Portal de Periódicos da CAPES

Molecular Basis for the Loss of CD28 Expression in Senescent T Cells

2002; Elsevier BV; Volume: 277; Issue: 49 Linguagem: Inglês

10.1074/jbc.m207352200

1083-351X

Abbe N. Vallejo, Ewa Bryl, Klaus Klarskov, Stephen Naylor, Cornelia M. Weyand, Jörg J. Goronzy,

Cytomegalovirus and herpesvirus research

CD28null T cells are the most consistent biological indicator of the aging immune system in humans and are predictors of immunoincompetence in the elderly. The loss of CD28 is the result of an inoperative transcriptional initiator (INR), which consists of two nonoverlapping α and β motifs that have distinct protein binding profiles but function as a unit. In CD28null T cells, there is a coordinate loss of α-/β-bound complexes, hence the αβ-INR is inactive. In the present work therefore, studies were conducted to identify the components of such complexes that may account for thetrans-activation of the αβ-INR. By affinity chromatography and tandem mass spectrometry, two proteins, namely, nucleolin and the A isoform of heterogeneous nuclear ribonucleoprotein-D0 (hnRNP-D0A), were identified to be among the key components of the site α complex. In DNA binding assays, specific antibodies indicated their antigenic presence in α-bound complexes. Transcription assays showed that they are both required in thetrans-activation of αβ-INR-driven DNA templates. Because CD28 is T cell-restricted, and nucleolin and hnRNP-D0A are ubiquitous proteins, these results support the notion that cell-specific functions can be regulated by commonly expressed proteins. The present data also provide evidence for INR-regulated transcription that is independent of the known components of the basal transcription complex. CD28null T cells are the most consistent biological indicator of the aging immune system in humans and are predictors of immunoincompetence in the elderly. The loss of CD28 is the result of an inoperative transcriptional initiator (INR), which consists of two nonoverlapping α and β motifs that have distinct protein binding profiles but function as a unit. In CD28null T cells, there is a coordinate loss of α-/β-bound complexes, hence the αβ-INR is inactive. In the present work therefore, studies were conducted to identify the components of such complexes that may account for thetrans-activation of the αβ-INR. By affinity chromatography and tandem mass spectrometry, two proteins, namely, nucleolin and the A isoform of heterogeneous nuclear ribonucleoprotein-D0 (hnRNP-D0A), were identified to be among the key components of the site α complex. In DNA binding assays, specific antibodies indicated their antigenic presence in α-bound complexes. Transcription assays showed that they are both required in thetrans-activation of αβ-INR-driven DNA templates. Because CD28 is T cell-restricted, and nucleolin and hnRNP-D0A are ubiquitous proteins, these results support the notion that cell-specific functions can be regulated by commonly expressed proteins. The present data also provide evidence for INR-regulated transcription that is independent of the known components of the basal transcription complex. The CD28 molecule is a T cell-restricted membrane glycoprotein that provides the requisite costimulatory signal for the induction and maintenance of T cell-mediated immune responses (1Chambers C.A. Allison J.P. Curr. Opin. Cell Biol. 1999; 11: 203-210Google Scholar, 2Lenschow D.J. Walunas T.J. Bluestone J.A. Annu. Rev. Immunol. 1996; 14: 233-258Google Scholar). Coengagement of CD28 with the T cell receptor enhances the synthesis of several humoral growth factors including interleukin-2 and of anti-apoptotic molecules (3Boise L.H. Minn A.J. Noel P.J. June C.H. Accavitti M.A. Lindsten T. Thompson C.B. Immunity. 