Portal de Periódicos da CAPES

Iontophoresis and Sonophoresis Stimulate Epidermal Cytokine Expression at Energies That Do Not Provoke a Barrier Abnormality: Lamellar Body Secretion and Cytokine Expression Are Linked to Altered Epidermal Calcium Levels

2003; Elsevier BV; Volume: 121; Issue: 5 Linguagem: Inglês

10.1046/j.1523-1747.2003.12566.x

1523-1747

Eung Ho Choi, Min Jung Kim, Sung Ku Ahn, Byung‐Il Yeh, Seung Hun Lee,

Contact Dermatitis and Allergies

We performed this study to identify whether the expression of epidermal cytokines is altered by changes in epidermal calcium content, independent of skin barrier disruption. Iontophoresis and sonophoresis with the energies that do not disrupt the skin barrier, but induce changes in the epidermal calcium gradient, were applied to the skin of hairless mice. Immediately after iontophoresis and sonophoresis, immersion in a solution containing calcium was carried out, and iontophoresis in either high- or low-calcium solutions was performed. The biopsy specimens were taken for real-time quantitative RT-PCR to detect changes in mRNA level of interleukin-1α (IL-1α), tumor necrosis factor-α (TNF-α), and transforming growth factor-β in the epidermis and for immunohistochemical stain with primary antibodies to IL-1α and TNF-α. The expression of each cytokine mRNA increased in the epidermis treated with iontophoresis and sonophoresis compared to a nontreated control as well as in tape-stripped skin used as a positive control and was lower after immersion in a high-calcium solution than in low-calcium solution. IL-1α and TNF-α immunohistochemical protein staining increased with iontophoresis at low calcium. These studies suggest that changes in epidermal calcium can directly signal expression of epidermal cytokines in vivo, independent of changes in barrier function. We performed this study to identify whether the expression of epidermal cytokines is altered by changes in epidermal calcium content, independent of skin barrier disruption. Iontophoresis and sonophoresis with the energies that do not disrupt the skin barrier, but induce changes in the epidermal calcium gradient, were applied to the skin of hairless mice. Immediately after iontophoresis and sonophoresis, immersion in a solution containing calcium was carried out, and iontophoresis in either high- or low-calcium solutions was performed. The biopsy specimens were taken for real-time quantitative RT-PCR to detect changes in mRNA level of interleukin-1α (IL-1α), tumor necrosis factor-α (TNF-α), and transforming growth factor-β in the epidermis and for immunohistochemical stain with primary antibodies to IL-1α and TNF-α. The expression of each cytokine mRNA increased in the epidermis treated with iontophoresis and sonophoresis compared to a nontreated control as well as in tape-stripped skin used as a positive control and was lower after immersion in a high-calcium solution than in low-calcium solution. IL-1α and TNF-α immunohistochemical protein staining increased with iontophoresis at low calcium. These studies suggest that changes in epidermal calcium can directly signal expression of epidermal cytokines in vivo, independent of changes in barrier function. interleukin iontophoresis for 1 h iontophoresis for 2 h lamellar body nontreated control phosphate-buffered saline stratum corneum stratum granulosum transforming growth factor tumor necrosis factor-α transepidermal water loss sonophoreis for 10 min The skin barrier is composed of corneocytes and intercorneocyte lipid lamellae (Elias, 1983Elias P.M. Epidermal lipids, barrier function and desquamation.J Invest Dermatol. 1983; 80: 44-49Crossref PubMed Google Scholar). Acute disruption of the skin barrier with either solvents or tape stripping produces a homeostatic response in the subjacent nucleated layers of the epidermis, resulting in rapid restoration of normal barrier function (Feingold, 1991Feingold K.R. The regulation of epidermal lipid synthesis by permeability barrier requirements.Critical Reviews in Therapeutic Drug Carrier Systems. Vol 8. CRC Press, Boca Raton (FL)1991: 193-210Google Scholar). This response includes: (1) increased lamellar body (LB) secretion from the outer stratum granulosum (SG) (Menon et al., 1992bMenon G.K. Feingold K.R. Elias P.M. The lamellar body secretory response to barrier disruption.J Invest Dermatol. 1992; 98: 279-289Crossref PubMed Scopus (234) Google Scholar); (2) increased lipid synthesis in all epidermal layers (Menon et al., 1985Menon G.K. Feingold K.R. Moser A.H. Brown B.E. Elias P.M. De novo sterologenesis in the skin. II. Regulation by cutaneous barrier requirements.J Lipid Res. 1985; 26: 418-427Abstract Full Text PDF PubMed Google Scholar;Grubauer et al., 1987Grubauer G. Feingold K.R. Elias P.M. The relationship of epidermal lipogenesis to cutaneous barrier function.J Lipid Res. 1987; 28: 746-752Abstract Full Text PDF PubMed Google Scholar;Feingold et al., 1990Feingold K.R. Mao-Quiang M. Menon G.K. Cho S.S. Brown B.E. Elias P.M. Cholesterol synthesis is required for cutaneous barrier function in mice.J Clin Invest. 