACTAA–NFQGACAGCTTCTTCCAGAGGTGATAATARat SCN9A exon 11extGACAAGAAGTAAGAACTAGAGAGCCTTTTFAM–ACAGCGGCACGACTAA–NFQCCTACCCACCTCACAACATAGTGRat SCN11A wild-typeGGCTAGTGAGCTGCTTGGTFAM–CACCGGCCTGAACTC–NFQa FAM, FAM fluorophoreb NFQ, non-fluorescent quencherc VIC, VIC fluorophore Open table in a new tab Total RNA from human tissue was obtained from Clontech. Total rat dorsal root ganglia RNA from control and treated animals from a spinal nerve ligation neuropathic pain model was obtained as a gift from Dr. Hao Wang and colleagues (Merck Research Labs, West Point, PA). All of the handling of the animals and testing was performed in accordance with the policies and recommendations of the International Association for the Study of Pain (19Zimmermann M. Pain. 1983; 16: 109-110Abstract Full Text PDF PubMed Scopus (6802) Google Scholar) and received approval from the Institutional Animal Care and Use Committee of MRL, West Point, PA. The experimental treatment of the animals was exactly as described in Ref. 20Wang H. Sun H. Della Penna K. Benz R.J. Xu J. Gerhold D.L. Holder D.J. Koblan K.S. Neuroscience. 2002; 114: 529-546Crossref PubMed Scopus (218) Google Scholar. RNA was converted to cDNA for TaqMan® measurements using a commercially available kit from Applied Biosystems. All assays were normalized on a tissue-to-tissue basis by adding a constant amount of input total RNA into the RT reaction. We chose this normalization method because we were unable to identify a single housekeeping gene that yielded satisfactory normalization data. Isoform levels within tissue RNAs were measured in triplicate on separate occasions, and the results were highly reproducible. A representative data set is shown in each case.Quantitative PCR values were calculated by assuming that the sum of splicing events at a given site was equal to unity (e.g. SCN8A [exon 6N] + [exon 6A] = 1). This was applied to the most abundant measurement in each data set (SCN8A-adult brain; SCN9A exon 5-DRG; SCN9A exon 11-fetal brain) where the sum of the isoform measurements was adjusted to a value of 100%. All other measurements in the data set were normalized to these maximum values. Error bars are 1 S.D. of the average of triplicate measurements.RESULTSBody Atlas Expression Patterns of Sodium Channels—DNA microarrays afford the opportunity for genome-wide monitoring of transcription within any RNA sample. When RNA samples from diverse tissues throughout the body are hybridized, it becomes possible to assemble a transcriptional compendium or Body Atlas (5Johnson J.M. Castle J. Garrett-Engele P. Kan Z. Loerch P.M. Armour C.D. Santos R. Schadt E.E. Stoughton R. Shoemaker D.D. Science. 2003; 302: 2141-2144Crossref PubMed Scopus (1185) Google Scholar, 21Hsiao L.L. Dangond F. Yoshida T. Hong R. Jensen R.V. Misra J. Dillon W. Lee K.F. Clark K.E. Haverty P. Weng Z. Mutter G.L. Frosch M.P. Macdonald M.E. Milford E.L. Crum C.P. Bueno R. Pratt R.E. Mahadevappa M. Warrington J.A. Stephanopoulos G. Gullans S.R. Physiol. Genomics. 2001; 7: 97-104Crossref PubMed Google Scholar, 22Su A.I. Cooke M.P. Ching K.A. Hakak Y. Walker J.R. Wiltshire T. Orth A.P. Vega R.G. Sapinoso L.M. Moqrich A. Patapoutian A. Hampton G.M. Schultz P.G. Hogenesch J.B. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 4465-4470Crossref PubMed Scopus (1250) Google Scholar). This resource is essentially a semiquantitative, whole-genome Northern blot for all transcripts with corresponding probes on the array. The Body Atlas of the nine voltage-gated sodium channel paralogs across a broad range of tissues was obtained for cynomolgus macaque monkey transcripts profiled on human microarrays (Fig. 1). While entirely consistent with previous studies (7Catterall W.A. Neuron. 