Portal de Periódicos da CAPES

Differential Regulation of JunD by Dihydroxycholecalciferol in Human Chronic Myelogenous Leukemia Cells

1995; Elsevier BV; Volume: 270; Issue: 34 Linguagem: Inglês

10.1074/jbc.270.34.19676

1083-351X

Stephen R. Lasky, Keigo Iwata, Alan G. Rosmarin, David G. Caprio, Abby Maizel,

Vitamin D Research Studies

1,25-Dihydroxyvitamin D3 inhibits the proliferation of the chronic myelogenous leukemia cell line RWLeu-4 but not the resistant variant, JMRD3. Although these cells exhibit no detectable differences in the vitamin D receptor, alterations in the interaction of nuclear extracts with the osteocalcin-1,25-dihydroxyvitamin D3-response element are noted. It is shown herein that the 1,25-dihydroxyvitamin D3 receptor binds to the osteocalcin-1,25-dihydroxyvitamin D3-response element along with activator protein-1 (AP-1) complexes and that the DNA binding activities of members of the Jun and Fos proto-oncogene families, which make up the AP-1 transcription factor, are differentially regulated by 1,25-dihydroxyvitamin D3. It is shown that JunD DNA binding activity is enhanced by 1,25-dihydroxyvitamin D3 during cell cycle arrest in the sensitive cells but is decreased in the resistant cells. These results suggest that the level of JunD DNA binding activity may be a critical factor in the regulation of proliferation. 1,25-Dihydroxyvitamin D3 inhibits the proliferation of the chronic myelogenous leukemia cell line RWLeu-4 but not the resistant variant, JMRD3. Although these cells exhibit no detectable differences in the vitamin D receptor, alterations in the interaction of nuclear extracts with the osteocalcin-1,25-dihydroxyvitamin D3-response element are noted. It is shown herein that the 1,25-dihydroxyvitamin D3 receptor binds to the osteocalcin-1,25-dihydroxyvitamin D3-response element along with activator protein-1 (AP-1) complexes and that the DNA binding activities of members of the Jun and Fos proto-oncogene families, which make up the AP-1 transcription factor, are differentially regulated by 1,25-dihydroxyvitamin D3. It is shown that JunD DNA binding activity is enhanced by 1,25-dihydroxyvitamin D3 during cell cycle arrest in the sensitive cells but is decreased in the resistant cells. These results suggest that the level of JunD DNA binding activity may be a critical factor in the regulation of proliferation. INTRODUCTION1,25-Dihydroxyvitamin D3 (VD3) 1The abbreviations used are: VD31,25-dihydroxyvitamin D3VDR1,25-dihydroxyvitamin D3 receptorVDRE1,25-dihydroxyvitamin D3-response elementOC-VDREosteocalcin-VDREDR3-VDREdirect repeat with 3-nucleotide spacer VDREAP-1activator protein-1CMLchronic myelogenous leukemiaEMSAelectrophoretic mobility shift assay(s). plays an important role in regulating the proliferation and differentiation of myeloid cells(1Pols H. Birkenhäger J.C. Foekens J.A. Van L.J. J. Steroid Biochem. Mol. Biol. 1990; 37: 873-876Crossref PubMed Scopus (100) Google Scholar, 2Suda T. Shinki T. Takahashi N. Annu. Rev. Nutr. 1990; 10: 195-211Crossref PubMed Scopus (98) Google Scholar, 3Koeffler H.P. Neth O. Gallo R.C. Greaves M.F. Janka G.E. Vitamin D: Myeloid Differentiation and Proliferation. Haematology and Blood Transfusion. Vol. 29. Springer-Verlag, Berlin/Heidelberg1985: 409-417Google Scholar, 4Studzinski G.P. McLane J.A. Uskokovic M.R. Crit. Rev. Eukaryotic Gene Expression. 1993; 3: 279-312PubMed Google Scholar). Many of the effects of VD3 are mediated through the binding and activation of high affinity nuclear receptors (VDRs) (5Pike J.W. Annu. Rev. Nutr. 1991; 11: 189-216Crossref PubMed Scopus (283) Google Scholar) that show extensive sequence similarity to steroid, thyroid, retinoid, and orphan nuclear receptors(6McDonnell D. Pike J.W. O'Malley B.W. J. Steroid Biochem. 