1990; 86: 1738-1745Crossref PubMed Scopus (154) Google Scholar;Holleran et al., 1991aHolleran W.M. Feingold K.R. Mao-Quiang M. Gao W.N. Lee J.M. Elias P.M. Regulation of epidermal sphingolipid synthesis by permeability barrier function.J Lipid Res. 1991; 32: 1151-1158Abstract Full Text PDF PubMed Google Scholar); (3) the formation of new LB in SG cells followed by further LB secretion; and (4) increased DNA synthesis in the basal layer of the epidermis (Proksch et al., 1991Proksch E. Feingold K.R. Mao-Quiang M. Elias P.M. Barrier function regulates epidermal DNA synthesis.J Clin Invest. 1991; 87: 1668-1673Crossref PubMed Scopus (221) Google Scholar). Acute disruption of the skin barrier can also increase cytokines expression in the epidermis. It is known that the calcium ion plays an important role in the proliferation and differentiation of keratinocytes in vitro. Nevertheless, there have been few in vivo studies owing to the paucity of adequate experimental models. Recent in vivo studies have shown, however, that manipulation of epidermal calcium in vivo directly regulate epidermal differentiation (Choi et al., 2002Choi E.H. Park W.S. Son E.D. Hwang S.M. Kim M.J. Ahn S.K. Lee S.H. The effect of change in epidermal calcium gradient on stratum corneum lipid and epidermal differentiation.in: Mark R. Leveque J.L. Voegeli R. The Essential Stratum Corneum. Dunitz, London2002: 77-80Crossref Google Scholar;Elias et al., 2002bElias P.M. Ahn S.K. Denda M. et al.Modulations in epidermal calcium regulate the expression of differentiation-specific markers.J Invest Dermatol. 2002; 119: 1128-1136Crossref PubMed Scopus (165) Google Scholar.Iontophoresis using proper electric current (Lee et al., 1998Lee S.H. Choi E.H. Feingold K.R. Jiang S. Ahn S.K. Iontophoresis itself on hairless mouse skin induces the loss of the epidermal calcium gradient without skin barrier impairment.J Invest Dermatol. 1998; 111: 39-43Crossref PubMed Scopus (57) Google Scholar) and sonophoresis using proper ultrasound (Menon et al., 1994Menon G.K. Price L.F. Bommannan B. Elias P.M. Feingold K.R. Selective obliteration of the epidermal calcium gradient leads to enhanced lamellar body secretion.J Invest Dermatol. 1994; 102: 789-795Abstract Full Text PDF PubMed Google Scholar) can induce changes in the epidermal calcium that increase LB secretion without increasing transepidermal water loss (TEWL). From these results we hypothesized that iontophoresis and sonophoresis, if their density or intensity did not disrupt the skin barrier, could be used for in vivo studies to define the expression of cytokines in response to changes in epidermal calcium in vivo. The purpose of this study was to elucidate whether changes in the epidermal calcium gradient can stimulate epidermal cytokine expression. We used iontophoresis and sonophoresis as methods at energy levels that induce changes in the epidermal calcium gradient without altering TEWL and then applied real-time, quantitative RT-PCR and immunohistochemical staining to demonstrate changes in expression of epidermal cytokines. Our results suggest that reduction in epidermal calcium directly stimulate generation of primary cytokines in the epidermis. Adult hairless mice were purchased from the animal laboratory of Yonsei University and were 8–12-wk-old females at the time of study. The use of mice was approved by the institutional review board in Yonsei University Wonju College of Medicine. After attachment of the patches (3.46 cm2) on the £ank of hairless mice, the iontophoresis was performed with direct current (6 V 0.6 mA/3.46 cm2) of on:off duty ratio (2:1) for 1 and 2 h, respectively, the same as described in the previous report, in whichTEWL was not increased after treatment (Lee et al., 1998Lee S.H. Choi E.H. Feingold K.R. Jiang S. Ahn S.K. Iontophoresis itself on hairless mouse skin induces the loss of the epidermal calcium gradient without skin barrier impairment.J Invest Dermatol. 1998; 111: 39-43Crossref PubMed Scopus (57) Google Scholar). The biopsy specimens were taken at 1 and 2 h after patch removal for real-time quantitative RT-PCR and at 1, 3, and 6 h for immunohistochemical stains. Specimens from disrupted skin after tape stripping were used as a positive control, and specimens from skin with a patch but no current, as a normal control. The back of hairless mice was divided into two sections to be used as the treatment site and control site. After anesthesia with chloral hydrate, the treatment sites of the back received 10 min of 300 mW per cm2 1-MHz continuous wave ultrasound (Skin joy, Sonic tech, Korea) treatment as in our previous study (Lee and Choi, 2001Lee S.W. Choi E.H. The effect of ultrasound on the skin of aged and young mice.Kor J Invest Dermatol. 2001; 8: 209-218Google Scholar) in which TEWL was not increased after treatment, and the negative control sites were only dabbed with the transmission gel (Biosonic, Amite) which is generally applied before ultrasound treatment. At 1 and 2 h after ultrasound treatment, skin biopsy specimens were taken. After the treatment with 1 h of iontophoresis (Ion 1 h) and 10 min of sonophoresis (US), the hairless mice were immediately immersed with one flank submerged in phosphate-buffered saline (PBS) solution containing 0.1 mM calcium (PBS + Ca2+) and PBS solution without calcium ion (PBS) for 2 h as described in the previous report (Lee et al., 1992Lee S.H. Elias P.M. Proksch E. Menon G.K. Mao-Quiang M. Feingold K.R. Calcium and potassium are important regulators of barrier homeostasis in murine epidermis.J Clin Invest. 