Portal de Periódicos da CAPES

Alterations in Global Patterns of Gene Expression in Synechocystis sp. PCC 6803 in Response to Inorganic Carbon Limitation and the Inactivation of ndhR, a LysR Family Regulator

2004; Elsevier BV; Volume: 279; Issue: 7 Linguagem: Inglês

10.1074/jbc.m311336200

1083-351X

Hongliang Wang, Bradley L. Postier, Robert L. Burnap,

Microbial Community Ecology and Physiology

The cyanobacterium Synechocystis sp. PCC 6803 possesses multiple inorganic carbon (Ci) uptake systems that are regulated by Ci availability. The control mechanisms of these systems and their integration with other cell functions remain to be clarified. An analysis of the changes in global gene expression in response to Ci downshift and the inactivation of ndhR (sll1594), a LysR family regulator of Ci uptake is presented in this report. Mild Ci limitation (3% CO2 (v/v) in air to air alone) induced a dramatic up-regulation of genes encoding both inducible CO2 and HCO3- uptake systems. An induction of ndhD5/ndhD6 and other genes in a probable transcriptional unit was observed, suggesting a function in inducible Ci uptake. The expression of slr1513 and sll1735, physically clustered with sbtA and ndhF3/ndhD3/cupA, respectively, were also coordinated with upstream genes encoding the essential components for HCO3- and CO2 uptake. Ci limitation induced the regulatory genes slr1214, sll1292, slr1594, sigD, sigG, and sigH, among which slr1214, a two-component response regulator, showed the earliest induction, implying a role for the early response to Ci limitation. Opposite regulation of genes encoding the assimilation of carbon and nitrogen demonstrated a striking coordination of expression to balance C- and N-fluxes. The analyses revealed that ndhR inactivation up-regulated the expression of sbtA/sbtB, ndhF3/ndhD3/cupA/sll1735, and slr2006-13 including ndhD5 and ndhD6, indicating a vital role of this regulatory gene in both CO2 and HCO3-acquisition of the cyanobacterium. We therefore suggest that ndhR be renamed ccmR to better represent its broader regulatory characteristics. The cyanobacterium Synechocystis sp. PCC 6803 possesses multiple inorganic carbon (Ci) uptake systems that are regulated by Ci availability. The control mechanisms of these systems and their integration with other cell functions remain to be clarified. An analysis of the changes in global gene expression in response to Ci downshift and the inactivation of ndhR (sll1594), a LysR family regulator of Ci uptake is presented in this report. Mild Ci limitation (3% CO2 (v/v) in air to air alone) induced a dramatic up-regulation of genes encoding both inducible CO2 and HCO3- uptake systems. An induction of ndhD5/ndhD6 and other genes in a probable transcriptional unit was observed, suggesting a function in inducible Ci uptake. The expression of slr1513 and sll1735, physically clustered with sbtA and ndhF3/ndhD3/cupA, respectively, were also coordinated with upstream genes encoding the essential components for HCO3- and CO2 uptake. Ci limitation induced the regulatory genes slr1214, sll1292, slr1594, sigD, sigG, and sigH, among which slr1214, a two-component response regulator, showed the earliest induction, implying a role for the early response to Ci limitation. Opposite regulation of genes encoding the assimilation of carbon and nitrogen demonstrated a striking coordination of expression to balance C- and N-fluxes. The analyses revealed that ndhR inactivation up-regulated the expression of sbtA/sbtB, ndhF3/ndhD3/cupA/sll1735, and slr2006-13 including ndhD5 and ndhD6, indicating a vital role of this regulatory gene in both CO2 and HCO3-acquisition of the cyanobacterium. We therefore suggest that ndhR be renamed ccmR to better represent its broader regulatory characteristics. Inorganic