1995; 3: 87-98Google Scholar, 4Powell J.D. Ragheb J.A. Kitagawa-Sakakida S. Schwartz R.H. Immunol. Rev. 1998; 165: 287-300Google Scholar). Hence, T cells either become anergic or undergo apoptosis in the absence of CD28 signals. Targeted deletion of the CD28 gene in laboratory mice has been found to result in immunocompromised animals because of defective T cell activation (5Ferguson S.E. Han S. Kelsoe G. Thompson C.B. J. Immunol. 1996; 156: 4576-4581Google Scholar, 6Mittrucker H.W. Shahinian A. Bouchard D. Kundig T.M. Mak T.W. J. Exp. Med. 1996; 183: 2481-2488Google Scholar, 7Shahinian A. Pfeffer K. Lee K.P. Kundig T.M. Kishihara K. Wakeham A. Kawai K. Ohashi P.S. Thompson C.B. Mak T.W. Science. 1993; 261: 609-612Google Scholar). These findings underscore the central role of CD28 in adaptive immunity. Although CD28 is constitutively expressed on all T cells, CD28null T cells are typically found in the immune system of the elderly, in both CD8+ (8Effros R.B. Boucher N. Porter V. Zhu X. Spaulding C. Walford R.L. Kronenberg M. Cohen D. Schachter F. Exp. Gerontol. 1994; 29: 601-609Google Scholar, 9Posnett D.N. Sinha R. Kabak S. Russo C. J. Exp. Med. 1994; 179: 609-618Google Scholar) and CD4+compartments (10Vallejo A.N. Nestel A.R. Schirmer M. Weyand C.M. Goronzy J.J. J. Biol. Chem. 1998; 273: 8119-8129Google Scholar). CD28null cells have highly shortened telomeres compared with their CD28+ counterparts, indicating their long replicative history (11Montiero J. Batiwalla F. Ostere H. Gregersen P.K. J. Immunol. 1996; 156: 3587-3590Google Scholar). These unusual cells are also highly oligoclonal (9Posnett D.N. Sinha R. Kabak S. Russo C. J. Exp. Med. 1994; 179: 609-618Google Scholar, 12Schmidt D. Martens P.B. Weyand C.M. Goronzy J.J. Mol. Med. 1996; 2: 608-618Google Scholar), occurring at large clonal sizes that contribute to the contraction of the T cell repertoire diversity. Because of the limited replicative lifespan of T cells (13Effros R.B. Pawalec G. Immunol. Today. 1997; 18: 450-454Google Scholar), CD28null cells are thought to be biological indicators of immunosenescence. Interestingly, CD28null CD4+T cells have also been found in high frequencies among patients with chronic inflammatory conditions such as rheumatoid arthritis (14Martens P.B. Goronzy J.J. Schaid D. Weyand C.M. Arthritis Rheum. 1997; 40: 1106-1114Google Scholar), Wegener's granulomatosis (15Moosig F. Csernok E. Wang G. Gross W.L. Clin. Exp. Immunol. 1998; 114: 113-118Google Scholar), and unstable coronary artery disease (16Liuzzo G. Kopecky S.L. Frye R.L. O'Fallon W.M. Maseri A. Goronzy J.J. Weyand C.M. Circulation. 1999; 100: 2135-2139Google Scholar). In these pathological states, large clonal populations of these cells have been postulated to represent a pool of prematurely senescent T cells resulting from chronic immune activation (10Vallejo A.N. Nestel A.R. Schirmer M. Weyand C.M. Goronzy J.J. J. Biol. Chem. 1998; 273: 8119-8129Google Scholar, 17Wagner U.G. Koetz K. Weyand C.M. Goronzy J.J. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 14447-14452Google Scholar, 18Vallejo A.N. Weyand C.M. Goronzy J.J. J. Biol. Chem. 2001; 276: 2565-2570Google Scholar). The CD28null T cell phenotype is generally stable and lacks specific transcripts of all the known splice variants of CD28 (18Vallejo A.N. Weyand C.M. Goronzy J.J. J. Biol. Chem. 2001; 276: 2565-2570Google Scholar, 19Namekawa T. Wagner U.G. Goronzy J.J. Weyand C.M. Arthritis Rheum. 1998; 41: 2108-2116Google Scholar, 20Vallejo A.N. Brandes J.C. Weyand C.M. Goronzy J.J. J. Immunol. 