1992; 89: 530-538Crossref PubMed Scopus (177) Google Scholar), and then biopsy specimens were taken. The biopsy skin was used for real-time quantitative RT-PCR and immunohistochemical stain. Nile red stain and OsO4 postfixation for electron microscope were performed for the skin treated with sonophoresis. Nile red, a fluorescence probe for lipids, was used to demonstrate the distribution and content of lipids in the stratum corneum (SC) (Grubauer et al., 1987Grubauer G. Feingold K.R. Elias P.M. The relationship of epidermal lipogenesis to cutaneous barrier function.J Lipid Res. 1987; 28: 746-752Abstract Full Text PDF PubMed Google Scholar). The digital photographs of epidermis (× 200) obtained at random from the cross-sections of each group were compared with the scores defined by intensity and extent of fluorescence in the outermost epidermis. Electron microscope examination after OsO4 postfixation was used to observe the secretion of LB between the SC–SG junction as described previously (Kim et al., 2001Kim T.H. Choi E.H. Kang Y.C. Lee S.H. Ahn S.K. The effects of topical α-hydroxyacids on the normal skin barrier of hairless mice.Br J Dermatol. 2001; 144: 267-273Crossref PubMed Scopus (26) Google Scholar). Iontophoresis using 1.0 mM CaCl2 (high-calcium) solution and 0.03 mM CaCl2 (low-calcium) solution on hairless mice was carried out for 1 h. The skin specimens were taken at 3 h after iontophoresis for real-time quantitative RT-PCR to compare mRNA of interleukin (IL)-1α and tumor necrosis factor-α (TNF-α). The skin specimens were taken after iontophoresis and sonophoresis and performed calcium-capture cyto- chemistry to observe the epidermal calcium under electron microscope as our previous report (Lee et al., 1998Lee S.H. Choi E.H. Feingold K.R. Jiang S. Ahn S.K. Iontophoresis itself on hairless mouse skin induces the loss of the epidermal calcium gradient without skin barrier impairment.J Invest Dermatol. 1998; 111: 39-43Crossref PubMed Scopus (57) Google Scholar). After cervical dislocation, the full-thickness skin specimens were excised immediately and put on a petri dish with epidermal surface facing downward. Subcutaneous fat was removed with a scalpel and floated dermis side down on 10 mL of 10 mM EDTA in Ca-, Mg-free PBS at 37°C for 35 min. The epidermis was then isolated, soaked inTrizol reagent (Gibco BRL, NY), and stored in a –70°C freezer. Total RNA was isolated from each skin obtained after iontophoresis and sonophoresis treatment using Trizol reagent. One microgram of total RNAwas reverse-transcribed with AMV reverse transcriptase (Promega, Madison, WI). Pairs of primers for amplification of IL-1α, TNF-α, and transforming growth factor (TGF)-α were designed using the Primer Express Software (Applied Biosystems, Foster City, CA). In all experiments, primer concentrations were first optimized to avoid unspecific binding of primers, and after running the PCR products, a dissociation curve analysis was performed to verify the specificity of the amplification products. Probe and primer sequences used were as follows: IL-1α probe, CTGTGTAATGAAAGACGGCACACC- CACC; IL-1α forward primer, CAACCAACAAGTGATATTCTCCATG; IL-1α reverse primer, GATCCACACTCTCCAGCTGCA; TNF-α probe, CACGTCGTAGCAAACCACCAAGTGGA; TNF-α forward primer, CATCTTCTCAAAATTCGAGTGACAA; TNF-α reverse primer, TGGG- AGTAGACAAGGTACAACCC; TGF-α probe, TTCAGCGCTCACT- GCTCTTGTGACAG; TGF-α forward primer, TGACGTCACTGGAG- TTGTACGG; TGF-α reverse primer, GGTTCATGTCATGGATGGTGC; GAPDH probe, TGCATCCTACACCACCAACTGCTTAG; GAPDH forward primer, TTCACCACCATGGAGAAGGC; and GAPDH reverse primer, GGCATGGACTGTGGTCATGA (Overbergh et al., 1999Overbergh L. Valckx D. Waer M. Mathieu C. Quantification of murine cytokine mRNAs using real time quantitative reverse transcriptase PCR.Cytokine. 1999; 4: 305-311Crossref Scopus (515) Google Scholar). Real-time quantitative PCR was performed using the ABI Prism 7700 sequence detector (TaqMan, Perkin Elmer/Applied Biosystems, Foster City, CA). The TaqMan PCR conditions were as follows; 15 s at 94°C and 1 min at 60°C with a total of 40 to 45 cycles. Data were analyzed with the software provided with the TaqMan. TaqMan Ct values were followed by GAPDH normalization. To avoid contamination, all assays were performed using the universal thermal cycling parameters (Applied Biosystems) with AmpErase UNG. All experiments were performed in duplicate. For immunohistochemical stains, the skin biopsy was taken at 1, 3, and 6 h after iontophoresis for 1 and 2 h. Tissue samples, quick-frozen and fixated in liquid nitrogen, were placed in a cryomold filled with OCT compound and quick-frozen with isopentane. The frozen tissue samples were then sliced into sections 6 to 8 mm thick with a cryostat, fixed on gelatin-coated slides, and fixated for 5 min with acetone chilled at 20°C. After being rinsed with TBS buffer solution, the tissue sections were cultured in 3% H2O2 for 30 min