carbon (Ci) 1The abbreviations used are: Ciinorganic carbonCCMinorganic carbon concentrating mechanismCUPCO2 uptakeRubiscoribulose-bisphosphate carboxylase/oxygenaseORFopen reading frameTES2-{[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]amino}ethanesulfonic acidRTreverse transcriptionGSglutamine synthetaseGOGATglutamate synthase. is an essential and often limiting inorganic substrate for oxygenic photosynthesis. For aquatic photosynthetic species including cyanobacteria, Ci is acquired either as HCO3- or as dissolved CO2. Cyanobacteria have evolved a complex Ci concentrating mechanism (CCM) that functions to increase the intracellular concentration of CO2 to overcome the low affinity of the carbon-fixing enzyme, Rubisco (1Badger M.R. Price G.D. J. Exp. Bot. 2003; 54: 609-622Crossref PubMed Scopus (599) Google Scholar, 2Kaplan A. Reinhold L. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1999; 50: 539-570Crossref PubMed Scopus (577) Google Scholar, 3Price G.D. Sultemeyer D. Klughammer B. Ludwig M. Badger M.R. Can. J. Bot. 1998; 76: 973-1002Google Scholar). The CCM is regulated to optimize growth under varying Ci availabilities. Expression of the CCM is maximal under conditions of Ci limitation, whereas constitutive levels of CCM activity are observed even under Ci replete conditions. Four Ci acquisition systems have been described for Synechocystis sp. PCC 6803 and Synechococcus sp. PCC 7942 (hereafter Synechocystis 6803 and Synechococcus 7942, respectively) (1Badger M.R. Price G.D. J. Exp. Bot. 2003; 54: 609-622Crossref PubMed Scopus (599) Google Scholar). An ABC-type HCO3- transporter encoded by cmpABCD operon and a potential Na+/HCO3- symporter encoded by sbtA have been identified and thus represent specific HCO3- transporters driven by ATP and the trans-cytoplasmic membrane Na+ gradient, respectively (4Shibata M. Katoh H. Sonoda M. Ohkawa H. Shimoyama M. Fukuzawa H. Kaplan A. Ogawa T. J. Biol. Chem. 2002; 277: 18658-18664Abstract Full Text Full Text PDF PubMed Scopus (209) Google Scholar, 5Omata T. Price G.D. Badger M.R. Okamura M. Gohta S. Ogawa T. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 13571-13576Crossref PubMed Scopus (192) Google Scholar). CO2 uptake (CUP) relies on a carbonic anhydrase-like entity that catalyzes the active CO2 hydration and is energized by type I NAD(P)H dehydrogenase (NDH-1) complexes presumed to be situated on the thylakoid membrane (1Badger M.R. Price G.D. J. Exp. Bot. 2003; 54: 609-622Crossref PubMed Scopus (599) Google Scholar, 6Kaplan A. Helman Y. Tchernov D. Reinhold L. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 4817-4818Crossref PubMed Scopus (24) Google Scholar). The CUP-mediated hydration of CO2 inside cells maintains an inwardly directed CO2 concentration gradient across cytoplasmic membranes such that external CO2 continuously diffuses into cells, perhaps mainly through water channels (7Tchernov D. Helman Y. Keren N. Luz B. Ohad I. Reinhold L. Ogawa T. Kaplan A. J. Biol. Chem. 2001; 276: 23450-23455Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar). Thus, in addition to its well established roles in respiratory and cyclic photosynthetic electron transport, the cyanobacterial NDH-1 complex is also essential for CUP activity. Elegant genetic analyses in the cyanobacteria Synechococcus 7942 and Synechocystis 6803 reveal that cyanobacterial CUP activity requires specialized forms of the NDH-1 complex that appear to incorporate evolutionary modifications in the subunit composition of the canonical type I NDH respiratory complex (1Badger M.R. Price G.D. J. Exp. Bot. 2003; 54: 609-622Crossref PubMed Scopus (599) Google Scholar, 8Maeda S. Badger M.R. Price G.D. Mol. Microbiol. 