1999; 162: 6572-6579Google Scholar, 21Weyand C.M. Brandes J.C. Schmidt D. Fulbright J.W. Goronzy J.J. Mech. Ageing Dev. 1998; 102: 131-147Google Scholar) resulting from a transcriptional block. Our studies show that the basal transcription of the CD28 gene is regulated by two sequence motifs sites α and β, in the gene promoter, situated downstream from an atypical TATA box (10Vallejo A.N. Nestel A.R. Schirmer M. Weyand C.M. Goronzy J.J. J. Biol. Chem. 1998; 273: 8119-8129Google Scholar). These sequences constitute a functionally singular transcriptional initiator (INR) 1The abbreviations used are: INR, initiator; ACN, acetonitrile; CR2, complement receptor 2; EMSA, electrophoretic mobility shift assay; ESI, electrospray ionization; hnRNP, heterogeneous nuclear ribonucleoprotein; MALDI, matrix-assisted laser desorption ionization; MS, mass spectrometry; MS/MS, tandem mass spectrometry; nLC, nano scale liquid chromatography; Q, quadrupole; RT, reverse transcription; TdT, terminal deoxynucleotidyltransferase; TOF, time of flight element (18Vallejo A.N. Weyand C.M. Goronzy J.J. J. Biol. Chem. 2001; 276: 2565-2570Google Scholar). In reporter gene bioassays and in vitro transcription studies, mutation in or deletion of either motif is sufficient to inactivate the CD28 gene promoter. In CD28null T cells, the αβ-INR is functionally inoperative because of the coordinate lack of sites α- and β-specific transcription factors (18Vallejo A.N. Weyand C.M. Goronzy J.J. J. Biol. Chem. 2001; 276: 2565-2570Google Scholar, 20Vallejo A.N. Brandes J.C. Weyand C.M. Goronzy J.J. J. Immunol. 1999; 162: 6572-6579Google Scholar). Although INRs are classically defined as nucleation sites of the basal transcription initiation complex (22Kaufmann J. Smale S.T. Genes Dev. 1994; 8: 821-829Google Scholar, 23Novina C.D. Roy A.L. Trends Genet. 1996; 12: 351-355Google Scholar), these findings indicate that loss (or gain) of INR activity may also be a critical determinant of cell phenotype and function. Because the CD28 αβ-INR has no homology with other INRs (18Vallejo A.N. Weyand C.M. Goronzy J.J. J. Biol. Chem. 2001; 276: 2565-2570Google Scholar, 24Javahery R. Khachi A. Lo K. Zenzie-Gregory B. Smale S.T. Mol. Cell. Biol. 1994; 14: 116-127Google Scholar,25Kraus R.J. Murray E.E. Wiley S.R. Zink N.M. Loritz K. Gelembiuk G.W. Mertz J.E. Nucleic Acids Res. 1996; 24: 1531-1539Google Scholar), we undertook studies to characterize the relevant INR-binding proteins. We utilized a combination of affinity chromatography in concert with matrix-assisted laser desorption ionization-time of flight-mass spectrometry (MALDI-TOF-MS) and nanocapillary liquid chromatography-nanospray tandem mass spectrometry (nLC-MS/MS) to identify the proteins associated with the DNA-binding complex. By these approaches, we identified two of the component proteins of the transcription factor complex which recognize site α of the CD28 INR. Here, evidence is also presented that the specific removal of either protein component of the site α-binding complex effectively inhibits the trans-activation of αβ-INR-driven DNA templates. The present work therefore provides a biochemical basis supporting the notion that the CD28 INR is indeed a structurally bipartite but functionally singular core promoter element. Jurkat (ATCC), a prototypical CD28+ T cell line (18Vallejo A.N. Weyand C.M. Goronzy J.J. J. Biol. Chem. 2001; 276: 2565-2570Google Scholar), was propagated in RPMI 1640 medium supplemented with 10% fetal calf serum at 37 °C in a humidified 5% CO2 incubator. Cells were maintained in batches of 250-ml flask cultures or 1-liter minibioreactors. Nuclear extracts were routinely prepared from bulk cultures when the cell density reached 5 × 106 cells/ml. Nuclear extracts were prepared as described previously (10Vallejo A.N. Nestel A.R. Schirmer M. Weyand C.M. Goronzy J.J. J. Biol. Chem. 1998; 273: 8119-8129Google Scholar, 20Vallejo A.N. Brandes J.C. Weyand C.M. Goronzy J.J. J. Immunol. 