and rinsed once more with TBS buffer solution. Horse serum (0.5%) and sheep serum (2%) were administered to the sample slides and 30 min was allowed for reactions to proceed. A total of 100 to 150 μL of primary antibodies for IL-1α (Endogen, Woburn, MA) and TNF-α (Endogen, Woburn, MA) was dropped on the slides placed inside a wet box. The slides were left to sit through the reaction for 1 h at room temperature and rinsed with TBS buffer. The samples then received administration of secondary antibodies (EnVision, Dako, Carpinteria, CA), sat for 30 min, and were rinsed with TBS buffer solution. Two drops of diamino- benzidine solutions (Dako) were dropped onto each sample slide and allowed 5 min to stain. The slides were then mounted and observed under the optical microscope with 10 × objective lens and with the intensity profile of the image analyzer. Background coloring was not carried out as part of the diaminobenzidine staining process and the unstained sections were used for analysis. Intensity profile refers to the method used to determine the degree of staining in dyed tissue. The images of specimen observed through the optical microscope were converted into a gray scale and the intensity of stain in the desired area was used to calculate the average, which was used as a reference point or an indicator. Iontophoresis and sonophoresis induced a marked decrease in calcium content in the epidermis, especially the top part, similar to as in our previous report (Lee et al., 1998Lee S.H. Choi E.H. Feingold K.R. Jiang S. Ahn S.K. Iontophoresis itself on hairless mouse skin induces the loss of the epidermal calcium gradient without skin barrier impairment.J Invest Dermatol. 1998; 111: 39-43Crossref PubMed Scopus (57) Google Scholar). We used nile red staining and quantitative electron microscopy to assess changes in LB secretion and lipid deposition in the SC. The £uorescence in the SC after US and nontreated controls (NC) decreased with immersion in PBS containing calcium compared to PBS alone (Fig 1). After sonophoresis treatment, secretion of LB increased at the SC–SG junction in comparison to NC (Fig 2). In contrast, LB secretion was inhibited by immersion in PBS containing calcium compared to PBS only as in the previous report (Menon et al., 1994Menon G.K. Price L.F. Bommannan B. Elias P.M. Feingold K.R. Selective obliteration of the epidermal calcium gradient leads to enhanced lamellar body secretion.J Invest Dermatol. 1994; 102: 789-795Abstract Full Text PDF PubMed Google Scholar) (Fig 2).Figure 2Secretion of LB in the SC–SG junction after US was increased compared to NC. It was inhibited by immersion in PBS containing calcium compared to PBS only. US(PBS), immersion in PBS after ultrasound treatment; US(PBS+Ca2+), immersion in PBS containing calcium after ultrasound treatment; US(air), air exposure after ultrasound treatment.View Large Image Figure ViewerDownload (PPT) We used iontophoresis and sonophoresis, with the energies that did not disrupt the skin barrier but induce changes in the epidermal calcium gradient (Lee et al., 1998Lee S.H. Choi E.H. Feingold K.R. Jiang S. Ahn S.K. Iontophoresis itself on hairless mouse skin induces the loss of the epidermal calcium gradient without skin barrier impairment.J Invest Dermatol. 1998; 111: 39-43Crossref PubMed Scopus (57) Google Scholar; Choi et al., 2002Choi E.H. Park W.S. Son E.D. Hwang S.M. Kim M.J. Ahn S.K. Lee S.H. The effect of change in epidermal calcium gradient on stratum corneum lipid and epidermal differentiation.in: Mark R. Leveque J.L. Voegeli R. The Essential Stratum Corneum. Dunitz, London2002: 77-80Crossref Google Scholar). In this trial, distilled water for iontophoresis and transmission gel for sonophoresis us that did not contain calcium ion were used. The expression of mRNA of IL-1α, TNF-α, and TGF-β increased in murine epidermis at 1 and 2 h after iontophoresis and sonophoresis on skin surface. Results were compared to mRNA levels of NC. Expression of all three cytokines increased in the epidermis after treatment with iontophoresis for 1 h and iontophoresis for 2 h (Ion 2 h) and with US compared to the NC as well as the tape-stripped skin used as a positive control (Figure 3, Figure 4). The expression of all three cytokines in Ion 2 h was increased more than Ion 1 h and US at both 1 and 2 h after treatment. Immunohistochemical stains for IL-1α and TNF-α in epidermis treated with iontophoresis showed increased expression compared to NC. The increased expression was observed from 1 h after iontophoresis and continued to increase at 3 and at 6 h (Figure 5, Figure 6, Figure 7).Figure 4IL-1α, TNF-α, and TGF-β expression are increased in murine epidermis at 2 h after iontophoresis and ultrasound on skin surface. Total RNA was extracted, reverse-transcribed, and analyzed by real-time quantitative RT-PCR using GAPDH as an endogenous control. Results are illustrated relative to the mRNA levels of the NC. All three cytokines showed increased expression in iontophoresis treated skin for 1 h (Ion 1 h) and 2 h (Ion 2 h) and ultrasound-treated skin (US) compared to the NC as well as tape-stripped skin (TS) used as a positive control.View Large Image Figure