2002; 43: 425-435Crossref PubMed Scopus (155) Google Scholar, 9Ohkawa H. Pakrasi H.B. Ogawa T. J. Biol. Chem. 2000; 275: 31630-31634Abstract Full Text Full Text PDF PubMed Scopus (170) Google Scholar, 10Klughammer B. Sultemeyer D. Badger M.R. Price G.D. Mol. Microbiol. 1999; 32: 1305-1315Crossref PubMed Scopus (94) Google Scholar). These alternative forms of the NDH-1 complex contain the products of variant ndhD and ndhF genes, which are found as members of paralogous multigene families. This contrasts with other core ndh genes, which are typically found as single copies in the genomes of Synechococcus 7942 and Synechocystis 6803. The CUP systems possess a third type of gene (alternatively designated as chp or cup) encoding a novel protein hypothesized to be responsible for the actual CO2 hydration activity (8Maeda S. Badger M.R. Price G.D. Mol. Microbiol. 2002; 43: 425-435Crossref PubMed Scopus (155) Google Scholar, 9Ohkawa H. Pakrasi H.B. Ogawa T. J. Biol. Chem. 2000; 275: 31630-31634Abstract Full Text Full Text PDF PubMed Scopus (170) Google Scholar, 10Klughammer B. Sultemeyer D. Badger M.R. Price G.D. Mol. Microbiol. 1999; 32: 1305-1315Crossref PubMed Scopus (94) Google Scholar). These genes are organized into two systems, one constitutive, low affinity system (ndhF4/ndhD4/cupB) and one inducible high affinity system (ndhF3/ndhD3/cupA) (11Shibata M. Ohkawa H. Kaneko T. Fukuzawa H. Tabata S. Kaplan A. Ogawa T. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 11789-11794Crossref PubMed Scopus (200) Google Scholar). Although the products of the ndhD1, ndhD2, ndhF1, and ndhF2 genes appear to function in cyclic and respiratory electron transport, the roles of other ndhD and ndhF paralogs, such as ndhD5 and ndhD6, remain to be elucidated (1Badger M.R. Price G.D. J. Exp. Bot. 2003; 54: 609-622Crossref PubMed Scopus (599) Google Scholar). inorganic carbon inorganic carbon concentrating mechanism CO2 uptake ribulose-bisphosphate carboxylase/oxygenase open reading frame 2-{[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]amino}ethanesulfonic acid reverse transcription glutamine synthetase glutamate synthase. Although considerable progress has been obtained in defining the structural genes required for the CCM, some progress toward understanding the regulatory circuits governing their expression has also been made. A LysR-type transcription regulator, NdhR, negatively controls the expression of its own gene and NDH-1 genes (ndhF3/ndhD3) in Synechocystis 6803 (12Figge R.M. Cassier-Chauvat C. Chauvat F. Cerff R. Mol. Microbiol. 2001; 39: 455-468Crossref PubMed Scopus (83) Google Scholar). Interestingly, NdhR also regulates the expression of a gene encoding a Na+/H+ antiporter (i.e. nhaS1 (slr1727)), suggesting that it may exert control over other Na+ or H+ translocation systems. The CO2- and Na+-dependent HCO3- uptake activities in cyanobacteria demand Na+ at micromolar and millimolar levels, respectively (3Price G.D. Sultemeyer D. Klughammer B. Ludwig M. Badger M.R. Can. J. Bot. 1998; 76: 973-1002Google Scholar). For Synechocystis 6803 cells grown at low Ci, Na+ is indispensable because of its low capacity for Na+-independent HCO3- transport, in contrast to other cyanobacteria, which are found to perform efficient Na+-independent HCO3- transport under the same conditions (13So A. Kassam A. Espie G. Can. J. Bot. 1998; 76: 1084-1091Google Scholar). A Na+ gradient drives the Na+-dependent HCO3- transporter (SbtA). Sodium also acts as a counter ion for Na+/H+ antiporters operating to maintain pH homeostasis during the light-dependent episodes of proton release and uptake as a result of the cytoplasmic hydration of CO2 and the dehydration of HCO3- by carbonic anhydrase activity in the carboxysome, where CO2 is carboxylated by Rubisco. The coordinated expression of the genes encoding the key CCM components under relatively severe Ci starvation has been more recently investigated (14McGinn P.J. Price G.D. Maleszka R. Badger M.R. Plant Physiol. 