1999; 162: 6572-6579Google Scholar) and stored at −70 °C until use. In these studies, a 75-liter culture was processed for nuclear protein extraction. Total protein concentration was determined colorimetrically using the Bio-Rad protein assay reagent. HUT78 (ATCC), a prototypical CD28null T cell line (10Vallejo A.N. Nestel A.R. Schirmer M. Weyand C.M. Goronzy J.J. J. Biol. Chem. 1998; 273: 8119-8129Google Scholar, 18Vallejo A.N. Weyand C.M. Goronzy J.J. J. Biol. Chem. 2001; 276: 2565-2570Google Scholar), was also propagated in complete RPMI medium but supplemented with 20 units/ml human recombinant interleukin-2 (Proleukin™, Chiron, Emeryville, CA). Derivation and propagation of nontransformed CD4+CD28+ and CD28null T cell lines and clones have been described previously (10Vallejo A.N. Nestel A.R. Schirmer M. Weyand C.M. Goronzy J.J. J. Biol. Chem. 1998; 273: 8119-8129Google Scholar, 12Schmidt D. Martens P.B. Weyand C.M. Goronzy J.J. Mol. Med. 1996; 2: 608-618Google Scholar, 20Vallejo A.N. Brandes J.C. Weyand C.M. Goronzy J.J. J. Immunol. 1999; 162: 6572-6579Google Scholar). T cells used in the present studies were routinely subjected to phenotypic screening by direct immunofluorescence staining for CD3, CD4, and CD28 and analyzed by flow cytometry as described previously (10Vallejo A.N. Nestel A.R. Schirmer M. Weyand C.M. Goronzy J.J. J. Biol. Chem. 1998; 273: 8119-8129Google Scholar, 18Vallejo A.N. Weyand C.M. Goronzy J.J. J. Biol. Chem. 2001; 276: 2565-2570Google Scholar, 19Namekawa T. Wagner U.G. Goronzy J.J. Weyand C.M. Arthritis Rheum. 1998; 41: 2108-2116Google Scholar, 20Vallejo A.N. Brandes J.C. Weyand C.M. Goronzy J.J. J. Immunol. 1999; 162: 6572-6579Google Scholar, 21Weyand C.M. Brandes J.C. Schmidt D. Fulbright J.W. Goronzy J.J. Mech. Ageing Dev. 1998; 102: 131-147Google Scholar). Expression, or lack thereof, of CD28 was also confirmed by reverse transcription (RT)-PCR assays using amplification primers for all of the known variants of CD28 as described elsewhere (20Vallejo A.N. Brandes J.C. Weyand C.M. Goronzy J.J. J. Immunol. 1999; 162: 6572-6579Google Scholar). Nuclear extracts were dialyzed against 10 volumes of a hypotonic Hepes buffer pH 7.0 (10Vallejo A.N. Nestel A.R. Schirmer M. Weyand C.M. Goronzy J.J. J. Biol. Chem. 1998; 273: 8119-8129Google Scholar, 20Vallejo A.N. Brandes J.C. Weyand C.M. Goronzy J.J. J. Immunol. 1999; 162: 6572-6579Google Scholar) containing a protease inhibitor mixture (Roche Molecular Biochemicals), concentrated by centrifugation dialysis in Centricon YM-3 filters (Millipore), and subjected to sequential adsorption by column chromatography. The adsorption columns were agarose matrices of immobilized commercial DNA (Amersham Biosciences), heparin, and strepavidin (Pierce). The flow-through from the strepavidin column was subsequently poured into an affinity column with immobilized double-stranded, biotinylated, synthetic oligonucleotide corresponding to site α of the CD28-INR or its mutated variant M3 (10Vallejo A.N. Nestel A.R. Schirmer M. Weyand C.M. Goronzy J.J. J. Biol. Chem. 1998; 273: 8119-8129Google Scholar). The affinity column was washed aseptically with 10 volumes of Hepes buffer in the absence of peptide protease inhibitors. Bound proteins were eluted with 2 m KCl and concentrated by centrifugation dialysis against 10 volumes of sterile 10 mm Hepes pH 7.0. The simple design of the affinity purification for site α-binding proteins was based on empirical studies using microcolumns (data not shown). Additional adsorption/clearing steps such as the use of DEAE or Mono Q columns neither improved the elution yields nor altered the binding specificity of the site α oligonucleotide affinity column. As expected, incubation of precleared nuclear extracts with excess amounts of soluble site α oligonucleotides resulted in a significant