ViewerDownload (PPT)Figure 5Immunohistochemical stain of TNF-α after 2 h positive iontophoresis.nl, control; 1h, 1 h after iontophoresis; 3h, 3 h after iontophoresis; 6h, 6 h after iontophoresis.View Large Image Figure ViewerDownload (PPT)Figure 6IL-1α expression after iontophoresis.nl, control; 1h, 1 h after iontophoresis; 3h, 3 h after iontophoresis; 6h, 6 h after iontophoresis.View Large Image Figure ViewerDownload (PPT)Figure 7TNF-α expression after iontophoresis.nl, control; 1h, 1 h after iontophoresis; 3h, 3 h after iontophoresis; 6h, 6 h after iontophoresis.View Large Image Figure ViewerDownload (PPT) To assess whether the expression of mRNA of IL-1α, TNF-α, and TGF-β was stimulated directly by changes in epidermal calcium, we used two unrelated models. First, we employed the immersion technique, with solutions containing calcium, described previously (Lee et al., 1992Lee S.H. Elias P.M. Proksch E. Menon G.K. Mao-Quiang M. Feingold K.R. Calcium and potassium are important regulators of barrier homeostasis in murine epidermis.J Clin Invest. 1992; 89: 530-538Crossref PubMed Scopus (177) Google Scholar; Lee et al., 1994Lee S.H. Elias P.M. Feingold K.R. Mauro T. A role for ions in barrier recovery after acute perturbation.J Invest Dermatol. 1994; 102: 976-979Abstract Full Text PDF PubMed Google Scholar). The expression of mRNA of all three cytokines decreased in murine epidermis after 2 h of immersion in PBS containing high calcium versus PBS only (control) after Ion 1 h and US on the skin surface. Results are illustrated as the reduction rate (percentage) on the control (Fig 8A). In the second experiment, we compared cytokine expression after iontophoresis of high versus low calcium. mRNA of IL-1α was 21% lower than following iontophoresis of low calcium, and TNF-α levels also were decreased by 66% in low versus high calcium (Fig 8B). Together, these results suggest that change in calcium ion alone and specifcally a reduction in epidermal calcium ion stimulate cytokine generation in vivo. For some time it has been suggested that reduction in calcium levels comprise a signal that initiates the barrier repair response after barrier disruption. Disruption of the epidermal permeability barrier causes an immediate loss of the calcium gradient, and barrier recovery is parallel with the restoration of the calcium gradient in the epidermis (Menon et al., 1992aMenon G.K. Elias P.M. Lee S.H. Feingold K.R. Localization of calcium in murine epidermis following disruption and repair of the permeability barrier.Cell Tissue Res. 1992; 270: 503-512Crossref PubMed Scopus (155) Google Scholar). Artifcial restora- tion of the barrier function by occlusion with a water vapor-im- permeable membrane abrogates the expected increase in lipid synthesis and retards the barrier recovery, as well as block the nor- malization of the epidermal calcium gradient (Menon et al., 1992bMenon G.K. Feingold K.R. Elias P.M. The lamellar body secretory response to barrier disruption.J Invest Dermatol. 1992; 98: 279-289Crossref PubMed Scopus (234) Google Scholar, Menon et al., 1994Menon G.K. Price L.F. Bommannan B. Elias P.M. Feingold K.R. Selective obliteration of the epidermal calcium gradient leads to enhanced lamellar body secretion.J Invest Dermatol. 1994; 102: 789-795Abstract Full Text PDF PubMed Google Scholar). Prolonged occlusion of tape-stripped epidermis induced transitional cells and delayed the restoration of epidermal calcium gradient until 48 h (Ahn et al., 1999Ahn S.K. Hwang S.M. Jiang S.J. Choi E.H. Lee S.H. The changes of epidermal calcium gradient and transitional cells after prolonged occlusion following tape stripping in the murine epidermis.J Invest Dermatol. 1999; 113: 189-195Crossref PubMed Scopus (30) Google Scholar). Therefore, the state of calcium deprivation after acute barrier perturbation by occlusion is maintained for a very long time. Furthermore, in chronic forms of barrier abnormality such as in essential fatty acid-defcient mice and topical lovastatin-treated mice, the epidermal calcium gradient is abnormal (Menon et al., 1994Menon G.K. Price L.F. Bommannan B. Elias P.M. Feingold K.R. Selective obliteration of the epidermal calcium gradient leads to enhanced lamellar body secretion.J Invest Dermatol. 1994; 102: 789-795Abstract Full Text PDF PubMed Google Scholar). In essential fatty acid- defcient mice, occlusion normalizes epidermal calcium gradient within 48 h. Recently, Elias et al., 2002bElias P.M. Ahn S.K. Denda M. et al.Modulations in epidermal calcium regulate the expression of differentiation-specific markers.J Invest Dermatol. 2002; 119: 1128-1136Crossref PubMed Scopus (165) Google Scholar showed direct evidence that permeability barrier status regulates the formation of the epidermal calcium gradient and that passive diffusion rather than active mechanisms appears to suffice to explain gradient formation. Disruption of the epidermal permeability barrier in murine skin stimulates the production of epidermal cytokines including TNF-α, IL-1α, IL-1β, and IL-1ra (Wood et al., 1992Wood L.C. Jackson S.M. Elias P.M. Grunfeld C. Feingold K.R. Cutaneous barrier perturbation stimulates cytokine production in the epidermis of mice.J Clin Invest. 