2003; 132: 218-229Crossref PubMed Scopus (105) Google Scholar). To further contribute to this effort, the present paper describes the genome-wide expression patterns in Synechocystis 6803 cells subjected to relatively mild Ci limitation as analyzed using DNA microarrays. The investigation not only reveals the expression of both known and previously unknown genes likely involved in the CCM, it also provides greater insight into the genome-wide expression modulation of genes involving the processes, such as N-assimilation and photosynthesis, that allow the cyanobacterium to maximize metabolic fitness during Ci limitation. Additionally, an ndhR mutant was constructed and the analysis of the mutant has led to the better definition of critical components of a CCM regulon. The results indicate that NdhR regulates a gene cluster that harbors the ndhD5 and ndhD6 genes, as well as the Na+/HCO3- symport genes, sbtA, and its downstream putative ORF, slr1513 (designated sbtB, more recently), thus extending the group of known NdhR-regulated Ci genes beyond the initially determined ndhF3/ndhD3/cupA operon (12Figge R.M. Cassier-Chauvat C. Chauvat F. Cerff R. Mol. Microbiol. 2001; 39: 455-468Crossref PubMed Scopus (83) Google Scholar). Growth Conditions—The wild-type and mutant cells of Synechocystis 6803 were grown photoautotrophically at 32 °C (water bath) in BG-11 medium buffered with 20 mm TES-KOH at pH 8.0, and bubbled with 3% CO2 in air (v/v). Experimental cultures were grown in 600-ml batches in 1-liter Roux bottles (Corning). For Ci-limited culture, Na2CO3 was omitted from BG-11 medium. The modified BG-11 was also buffered with 20 mm TES-KOH at pH 7.0, to inhibit the formation of HCO3-. The pre-cultures of the wild-type and mutant cells grown at logarithmic phase under CO2-enriched conditions (3% in air, v/v) were used to inoculate the experimental cultures at starting cell densities with an OD750 nm of 0.2. A relatively mild Ci stress was applied by switching the aeration from 3% CO2 in air (v/v) to air alone (350 ppm CO2, Ci-limited). Continuous illumination was provided by Cool White (General Electric) fluorescent lamps with an incident flux of ∼50 μmol m-2 s-1 as measured with a sensor (LI-COR, Lincoln, NE). Continuous measurement of relative cell density was obtained using modulated beam (850 nm) industrial turbidity monitors (Banner Engineering, Minneapolis, MN) connected to a computer to record the turbidity data. The relative optical density measured by this instrument closely parallels the more typically used OD750 nm measured in a standard spectrophotometer because there are no major pigment absorptions in whole cells at either of these wavelengths and scattering properties of cells are similar. However, spectrophotometric OD750 nm determinations were used when absolute optical densities were used to facilitate standardization of the experiments. Solid medium contained BG-11 buffered with 10 mm TES-KOH, pH 8.0, and was supplemented with 1.5% agar and 5 mm sodium thiosulfate. Construction of the ndhR Deletion Mutant—Gene deletion was accomplished by transformation of the wild type with mutagenic DNA fragments prepared using a fusion PCR approach (15Wang H.L. Postier B.L. Burnap R.L. BioTechniques. 2002; 33: 26-30Crossref PubMed Scopus (34) Google Scholar, 16Wang H.L. Postier B.L. Burnap R.L. Mol. Microbiol. 2002; 44: 1493-1506Crossref PubMed Scopus (51) Google Scholar). The genomic sequence of Synechocystis 6803 was obtained through Cyanobase (www.kazusa.or.jp/cyano/cyano.html) to design the primers used to amplify the ndhR (sll1594) gene-flanking segments (Table I). Care was taken to ensure that only the target gene ORF was knocked out. The plasmid pRL563, supplied by the Wolk group (17Elhai J. Wolk C.P. Gene (Amst.). 