reduction in the amounts, or the complete lack, of proteins that can be eluted from the affinity column. In these latter experiments, the absence of proteins eluted from the columns was confirmed by SDS-PAGE and silver staining and by MALDI-TOF-MS (below). Eluates from DNA affinity columns were initially subjected to MALDI-TOF-MS to examine the relative diversity of the isolated site α-specific protein complexes. Samples were desalted on a C4 ZipTip cartridge (Millipore). Retained proteins were eluted with a 2-μl matrix solution of 10 μg/μl 3,5-dimethoxy-4-hydroxycinnamic acid in 55% acetonitrile (ACN), 0.1% trifluoroacetic acid. Two 0.8-μl aliquots were loaded onto a 0.5-μl sinnapinnic acid matrix precrystallized in 70% ACN and 0.1% trifluoroacetic acid. Mass spectra were acquired using a Voyager-DE STR mass spectrometer (Perseptive Biosystems, Framingham, MA) by delayed extraction using either the reflectron or linear mode. Acceleration grid and guide wire voltages were set to 20,000 V, at 70% or 0.08%, respectively. The low mass gate was set to either 600 or 5,000. External calibration in linear mode was performed using doubly and singly charged ions from bovine serum albumin prepared by the same procedure as the sample eluates. MS/MS was performed to identify the site α-specific proteins by examining the peptide fragmentation fingerprints of the affinity column eluates. Desalted samples (see above) were dissolved in 10 mm Hepes pH 8.0 to a maximum concentration of 2.5 μg/μl and subjected to cysteine reduction and alkylation. Dithiothreitol (in 1 m Tris-HCl pH 8.8) was added to the samples to a final concentration of 1 μg/μl and incubated for 30 min at 37 °C. Samples were cooled to room temperature, iodoacetamide was added to a concentration of 2 μg/μl, and the samples were incubated for 30 min in the dark. Subsequent to reduction and alkylation, samples were diluted with an equal volume of 100 mm Tris-HCl buffer to a final concentration of 1.25 μg/μl and digested overnight with trypsin (E/S 1:50) at 37 °C. Trypsin digestion was stopped with the addition of 10% formic acid. Aliquots of the trypsin-digested material were diluted with an equal volume of 0.1% trifluoroacetic acid and loaded onto a ZipTip cartridge packed with C18 reverse material (Millipore) as described by the manufacturer. Peptides were eluted with 3 μl of matrix solution (12 μg/μl α-cyano-4-hydroxycinnamic acid in 45% aqueous ACN and 0.1% trifluoroacetic acid). Peptides were subjected to nLC-MS and MS/MS as described previously (26Poland G.A. Ovsyannikova I.G. Johnson K.L. Naylor S. Vaccine. 2001; 19: 2692-2700Google Scholar). Briefly, reversed phase η scale LC separations were done on a prepacked 75-μm inner diameter/5-cm long PicroFrit column (New Objective Inc., Cambridge, MA) packed with 5-μm particles of Aquasil C18 (ThermoHypersil-Keystone, Bellefonte, PA). Peptides were eluted at a flow rate of 0.2 μl/min utilizing a linear gradient as follows: initial hold at 0% B for 10 min, 1-min ramp to 10% B, 10–50% B over 30 min, 50–95% B over 5 min, hold 5 min at 95% B, return to 0% B over 5 min, and reequilibration for 5 min prior to new injection. Mobile phase A consisted of water/ACN/n-propyl alcohol (98/1/1 v/v/v) containing 0.2% formic acid. Mobile phase B consisted of ACN/n-propyl alcohol/water (80/10/10 v/v/v) containing 0.2% formic acid. Mobile phase flows at 50 μl/min were supplied by a Michrom UMA LC system (Michrom Bioresources Inc., Auburn, CA). A contact closure event table within the LC software was used to send start signals to the autosampler, control the LC switching valve, and send acquisition start signals to the mass spectrometer. A 10-min (10 min × 10 μl/min = 100 μl) sample transfer and wash step was built into the beginning of the reversed