1992; 90: 482-487Crossref PubMed Scopus (387) Google Scholar). An increase of these cytokines was observed in acute barrier disruption by either topical acetone treatment or tape stripping and in essential fatty acid-deficient epidermis (Wood et al., 1992Wood L.C. Jackson S.M. Elias P.M. Grunfeld C. Feingold K.R. Cutaneous barrier perturbation stimulates cytokine production in the epidermis of mice.J Clin Invest. 1992; 90: 482-487Crossref PubMed Scopus (387) Google Scholar;Wood et al., 1994aWood L.C. Feingold K.R. Sequeira-Martin S.M. Elias P.M. Grunfeld C. Barrier function coordinately regulates epidermal IL-1 and IL-1 receptor antagonist mRNA levels.Exp Dermatol. 1994; 3: 56-60Crossref PubMed Scopus (53) Google Scholar, Wood et al., 1994bWood L.C. Elias P.M. Sequeira-Martin S.M. Grunfeld C. Feingold K.R. Occlusion lowers cytokine mRNA levels in essential fatty acid deficient and normal mouse epidermis but not after acute barrier disruption.J Invest Dermatol. 1994; 103: 834-838Crossref PubMed Scopus (81) Google Scholar). A similar result was observed in human skin following tape stripping (Nickoloff and Naidu, 1994Nickoloff B.J. Naidu Y. Perturbation of epidermal barrier function correlates with initiation of cytokine cascade in human skin.J Am Acad Dermatol. 1994; 30: 535-546Abstract Full Text PDF PubMed Scopus (408) Google Scholar). Therefore, the increased level of these cytokines in the epidermis and dermis in response to cutaneous injury has been suggested as an initiator of a homeostatic repair response or an immune/inflammatory reaction in the past (Wood et al., 1996Wood L.C. Elias P.M. Calhoun C. Tsai J.C. Grunfeld C. Feingold K.R. Barrier disruption stimulates interleukin-1α expression and release from a pre-formed pool in murine epidermis.J Invest Dermatol. 1996; 106: 397-403Crossref PubMed Scopus (231) Google Scholar). Latex occlusion of essential fatty acid-deficient mice for 24 to 48 h lowered the mRNA levels of epidermal TNF-α, IL-1α, or IL-1ra to nearly control values. In contrast, latex occlusion of mice immediately after acute barrier disruption blocked neither a stimulation of epidermal mRNA for TNF-α, IL-1α, and IL-1ra, nor an increase of epidermal TNF-α protein (Wood et al., 1994aWood L.C. Feingold K.R. Sequeira-Martin S.M. Elias P.M. Grunfeld C. Barrier function coordinately regulates epidermal IL-1 and IL-1 receptor antagonist mRNA levels.Exp Dermatol. 1994; 3: 56-60Crossref PubMed Scopus (53) Google Scholar, Wood et al., 1994bWood L.C. Elias P.M. Sequeira-Martin S.M. Grunfeld C. Feingold K.R. Occlusion lowers cytokine mRNA levels in essential fatty acid deficient and normal mouse epidermis but not after acute barrier disruption.J Invest Dermatol. 1994; 103: 834-838Crossref PubMed Scopus (81) Google Scholar). Therefore, it was speculated that the generation of cytokines was linked to epidermal injury as a by-product of barrier disruption, rather than as homeostatic signaling mechanisms in the epidermis (Feingold, 1997Feingold K.R. Permeability barrier homeostasis. Its biochemical basis and regulation.Cosmet Toilet. 1997; 112: 49-59Google Scholar). Through many studies it has become evident that the secretion of LB was induced by barrier perturbation that could remarkably induce the loss of calcium ion in the upper epidermis. The loss of calcium from the upper epidermis, following barrier disruption, signals the increased secretion and synthesis of LB, a response that facilitates normal barrier recovery (Lee et al., 1992Lee S.H. Elias P.M. Proksch E. Menon G.K. Mao-Quiang M. Feingold K.R. Calcium and potassium are important regulators of barrier homeostasis in murine epidermis.J Clin Invest. 1992; 89: 530-538Crossref PubMed Scopus (177) Google Scholar). Nevertheless, some reports using sonophoresis and iontophoresis showed that changes in calcium ion in the outer epidermis directly regulate LB secretion, independent of barrier perturbation (Menon et al., 1994Menon G.K. Price L.F. Bommannan B. Elias P.M. Feingold K.R. Selective obliteration of the epidermal calcium gradient leads to enhanced lamellar body secretion.J Invest Dermatol. 1994; 102: 789-795Abstract Full Text PDF PubMed Google Scholar;Lee et al., 1998Lee S.H. Choi E.H. Feingold K.R. Jiang S. Ahn S.K. Iontophoresis itself on hairless mouse skin induces the loss of the epidermal calcium gradient without skin barrier impairment.J Invest Dermatol. 1998; 111: 39-43Crossref PubMed Scopus (57) Google Scholar). Therefore, now it is believed that LB secretion does not mean barrier perturbation. The purpose of our study was to elucidate whether the change of calcium ion in epidermis independent of barrier disruption can induce the cytokine expression. Theoretically there are no doses or direction that can shift calcium ions without LB secretion because the shift of calcium ion in the upper epidermis induces LB secretion. Of course we believe that there may be a threshold to induce LB secretion by a shift of the calcium ion, but we could not find any definite threshold in spite of many trials. We do not insist that any current density of iontophoresis or any intensity of ultrasound will not disrupt the skin barrier. So we used the same electric current and ultrasound by same iontophoresis and sonophoresis devices that were already shown not to induce skin barrier disruption represented by an increase of TEWL and epidermal proliferation (Lee et al., 1998Lee S.H. Choi E.H. Feingold K.R. Jiang S. Ahn S.K. Iontophoresis itself on hairless mouse skin induces the loss of the epidermal calcium gradient without skin barrier impairment.J Invest Dermatol. 