1988; 68: 119-138Crossref PubMed Scopus (374) Google Scholar), was used as template to amplify the selectable cassette encoding the genes for resistance to streptomycin/spectinomycin (Sm/Sp) (17Elhai J. Wolk C.P. Gene (Amst.). 1988; 68: 119-138Crossref PubMed Scopus (374) Google Scholar). Purified genomic DNA served as the PCR template to verify the complete segregation of the ndhR deletion strain (18Williams J.G.K. Methods Enzymol. 1988; 167: 766-778Crossref Scopus (851) Google Scholar).Table IOligonucleotide sequences used in this studyPrimerSequence (5′ → 3′)aBoldface indicates homology to the selectable markersll1594 (ndhR)bGene identification numbers are as in Cyanobase (www.kazusa.or.jp/cyano/Synechocystis). Previously assigned gene names are shown in parentheses UpstreamCAATTTCACATCGACAAAGGCCAGTTTGTTCGCCCAGCTTCTGTATGTGTAAGGTTGCTTGCATGTCCTTG DownstreamGCGTGCATAATAAGCCCTACACAAGAGCAATTAACGACCCAACAAACCAATAATCAGGCCAAGGCGGAAAT Streptomycin/spectinomycinCATACAGAAGCTGGGCGAACAAACTTGTGTAGGGCTTATTATGCACGCRT-PCR sll0218CTACTGGAAACGGTGCAGGACTTTATTTCAGGATCGACCCCTTCAAAC sll1594 (ndhR)TTTACGCTTGGCAGTGATTACCACCATTACTACCCAATTCCAACCGCA sll1732 (ndhF3)AAGGTCCAATTCCCGCCACTATAAGACCACCGTATTGGGTCAAATC sll1734 (cupA)CAACATGGAGTTTGCAGAGGCATTCGCCATCAATATAAACATGGTGA slr0040 (cmpA)GCAACAAGGTGCCCATGTATGTATTAGTTAAACCGGCCATGTAGCCAAT slr1512 (sbtA)AGTCAGTGGCTCTACAATGGCTGCTTCATAGACACTTTCCGGCTTGGT slr2007 (ndhD5)TTTTAGCGGTTTAACCCAAGCTCCAGAGCATAAAAACCGCCAGCAA rnpBAGTTAGGGAGGGAGTTGCGGATTCCTTGGGGAGTTATCTATCTGGGAAa Boldface indicates homology to the selectable markerb Gene identification numbers are as in Cyanobase (www.kazusa.or.jp/cyano/Synechocystis). Previously assigned gene names are shown in parentheses Open table in a new tab Isolation of Total RNA—After incubation under designated conditions, a 100-ml aliquot of culture was immediately combined with an equal volume of ice-cold mixture of phenol and ethanol (1:10, w/v) in an ice bath to prevent degradation of RNA (19Mikami K. Kanesaki Y. Suzuki I. Murata N. Mol. Microbiol. 2002; 46: 905-915Crossref PubMed Scopus (159) Google Scholar). The resultant cells were collected by centrifugation at 1000 × g for 10 min at 4 °C. Total RNA was isolated with RNeasy Midi Kit (Qiagen, Valencia, CA) following the protocol from the manufacturer. The resulting RNA was further treated with the DNA-free kit (Ambion, Austin, TX) to remove trace amounts of contaminating genomic DNA. RT-PCR Analysis—RT-PCR primers were designed to amplify 350-400 bp of internal coding region of each gene (Table I). Reverse transcription reactions were performed with the reverse primer of each gene using Superscript II (Invitrogen). The resulting cDNA was used as the template for RT-PCR (20Chelly J. Kahn A. Mullis K.B. Ferre F. Gibbs R.A. The Polymerase Chain Reaction. Birkhauser, Boston1994: 97-109Google Scholar). Amplified products were electrophoretically examined on 1% agarose gels. The transcript abundance of rnpB encoding RNase P in each sample served as a control. Preparation of Fluorescently Labeled Probes for DNA Microarray Analysis—Total RNA extraction for DNA microarray hybridization was as described above. Fluorescently labeled cDNA was produced via a two-step procedure involving cDNA synthesis in a reverse transcriptase reaction incorporating aminoallyl-modified deoxynucleotide, followed by the second step involving chemical coupling of fluorescent dye (either Cy3 or Cy5) to the introduced amino moieties of the synthesized cDNA (21Postier B.L. Wang H.L. Singh A. Impson L. Andrews H.L. Klahn J. Li H. Risinger G. Pesta D. Deyholos M. Galbraith D.W. Sherman L.A. Burnap R.L. BMC Genomics. 