1988; 30: 41-46Crossref PubMed Scopus (54) Google Scholar, 7Umesono K. Murakami K.K. Thompson C.C. Evans R.M. Cell. 1991; 65: 1255-1266Abstract Full Text PDF PubMed Scopus (1488) Google Scholar). The activity and response element specificity of the VDR can be enhanced by nuclear accessory factors such as the retinoid receptors and other non-receptor transcription factors such as activator protein-1 (AP-1)(8Liao J. Ozono K. Sone T. McDonnell D.P. Pike J.W. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 9751-9755Crossref PubMed Scopus (165) Google Scholar, 9Yu V.C. Delsert C. Andersen B. Holloway J.M. Devary O.V. Näär A.M. Kim S.Y. Boutin J.M. Glass C.K. Rosenfeld M.G. Cell. 1991; 67: 1251-1266Abstract Full Text PDF PubMed Scopus (1051) Google Scholar).Much attention has focused upon the AP-1 transcription factor, which consists of a family of proteins related to and including the c-Fos (FosB, Fra1, and Fra2) and c-Jun (JunB, JunD) proto-oncogene products (10Pfahl M. Endocr. Rev. 1993; 14: 651-658Crossref PubMed Scopus (447) Google Scholar, 11Radler P.A. Gebel S. Sachsenmaier C. König H. Krämer M. Oehler T. Streile M. Ponta H. Rapp U. Rahmsdorf H.J. Cato A. Angel P. Herrlich P. Ann. N. Y. Acad. Sci. 1993; 684: 127-148Crossref PubMed Scopus (47) Google Scholar). The dimeric forms of Jun and Fos family members bind to DNA exhibiting a consensus sequence of TGA(C/T)TCA while monomers are unable to functionally bind to DNA. These genes are expressed in a cell stage, lineage, and inducer-specific manner(11Radler P.A. Gebel S. Sachsenmaier C. König H. Krämer M. Oehler T. Streile M. Ponta H. Rapp U. Rahmsdorf H.J. Cato A. Angel P. Herrlich P. Ann. N. Y. Acad. Sci. 1993; 684: 127-148Crossref PubMed Scopus (47) Google Scholar, 12Angel P. Allegretto E.A. Okinko S.T. Hattori K. Boyle W.J. Hunter T. Karin M. Nature. 1988; 332: 166-171Crossref PubMed Scopus (683) Google Scholar, 13Vedeckis W.V. Proc. Soc. Exp. Biol. Med. 1992; 199: 1-12Crossref PubMed Scopus (21) Google Scholar), and it has been demonstrated that although the Jun family members can bind to the same DNA sequences, they do so with different affinities and may elicit different responses with regard to expression of target genes(14Deng T. Karin M. Genes & Dev. 1993; 7: 479-490Crossref PubMed Scopus (287) Google Scholar, 15Doucas V. Spyrou G. Yaniv M. EMBO J. 1991; 10: 2237-2245Crossref PubMed Scopus (106) Google Scholar, 16Ryseck R.P. Kovary K. Bravo R. Oncogene. 1990; 5: 1091-1093PubMed Google Scholar). Since alterations in AP-1 activity can interfere with normal cell cycle progression, this transcription factor may modulate the expression of genes involved in cell growth and differentiation(17Angel P. Karin M. Biochim. Biophys. Acta. 1991; 1072: 129-157Crossref PubMed Scopus (3248) Google Scholar, 18Bradley M.O. Manam S. Kraynak A.R. Nichols W.W. Ledwith B.J. Ann. N. Y. Acad. Sci. 1992; 660: 124-135Crossref PubMed Scopus (4) Google Scholar, 19Curran T. Franza B.R.J. Cell. 1988; 55: 395-397Abstract Full Text PDF PubMed Scopus (1309) Google Scholar). Considering that VD3 treatment causes myeloid leukemia cells to differentiate into monocyte/macrophage-like cells and cease proliferating(3Koeffler H.P. Neth O. Gallo R.C. Greaves M.F. Janka G.E. Vitamin D: Myeloid Differentiation and Proliferation. Haematology and Blood Transfusion. Vol. 29. Springer-Verlag, Berlin/Heidelberg1985: 409-417Google Scholar, 20Lasky S.R. Bell W. Huhn R.D. Posner M.R. Wiemann M. Calabresi P. Eil C. Cancer Res. 1990; 50: 3087-3094PubMed Google Scholar), one might expect that the activity of members of the Fos and Jun families would be modified during VD3-induced inhibition of proliferation and induction of differentiation(21Kolla S.S. Studzinski G.P. Cancer Res. 1994; 54: 1418-1421PubMed Google Scholar, 22Lian J.B. Stein G.S. Bortell R. Owen T.A. J. Cell. Biochem. 