1998; 111: 39-43Crossref PubMed Scopus (57) Google Scholar;Choi et al., 1999Choi E.H. Lee S.H. Ahn S.K. Hwang S.M. The pretreatment effect of chemical skin penetration enhancers in transdermal drug delivery using iontophoresis.Skin Pharmacol Appl Skin Physiol. 1999; 12: 326-335Crossref PubMed Scopus (66) Google Scholar,Choi et al., 2001Choi E.H. Ahn S.K. Lee S.H. The effect of repeated changes in the epidermal calcium gradient by repeated iontophoresis on the skin barrier.J Skin Barrier Res (Korean). 2001; 3: 62-67Google Scholar, Choi et al., 2002Choi E.H. Park W.S. Son E.D. Hwang S.M. Kim M.J. Ahn S.K. Lee S.H. The effect of change in epidermal calcium gradient on stratum corneum lipid and epidermal differentiation.in: Mark R. Leveque J.L. Voegeli R. The Essential Stratum Corneum. Dunitz, London2002: 77-80Crossref Google Scholar). The epidermal expression of mRNA of IL-1α, TNF-α, and TGF-β increased at 1 and 2 h after iontophoresis and sonophoresis. All three cytokines showed increased expression in Ion 1 h, Ion 2 h, and US compared to NC as well as tape-stripped skin used as a positive control (Figure 1, Figure 2). Tape stripping is known as a method increasing the expression of epidermal IL-1α and TNF-α mRNA from previous studies (Wood et al., 1992Wood L.C. Jackson S.M. Elias P.M. Grunfeld C. Feingold K.R. Cutaneous barrier perturbation stimulates cytokine production in the epidermis of mice.J Clin Invest. 1992; 90: 482-487Crossref PubMed Scopus (387) Google Scholar,Wood et al., 1994aWood L.C. Feingold K.R. Sequeira-Martin S.M. Elias P.M. Grunfeld C. Barrier function coordinately regulates epidermal IL-1 and IL-1 receptor antagonist mRNA levels.Exp Dermatol. 1994; 3: 56-60Crossref PubMed Scopus (53) Google Scholar, Wood et al., 1994bWood L.C. Elias P.M. Sequeira-Martin S.M. Grunfeld C. Feingold K.R. Occlusion lowers cytokine mRNA levels in essential fatty acid deficient and normal mouse epidermis but not after acute barrier disruption.J Invest Dermatol. 1994; 103: 834-838Crossref PubMed Scopus (81) Google Scholar, Wood et al., 1996Wood L.C. Elias P.M. Calhoun C. Tsai J.C. Grunfeld C. Feingold K.R. Barrier disruption stimulates interleukin-1α expression and release from a pre-formed pool in murine epidermis.J Invest Dermatol. 1996; 106: 397-403Crossref PubMed Scopus (231) Google Scholar). In the previous studies the expression of cytokines mRNA after tape stripping was remarkably increased, four- to sevenfold. Nevertheless, in our result it was not so high. We thought that it might be from the practical method using tape stripping. Because we only stripped five times in all mice without checking the TEWL, we might not have mice with the barrier enough disrupted. Nevertheless, the remarkable increase of all cytokines expression was observed in Ion 2 h, US, and some Ion 1 h. In our preliminary study using RT-PCR, we observed the same results after using iontophoresis and sonophoresis. Therefore, we decided to confirm the results with real-time quantitative RT-PCR. The expression of all three cytokines was increased in Ion 2 h compared to Ion 1 h and US at both 1 and 2 h after treatment. From our previous research using iontophoresis, we found that calcium deprivation in the epidermis was increased with current time (Lee et al., 1998Lee S.H. Choi E.H. Feingold K.R. Jiang S. Ahn S.K. Iontophoresis itself on hairless mouse skin induces the loss of the epidermal calcium gradient without skin barrier impairment.J Invest Dermatol. 1998; 111: 39-43Crossref PubMed Scopus (57) Google Scholar). Therefore, these results were more compatible with our hypothesis. TGF-β is known as an inhibitory cytokine to inflammation and related to cancer and wound healing (Massague, 1990Massague J. The transforming growth factor-β family.Annu Rev Cell Biol. 1990; 6: 597-641Crossref PubMed Scopus (2947) Google Scholar). TGF-β mRNA is increased in the epidermis after perturbation of the skin barrier in humans and hairless mice (Nickoloff and Naidu, 1994Nickoloff B.J. Naidu Y. Perturbation of epidermal barrier function correlates with initiation of cytokine cascade in human skin.J Am Acad Dermatol. 1994; 30: 535-546Abstract Full Text PDF PubMed Scopus (408) Google Scholar;Lew et al., 1998Lew W. Song D.H. Lee S.H. The effect of epidermal barrier disruption on the gene expression of transforming growth factor-β subtypes.Kor J Invest Dermatol. 1998; 5: 90-96Google Scholar). Also we observed an increase of TGF-β mRNA and immunoreactivity in the dermis after sonophoresis (Lee andChoi et al., 2001Choi E.H. Ahn S.K. Lee S.H. The effect of repeated changes in the epidermal calcium gradient by repeated iontophoresis on the skin barrier.J Skin Barrier Res (Korean). 