2003; 4: 23Crossref PubMed Scopus (29) Google Scholar). Briefly, 16 μg of total RNA served as the template of cDNA synthesis using 10 μg of random 8-base oligonucleotides (Sigma-Genosys, The Woodlands, TX) and Superscript II reverse transcriptase (Invitrogen). The resultant cDNA was purified with Millipore Microcon 30 centrifugal filter devices (Billerica, MA) and resuspended in 0.1 m Na2CO3 at pH 9.0. The cDNA labeling reaction with Cy3 or Cy5 dyes (Amersham Biosciences) was carried out at room temperature in the dark for 1 h and then quenched by the addition of 4 m hydroxylamine, followed by incubation for an additional 5 min. The Cy3 or Cy5 dye-coupled cDNA samples were combined and purified using a Qiagen PCR product purification kit according to the specifications from the manufacturer. Hybridization of DNA Microarray and Data Analysis—Labeled probes were adjusted to 14.75 μl, and the remainder of the hybridization components containing 2.5 μl of 10 μg μl-1 salmon sperm DNA, 8.75 μl of 20× SSC, 0.25 μl of 10% SDS, and 8.75 μl of formamide were added. The mixture was then heated for 2 min at 99 °C and maintained at 42 °C until hybridization. 3168 genes or putative ORFs of Synechocystis 6803 were printed in quadruplicate on Telechem (Sunnyvale, CA) slides (21Postier B.L. Wang H.L. Singh A. Impson L. Andrews H.L. Klahn J. Li H. Risinger G. Pesta D. Deyholos M. Galbraith D.W. Sherman L.A. Burnap R.L. BMC Genomics. 2003; 4: 23Crossref PubMed Scopus (29) Google Scholar). Printed slides were baked at 80 °C for 1 h and then subjected to a UV-cross-linking at a dose of 150 mJ cm-2. The slide was washed at room temperature in 0.1% SDS, washed in deionized water to remove unbound material, and then boiled in deionized water for 3 min to denature the printed DNA. Prehybridization was performed by incubating the slide in 25% formamide, 5× SSC, 0.1% SDS, and 1% bovine serum albumin for at least 45 min at 42 °C. The slide was then rinsed with distilled water and dried by low speed centrifugation. The slide was preheated at 42 °C. The pre-warmed probe sample was pipetted and spread uniformly onto a 24 × 60-mm glass coverslip (Fisher Scientific, Hampton, NH), and the pre-warmed slide was inverted and placed with the arrayed surface contacting the probe sample on the coverslip surface. The slide was incubated in a static incubator at 42 °C for 12-16 h and washed by placing in a 250-ml solution of 2× SSC and 0.1% SDS at 42 °C for 5 min with gentle agitation provided by rotation of a magnetic stir bar. The slide was transferred quickly to a 250-ml solution of 0.1× SSC and 0.1% SDS, incubated for 10 min at room temperature with gentle agitation, and washed five additional times in 0.1× SSC for 1 min at room temperature. The slide was then rinsed briefly with deionized water, dried by low speed centrifugation, and stored in the dark until it was scanned. Hybridization signals from the microarray were quantified using GenePix Pro 4.1 (Axon Instruments, Union City, CA). The quality control procedures were conducted in the image analysis software, and then data were saved to Acuity 3.1 (Axon Instruments). Each microarray hybridization was normalized with the Lowess print-tip option in the microarray informatics software. Four to six microarray hybridizations of two independent biological replicates were pooled to create data sets prior to the calculation of average log2 ratio and standard deviation. This study investigated both the response of wild-type cells to Ci limitation and the impact of ndhR inactivation to better define its function in Ci uptake. The ndhR deletion strain, ΔndhR, was constructed by replacement of the ndhR coding sequence with a spectinomycin/streptomycin resistance gene cassette using established procedures, and complete segregation of the mutant allele