2000; 26: 13-25Abstract Full Text Full Text PDF PubMed Scopus (1685) Google Scholar, 8Yu F.H. Catterall W.A. Genome Biol. 2003; 4: 207Crossref PubMed Scopus (502) Google Scholar, 9Goldin A.L. Barchi R.L. Caldwell J.H. Hofmann F. Howe J.R. Hunter J.C. Kallen R.G. Mandel G. Meisler M.H. Netter Y.B. Noda M. Tamkun M.M. Waxman S.G. Wood J.N. Catterall W.A. Neuron. 2000; 28: 365-368Abstract Full Text Full Text PDF PubMed Scopus (649) Google Scholar), these data are unique in that they provide a comprehensive overview of the entire gene family in a wide range of tissues. We present the data for monkey because our data for human were incomplete. Moreover, we believe the cynomolgus macaque data are a more accurate reflection of normal human biology because tissue RNA samples were obtained from healthy individuals under carefully controlled conditions. Microarrays using human sequences have routinely and successfully been used to profile non-human primate samples to study gene expression, including the use of samples from cynomolgus monkey (23Miyahara T. Kikuchi T. Akimoto M. Kurokawa T. Shibuki H. Yoshimura N. Investig. Ophthalmol. Vis. Sci. 2003; 44: 4347-4356Crossref PubMed Scopus (89) Google Scholar). There is a high level of conservation of orthologous sodium channel sequences and expression patterns among mammals that is likely even higher among primates. On average, one would expect zero to only a few mismatched bases between monkey and human per 60-mer probe sequence. Of the 10 sodium channel probes that could be mapped to both human and chimpanzee genomic sequences, seven were perfect matches in both species. Finally, although sequence differences between human and cynomolgus monkey transcripts may affect individual probe intensities, they are unlikely to influence intensity ratios (between sample and pool), which are used here. Examination of the Body Atlas data reveals that SCN4A (Nav1.4) and SCN5A (Nav1.5) exhibit strikingly selective expression in striated muscle and heart, respectively. SCN3A (Nav1.3) appears to be transcribed in numerous tissues. Channels SCN1A (Nav1.1), SCN2A (Nav1.2) and SCN8A (Nav1.6) appear to be abundantly expressed in both PNS and CNS tissues. In contrast, SCN9A (Nav1.7), SCN10A (Nav1.8) and SCN11A (Nav1.9) expression is strikingly selective to DRG, with only minor expression levels detected elsewhere in the body.Detection of Alternative Splicing in SCN8A, SCN9A, and SCN11A—Within the vertebrate sodium channel paralog family, parsimonious clustering by protein sequence indicates that SCN8A and SCN9A occupy one branch of the sodium channel family tree that also includes SCN1A, SCN2A, and SCN3A (8Yu F.H. Catterall W.A. Genome Biol. 2003; 4: 207Crossref PubMed Scopus (502) Google Scholar, 9Goldin A.L. Barchi R.L. Caldwell J.H. Hofmann F. Howe J.R. Hunter J.C. Kallen R.G. Mandel G. Meisler M.H. Netter Y.B. Noda M. Tamkun M.M. Waxman S.G. Wood J.N. Catterall W.A. Neuron. 2000; 28: 365-368Abstract Full Text Full Text PDF PubMed Scopus (649) Google Scholar). As mentioned, within SCN8A, two alternative splicing events with the potential to produce functional sodium channels have been described. The first involves the potential use of mutually exclusive, alternative exon 6 (coding exon 5) sequences that encode parts of transmembrane segments S3 and S4 within domain I (Fig. 2 and Refs. 14Plummer N.W. McBurney M.W. Meisler M.H. J. Biol. Chem. 1997; 272: 24008-24015Abstract Full Text Full Text PDF PubMed Scopus (133) Google Scholar and 15Plummer N.W. Galt J. Jones J.M. Burgess D.L. Sprunger L.K. Kohrman D.C. Meisler M.H. Genomics. 