phase η scale LC method to allow reconcentration on the mPC disk (SDB-EX styrene/divinylbenzene disk, Varian Inc., Harbor City, CA) while simultaneously reequilibrating the η scale LC column from the previous gradient. At the conclusion of 10 min, the mPC disk was switched on-line with the ηLC column, the gradient started, and mass spectrometer data acquisition commenced. Typically, 5–8 μl of the digested protein sample was concentrated on the mPC membrane. Because the SDB material in the mPC disk is less rententive than the C18 ηLC column, it allowed analytes eluting from the membrane to be refocused briefly on the head of the ηLC column during the reversed phase gradient. Nanospray ESI-MS was performed using a Micromass Q-TOF II (Micromass, Beverly, MA) equipped with a modified Micromass ηESI source. The source was modified by replacing the mounting platform on the X/Y/Z manipulator with a 2-piece platform of stainless steel on top of insulating Delrin that contains a grid of mounting holes. A titanium microvolume union with 150-μm bore (Valco, Houston, TX) was mounted to the platform via the bulkhead threads in the union and a nylon screw. The electrospray voltage, typically 1.7–2.1 kV, was applied to the metal microvolume union through the stainless steel mounting plate. The Delrin base of the platform serves to insulate electrically the spray platform from the rest of the X/Y/Z manipulator assembly. Spectra were acquired on either the MS or the auto MS/MS mode. Auto MS/MS experiments were conducted using survey scans to choose up to three precursor ions. Collision energies were chosen automatically as a function of m/z value and charge. Argon was used as the collision gas. The mass axis of the TOF analyzer was calibrated by manually injecting 0.3 μl of 0.1 mg/ml NaI dissolved in isopropyl alcohol/water (50/50 v/v) through the ηLC column. The solution also contained a small amount of cesium ion allowing calibration over the m/z range 132.9054–1821.7206 using a linear fit of the calibration points. Data base searches were carried out using either accurate peptide masses or partial sequence information. Searches were performed utilizing the Protein Prospector search algorithm (prospector.ucsf.edu) MS-Fit or the Mascot search program (Matrix Science Limited, www.matrixscience.com), and the NCBI protein data base. Purity of the samples at each phase of column chromatography was monitored by EMSAs, which were performed as described previously (10Vallejo A.N. Nestel A.R. Schirmer M. Weyand C.M. Goronzy J.J. J. Biol. Chem. 1998; 273: 8119-8129Google Scholar, 20Vallejo A.N. Brandes J.C. Weyand C.M. Goronzy J.J. J. Immunol. 1999; 162: 6572-6579Google Scholar). As indicated, EMSAs were carried out with the addition of specific antibodies or the appropriate isotype control immunoglobulin (Ig) or preimmune antiserum to the binding reactions. In these studies, the anti-nucleolin monoclonal antibody MS3 (27Valdez B.C. Henning D. Busch R.K. Srivastava M. Busch H. Mol. Immunol. 1995; 32: 1207-1213Google Scholar) (provided by Dr. Ben Valdez, Baylor College of Medicine) and four rabbit antisera to heterogeneous nuclear ribonucleoprotein (hnRNP)-D0 (provided by Dr. Mate Tolnay, Walter Reed Research Institute) were used at the indicated dilutions. The specificities of these rabbit antisera to the A (P3, P4) and B isoforms (P1) or to a conserved region (P2) of hnRNP-D0 have been described previously (28Tolnay M. Vereshchagina L.A. Tsokos G.C. Biochem. J. 1999; 338: 417-425Google Scholar, 29Tolnay M. Baranyi L. Tsokos G.C. Biochem. J. 2000; 348: 151-158Google Scholar). Competitive EMSA was also carried out as described previously (10Vallejo A.N. Nestel A.R. Schirmer M. Weyand C.M. Goronzy J.J. J. Biol. Chem. 1998; 273: 8119-8129Google Scholar). Sequences corresponding to the Ig switch region recognized by a B cell-specific transcription factor LR1 (30Dempsey L.A. Hanakahi L.A. Maizels N. J. Biol. Chem. 1998; 273: 29224-29229Google Scholar, 31Hanakahi L.A. Dempsey L.A. Li M.J. Maizels N. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 3605-3610Google Scholar), the hnRNP-D0B binding motif in the complement receptor 2 (CR2) promoter (28Tolnay M. Vereshchagina L.A. Tsokos G.C. Biochem. J. 1999; 338: 417-425Google Scholar, 32Tolnay M. Lambris J.D. Tsokos G.C. J. Immunol. 1997; 159: 5492-5501Google Scholar), or the mutated variant (M3) of site α (10Vallejo A.N. Nestel A.R. Schirmer M. Weyand C.M. Goronzy J.J. J. Biol. Chem. 1998; 273: 8119-8129Google Scholar) were used as competitors to the CD28 site α binding probe. DNA binding assays were also conducted using LR1 and CR2 double-stranded oligonucleotide sequences as binding probes. In other assays as indicated, single-stranded oligonucleotides of site α were also used as binding probes. Transcription assays with INR-driven DNA templates were conducted as described previously (18Vallejo A.N. Weyand C.M. Goronzy J.J. J. Biol. Chem. 2001; 276: 2565-2570Google Scholar). CD28-INR-driven DNA templates contained either the wild type or mutated variants of site α (M3, M4) or site β (M9, and M10) (10Vallejo A.N. Nestel A.R. Schirmer M. Weyand C.M. Goronzy J.J. J. Biol. Chem. 1998; 273: 8119-8129Google Scholar). Mutants were generated by the gene splicing by overlap extension technique described elsewhere (33Vallejo A.N. Pogulis R.P. Pease L.R. PCR Methods Applications. 1994; 4: S123-S130Google Scholar). For assays using immunodepleted extracts, batches of 100-μg aliquots of dialyzed nuclear extracts were incubated overnight at 4 °C with saturating amounts of anti-nucleolin (MS3) or anti-hnRNP-D0A (P3, P4), or equivalent amounts of IgG or preimmune serum. To this mixture, protein A/G-agarose (Pierce) was added and incubated for another 6 h at 4 °C. Supernatants were collected after brief centrifugation and concentrated by centrifugation dialysis in Microcon YM-3 filters (Millipore). Protein concentration was determined using the Bio-Rad protein assay reagent. Thirty μg of each of the antibody-cleared extracts was used in transcription assays using CD28 αβ-INR-driven DNA templates. In similar experiments, the immunoprecipitated protein complexes were added back the antibody-cleared extracts. Protein A/G-bound proteins from the depletion experiments were subjected to high salt elution, concentrated by centrifugation dialysis, and 20 μg of the concentrate was added to the antibody-cleared extract and used in transcription assays. DNA templates containing either the wild type or mutated form of the INR of the terminal deoxynucleotidyltransferase (TdT) gene (34Kaufmann J. Ahrens K. Koop R. Smale S.T. Müller R. Mol. Cell. Biol. 1998; 18: 233-239Google Scholar) were also used as system controls. Nuclear extracts from CD28+and CD28null T cells were prepared as described above, and 10-μg aliquots were subjected to SDS-PAGE under reducing conditions in 10% polyacrylamide gels. Fractionated proteins were transferred to nitrocellulose membranes (0.2-μm sieve, Bio-Rad) by standard electroblotting procedures. Membranes were blocked with 4% bovine serum albumin in Tris-buffered saline pH 7.4 for 1 h, followed by a 1-h incubation in a 1/1,000 dilution (in Tris-buffered saline containing 1% bovine serum albumin and 0.25% Tween 20) of the anti-nucleolin antibody MS3 (27Valdez B.C. Henning D. Busch R.K. Srivastava M. Busch H. Mol. Immunol. 