was verified by PCR analysis (Fig. 1). To apply low Ci stress, the wild-type and mutant cultures were subjected to a downshift in CO2 supply by switching the aeration with 3% CO2 in air (CO2-enriched) to the aeration with air alone (CO2-limited). To enhance the impact of the CO2 downshift, the pools of CO32- and HCO3- dissolved in the culture media were minimized by growing cells in Na2CO3-free BG-11 medium buffered with 20 mm TES-KOH at pH 7.0. The wild-type and ΔndhR cells showed similar rates of growth with 3% CO2 enrichment under the given growth conditions (Fig. 2). After the switch from CO2-enriched to Ci-limited aeration, ∼3 h elapsed before Ci limitation became manifested as a sharp decline of growth rate as monitored by continuous recording of culture turbidity (Fig. 2). The CO2 downshift was routinely performed when the cells reached a density of 0.95 at OD750 nm. However, it was observed that when the downshift was performed at lower cell densities (data not shown), a longer time elapsed before the onset of growth rate decrease, suggesting that levels of Ci were drawn down in a cell density-dependent manner. Although this was not quantified in the present study, recent mass spectroscopic measurements demonstrate a cell- and light-dependent draw-down of [Ci] in the media of Synechocystis 6803 cultures subjected to a more severe Ci limitation protocol involving a switch to CO2-free aeration rather than a switch to ambient CO2 (14McGinn P.J. Price G.D. Maleszka R. Badger M.R. Plant Physiol. 2003; 132: 218-229Crossref PubMed Scopus (105) Google Scholar). Interestingly, after CO2 downshift there was not a gradual slowdown of growth prior to the dramatic drop of apparent growth rate before the inflection period is reached. This may indicate the existence of a threshold [Ci] required for unrestrained growth (Fig. 2). Close inspection of the inflection period during the transition to decreased growth rates revealed that the turbidity of the culture remained constant for the first 20-30 min, and then declined during subsequent 3-5 h before resuming growth. Growth resumed approximately at 10 h after the CO2 downshift, albeit at a lower rate than the rate prior to growth inflection. The growth rate of ΔndhR strain was observed to be slightly lower than that of wild-type cells during the post-inflection resumption of growth. Based on these growth characteristics, sampling time points for analysis of transcript abundances using RT-PCR and DNA microarray methods were established to reveal the gene expression events occurring at the different stages after the CO2 downshift (Fig. 2). The transcript abundances of cupA (sll1734), ndhhF3 (sll1732), cmpA (slr0040), and sbtA (slr1512) at 0, 30, 60, 190, and 360 min after Ci downshift described above were evaluated using semiquantitative RT-PCR. This analysis served as a preliminary screen for establishing a chronological sampling protocol for subsequent microarray analysis. As shown in Fig. 3, a slight induction of cupA, ndhF3, and sbtA expression occurred at 60 min after CO2 downshift. A strongly induced accumulation of these transcripts was observed at 190 min during the inflection period of the growth rate decline caused by CO2 downshift. The high abundance of these transcripts remained through the 360 min of sampling. No increase in the level of cmpA transcripts in wild-type cells was observed at 60 min, but a strong accumulation of cmpA transcripts was observed at 190 and 360 min after CO2 downshift. The loss of ndhR resulted in distinctly different expression patterns of these genes as compared with wild type (Fig. 3). In the mutant cells, the accumulated transcripts of ndhF3 and cupA from ndhF3 operon were observed prior to CO2 downshift, as expected from previous results demonstrating repressor activity of NdhR (12Figge R.M. Cassier-Chauvat C. Chauvat F. Cerff R. Mol. Microbiol. 