1998; 54: 287-296Crossref PubMed Scopus (80) Google Scholar). The 92 nucleotide (nt) alternative exons, which are found in human, mouse, and rat genomic sequence and known to be used in other sodium channel family members, code for nearly identical amino acid sequences that differ at only two positions. The second, described in mouse and rat, involves the use of alternative 5′-splice donor sites in exon 12 (coding exon 11), which encodes a portion of the cytoplasmic loop between domains I and II (Fig. 2 and Ref. 12Dietrich P.S. McGivern J.G. Delgado S.G. Koch B.D. Eglen R.M. Hunter J.C. Sangameswaran L. J. Neurochem. 1998; 70: 2262-2272Crossref PubMed Scopus (103) Google Scholar). The resulting channels differ by 11 amino acid residues, and these isoforms exhibit distinct electrophysiological properties (Table I and Ref. 12Dietrich P.S. McGivern J.G. Delgado S.G. Koch B.D. Eglen R.M. Hunter J.C. Sangameswaran L. J. Neurochem. 1998; 70: 2262-2272Crossref PubMed Scopus (103) Google Scholar). Given conservation of the respective genomic sequences, we hypothesized that these alternative splice events might be expressed in human tissues. Gene-specific amplification primers for SCN8A were used to generate RT-PCR products from human DRG, and sequencing confirmed usage of both mutually exclusive exon 6 cassettes and alternative splice donor sites in exon 12 (Fig. 2). Inspection of genomic sequence of human, mouse and rat SCN9A suggested it has a gene structure similar to SCN8A. Specifically, the genome sequences from all three species encode potentially mutually exclusive exon 5 sequences, and evidence for alternative splicing of the rabbit paralog was deduced from cDNA sequences (24Belcher S.M. Zerillo C.A. Levenson R. Ritchie J.M. Howe J.R. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 11034-11038Crossref PubMed Scopus (71) Google Scholar). Similarly, conservation of exon 11 alternative splice donor sites was found in human, mouse and rat genomic sequences, and evidence for alternative splicing was suggested by comparison of human, rat, and rabbit cDNA sequences (12Dietrich P.S. McGivern J.G. Delgado S.G. Koch B.D. Eglen R.M. Hunter J.C. Sangameswaran L. J. Neurochem. 1998; 70: 2262-2272Crossref PubMed Scopus (103) Google Scholar). Confirmation that both of alternative splice events occur in human SCN9A was obtained by sequencing of RT-PCR products amplified from human DRG (Fig. 2).Fig. 2Alternative splicing of SCN8A, SCN9A, and SCN11A transcripts.A, neonatal (N) and adult (A) alternative splices involve the use of mutually exclusive alternative exons. The RefSeq (RS; human SCN8A [NM_014191.1], human SCN9A [NM_002977.1]), and extended (EXT) coding exon 11 sequences are generated by the use of alternative splice donor sites. The SCN11A variant was generated by exon skipping (3Kan Z. Castle J. Johnson J.M. Tsinoremas N.F. Pac. Symp. Biocomput. 2004; : 42-53PubMed Google Scholar). B, sodium channel transcripts are represented as a line, with the encoded pore-forming transmembrane domains shown as numbered rectangles. SCN8A and SCN9A are represented by the top gene structure. Both gene transcripts undergo analogous splicing events. SCN11A is shown as the bottom transcript with the position of the exon-skipping event denoted. C, nucleotide sequences of alternative exons, exon extensions, and the skipped SCN11A exon.View Large Image Figure ViewerDownload (PPT)Cross-species comparative studies using a combined paralog/ortholog approach also revealed a novel, alternatively spliced isoform of SCN11A. Sodium channel genes SCN5A, SCN10A, and SCN11A share a similar gene struc
Referência(s)