1995; 32: 1207-1213Google Scholar) or the P4 rabbit antiserum to hnRNP-D0A (29Tolnay M. Baranyi L. Tsokos G.C. Biochem. J. 2000; 348: 151-158Google Scholar). Membranes were washed extensively in the Tris-buffered saline-bovine serum albumin-Tween dilution buffer and subsequently incubated for 1 h in a 1:1/000 dilution of horseradish peroxidase-conjugated goat anti-mouse Ig (BD Biosciences) or goat anti-rabbit IgG/IgL (BIOSOURCE Intl., Camarillo, CA) for MS3- or P4-treated membrane, respectively. The membranes were again washed extensively in Tris-buffered saline-bovine serum albumin-Tween dilution buffer, and the immunoblots were developed by chemoluminescence using the SuperSignal kit (Pierce). Isolated site α-bound proteins were also subjected to Western blotting to ascertain the presence of nucleolin and hnRNP-D0A in the DNA·protein complexes. Approximately 100-μg samples of nuclear extracts from Jurkat and HUT78 cells were incubated separately with 100 μl of freshly washed strepavidin-agarose slurry (Pierce) for 2 h at 4 °C. After a brief centrifugation, the precleared extracts were divided into two aliquots; one was left on ice until use, and the other was added to a 500-μl EMSA binding reaction (as described above) containing 10 nmol of biotinylated site α sequences and incubated on ice for 1 h. A fresh 100-μl slurry of strepavidin-agarose was washed three times with the reaction buffer. After the last centrifugation, the supernatant was discarded by vacuum aspiration, and the EMSA binding reaction was poured into the strepavidin-agarose pellet. The mixture was incubated for 1 h at 4 °C in a rotating wheel. After a brief centrifugation, the supernatant was carefully aspirated off into a microfuge tube and left on ice. The DNA·protein complexes/strepavidin-agarose pellet was washed twice by centrifugation in 3 volumes of the binding reaction buffer. The binding reaction supernatant and the DNA-bound fraction, along with the precleared nuclear extract, were each mixed with an equal volume of 2× Laemmli buffer, and 100-μl aliquots were subjected to SDS-PAGE and Western blotting for nucleolin and hnRNP-D0A as described above. As system control, similar immunoblotting experiments were conducted using the monoclonal antibody 4B10 (35Piñol-Roma S. Choi Y.D. Matunis M.J. Dreyfuss G. Genes Dev. 1988; 2: 215-237Google Scholar) (provided by Dr. Gideon Dreyfuss, HHMI, University of Pennsylvania), which specifically recognizes the RNA-binding protein hnRNP-A1 (36Krecic A.M. Swanson M.S. Curr. Opin. Cell Biol. 1999; 11: 363-371Google Scholar) but not the isoforms of hnRNP-D0. Total RNA from a panel of T cells, as indicated, was prepared using the Trizol reagent (Invitrogen) and subjected to first strand cDNA synthesis by standard procedures. Aliquots of cDNA samples were subjected to PCR using specific primers. The sequences of the primer pairs used were gaggtggtggccccagt and cactctgctggttgctataatc, which amplified a 168-bp product corresponding to exon 7 of hnRNP-D0A (GenBank™ accession no.D55674; Ref. 37Kajita Y. Nakayama J. Aizawa M. Ishikawa F. J. Biol. Chem. 1995; 270: 22167-22175Google Scholar). PCR was carried out in 30 cycles of 94 °C for 1 min, 55 °C for 2 min, and 72 °C for 2 min. PCR products were size fractionated by agarose gel electrophoresis and visualized by ethidium bromide staining. To authenticate the fidelity of PCR amplification, PCR products were subjected to direct sequencing using an automated ABI377 DNA sequencer (Applied Biosystems, Foster City, CA). Parallel PCR experiments were also conducted for β-actin as a system control. The primer pairs used were ATCATGTTTGAGACCTTCAACAC and caggaggagcaatgatcttg (GenBank™ accession nos. M10278 and 5016088), and PCR was carried out as described above. The CD28 INR consists of two contiguous but noncompeting sequence motifs, α and β, which have no homology with the consensus INR and other regulatory elements (10Vallejo A.N. Nestel A.R. Schirmer M. Weyand C.M. Goronzy