2001; 3: 62-67Google Scholar). Immunohistochemical stains for IL-1α and TNF-α in the epidermis showed an increased expression compared to NC. The increased expression was observed from 1 h after iontophoresis and increased at 3 and at 6 h (Figure 3, Figure 4, Figure 5). Overall an increased tendency was shown with the 2-h current compared to 1 h. These results were similar to previous results of the acute perturbation model. We used image analysis to compare epidermal IL-1α and TNF-α expression by treatment because their expression was not localized at any specific layer but diffuse in the epidermis and we needed a more objective method to exclude the subjective bias that can be present with immunohistochemical stains. Because keratinocytes produce cytokines in response to exogenous stimuli such as ultraviolet B radiation, phorbol-12-myristate 13-acetate, and lipopolysaccharide (Wilmer et al., 1994Wilmer J.L. Burleson F.G. Kayama F. Kanno J. Luster M.I. Cytokine induction in human epidermal keratinocytes exposed to contact irritants and its relation to chemical-induced inflammation in mouse skin.J Invest Dermatol. 1994; 102: 915-922Abstract Full Text PDF PubMed Google Scholar), we question whether damage by the electric current of iontophoresis and heat produced by ultrasound of sonophoresis can induce cytokine production not by a change in epidermal calcium. Therefore, we introduced a classic immersion study using a solution containing calcium (Lee et al., 1992Lee S.H. Elias P.M. Proksch E. Menon G.K. Mao-Quiang M. Feingold K.R. Calcium and potassium are important regulators of barrier homeostasis in murine epidermis.J Clin Invest. 1992; 89: 530-538Crossref PubMed Scopus (177) Google Scholar). The expression of all three cytokines was reduced from approximately 30% to 90% in both iontophoresis and sonophoresis. Although Ion 2 h has shown a remarkable increase of cytokines expression, we used Ion 1 h in this study because the long period of complete anesthesia over 4 h was needed to complete the study with Ion 2 h, which has technical difficulties. Also we performed iontophoresis using high and low calcium and observed that cytokines expression decreased in high calcium compared to low calcium. We believe that these results will support our hypothesis. Nevertheless, the issues of toxicity or irritancy of electric current were not completely solved because the reduction was not complete. Our results directly showed that changes in epidermal calcium regulate mRNA expression of epidermal cytokines and then protein in vivo. We did not employ another marker for cellular injury to prove that there was no damage to epidermal cells. Rather we adopted an indirect method measuring epidermal proliferation to evaluate repeated skin barrier damage. Epidermal proliferation indicated keratinocyte damage in a previous study (Choi et al., 2001Choi E.H. Ahn S.K. Lee S.H. The effect of repeated changes in the epidermal calcium gradient by repeated iontophoresis on the skin barrier.J Skin Barrier Res (Korean). 2001; 3: 62-67Google Scholar). We did not find any epidermal proliferation after repeated iontophoresis and sonophoresis using the same intensity or current of the same devices. This indirect evidence supports the conclusion that there was no damage after iontophoresis and sonophoresis. Recently it was reported that modulations in epidermal calcium regulate the expression of differentiation specific markers (Elias et al., 2002bElias P.M. Ahn S.K. Denda M. et al.Modulations in epidermal calcium regulate the expression of differentiation-specific markers.J Invest Dermatol. 2002; 119: 1128-1136Crossref PubMed Scopus (165) Google Scholar). We also identified that iontophoresis-inducing changes in the epidermal calcium gradient without skin barrier disruption can increase sphingolipids and neutral lipids in the SC and change the expression of cornified cell envelop protein indicating terminal differentiation (Choi et al., 2002Choi E.H. Park W.S. Son E.D. Hwang S.M. Kim M.J. Ahn S.K. Lee S.H. The effect of change in epidermal calcium gradient on stratum corneum lipid and epidermal differentiation.in: Mark R. Leveque J.L. Voegeli R. The Essential Stratum Corneum. Dunitz, London2002: 77-80Crossref Google Scholar). In this study, the increased fluorescence in the SC after sonophoresis indicates an increase of SC intercellular lipids by an increase of LB secretion owing to calcium deprivation from the epidermis after sonophoresis, which depends on epidermal calcium as in a previous study (Menon et al., 1994Menon G.K. Price L.F. Bommannan B. Elias P.M. Feingold K.R. Selective obliteration of the epidermal calcium gradient leads to enhanced lamellar body secretion.J Invest Dermatol. 1994; 102: 789-795Abstract Full Text PDF PubMed Google Scholar). We believe that a key experiment to resolve the issue would be to confirm that a decrease in calcium ion in cultured keratinocytes stimulates cytokine production. That is our next experiment. From this study we conclude that the change of epidermal calcium may be a direct signal for inducing the expression of epidermal cytokines in vivo. This study was supported by a grant (KOSEF 98-0403-18-01-3) of the Korean Science and Engineering Foundation, Republic of Korea.