2001; 39: 455-468Crossref PubMed Scopus (83) Google Scholar). Unexpectedly, the same pattern was observed for sbtA expression in ndhR mutant, hinting that sbtA is also a component of the NdhR regulon (Fig. 3). Interestingly, the accumulation of cupA, ndhF3, and sbtA transcripts in the mutant was further enhanced at 360 min after CO2 downshift, implying that the expression of the key Ci uptake genes is subjected to other regulation mechanisms in the absence of the NdhR at the post-inflection stage. NdhR repressor activity upon cmpA expression is unlikely because no accumulation of cmpA transcript was observed in ndhR mutant prior to CO2 downshift. In fact, the accumulation of cmpA transcripts in the mutant did not occur even at 190 min after CO2 downshift (Fig. 3). The delayed expression of cmpA in the mutant compared with wild-type may result from the constitutive (de-repressed) sbtA expression that accounts for most activity of the HCO3- uptake in Synechocystis 6803 (4Shibata M. Katoh H. Sonoda M. Ohkawa H. Shimoyama M. Fukuzawa H. Kaplan A. Ogawa T. J. Biol. Chem. 2002; 277: 18658-18664Abstract Full Text Full Text PDF PubMed Scopus (209) Google Scholar). Based on RT-PCR analysis, wild-type cells appeared to be still unchallenged by Ci limitation at 30 min after CO2 downshift. Therefore, the time point was not further examined by microarray analysis. However, the investigation was extended to the recovery stage by including a sampling point at 720 min after CO2 downshift (see Fig. 2). As shown in Fig. 4A, there was only a slight change in global expression pattern even at 180 min after CO2 downshift. This point corresponds to the time immediately prior to the growth inflection period. In contrast, a dramatic alteration of global expression happened after another 20 min (200-min sampling point, Fig. 4B), indicating that a wide-reaching change of gene regulation in response to Ci downshift occurs over a short period of time. This also suggests that [Ci] in the medium dropped below a threshold level, thereby triggering the extensive changes of global gene expression at 190-200 min at the given cell density and growth conditions. Using the control sample as a reference, there were 456 ORFs that consistently exhibited expression changes of 2-fold or greater (log2 ratio ≥ 1 or ≤ -1) in at least one of the five sampling time points (60, 180, 200, 360, and 720 min) after CO2 downshift (Fig. 5). Based on the chromosomal proximity and expression pattern, 50 gene clusters were counted among the 456 ORFs (Fig. 5, C1-50). The coordinated up and down-regulation of genes physically clustered on the chromosome may be correlated with operon structure, but this is impossible to evaluate at this level of experimental analysis (22Ehira S. Hamano T. Hayashida T. Kojima K. Nakamoto H. Hiyama T. Ohmori M. Shivaji S. Sato N. FEMS Microbiol. Lett. 2003; 225: 137-142Crossref PubMed Scopus (13) Google Scholar). To show the features of coordinated expression of physically clustered genes, the transcriptional dynamics of the 465 ORFs are presented according to their linear order along the Synechocystis 6803 genome (Fig. 5).Fig. 5Transcriptional dynamics of genes strongly affected by Ci downshift. Cultures were grown in Na2CO3-free BG-11 media buffered with 20 mm TES-KOH, pH 7.0, and bubbled with 3% CO2 in air. RNA was prepared for microarray analysis from cells harvested at 0, 60, 180, 200, 360, and 720 min after the downshift to ambient air. The values shown are log2 ratios of transcript abundance for treated (60, 180, 200, 360, and 720 min after Ci downshift) versus control (0 min) RNA. Average log2 ratios are calculated from the pooled replicates of four t