1991; 45: 9-14Crossref PubMed Scopus (77) Google Scholar).Investigations into the effects of VD3 on the human chronic myelogenous leukemia (CML) cell line RWLeu-4 have shown that subnanomolar concentrations of VD3 inhibit the proliferation and induce monocyte/macrophage-like differentiation of these cells(20Lasky S.R. Bell W. Huhn R.D. Posner M.R. Wiemann M. Calabresi P. Eil C. Cancer Res. 1990; 50: 3087-3094PubMed Google Scholar). To further investigations into the mechanism of the anti-proliferative action of this hormone, a variant of the RWLeu-4 cell line, called JMRD3, in which proliferation is not inhibited by VD3 concentrations greater than 0.1 μM, has been derived(23Lasky S.R. Posner M.R. Iwata K. Santos M.A. Yen A. Samuel V. Clark J. Maizel A.L. Blood. 1994; 84: 4283-4294Crossref PubMed Google Scholar). Although most previously described VD3-resistant cell lines have mutations in the VDR(24Feldman D. Malloy P.J. Mol. Cell. Endocrinol. 1990; 72: C57-C62Crossref PubMed Scopus (48) Google Scholar, 25Hughes M. Malloy P. Kieback D. Kesterson R. Pike J.W. Feldman D. O'Malley B. Science. 1988; 242: 1702-1705Crossref PubMed Scopus (418) Google Scholar, 26Malloy P. Hochberg Z. Pike J. Feldman D. J. Clin. Endocrinol. Metab. 1989; 68: 263-269Crossref PubMed Scopus (78) Google Scholar), initial characterization of the VDR expressed in RWLeu-4 and JMRD3 cells indicates that there are no significant differences in the affinity for VD3 or number of receptors expressed in these lines(23Lasky S.R. Posner M.R. Iwata K. Santos M.A. Yen A. Samuel V. Clark J. Maizel A.L. Blood. 1994; 84: 4283-4294Crossref PubMed Google Scholar). Furthermore, no differences are found in the DNA coding for the receptor or the induction of VD3-responsive genes in the sensitive and resistant cells(23Lasky S.R. Posner M.R. Iwata K. Santos M.A. Yen A. Samuel V. Clark J. Maizel A.L. Blood. 1994; 84: 4283-4294Crossref PubMed Google Scholar).A series of experiments are reported herein which show that nuclear extracts from the sensitive and resistant cells express VDRs that bind to the human osteocalcin-vitamin D-response element (OC-VDRE) along with AP-1 proteins and that the activity of these complexes is regulated by VD3. We also show that the inhibition of proliferation by VD3 in the sensitive cells is accompanied by an increase in the DNA binding activity of AP-1 and that JunD is a major constituent of these AP-1 complexes. These results suggest that AP-1, and in particular JunD, may play an important role in the anti-proliferative actions of VD3.EXPERIMENTAL PROCEDURESReagentsVD3 was kindly provided by M. R. Uskokovic of Hoffmann-LaRoche. Stock solutions of 0.2 mM VD3 were prepared in absolute ethanol and protected from direct light. Tissue culture reagents were purchased from Life Technologies, Inc. Enhanced chemiluminescence (ECL) kits were purchased from Amersham Corp. 32P- and 35S-nucleotides were purchased from Amersham Corp. or DuPont NEN. Universolv liquid scintillation mixture was purchased from ICN (Cosa Mesa, CA). All other chemicals were of the highest commercially available purity.Cells and Cell CultureThe human leukemia cell lines RWLeu-4 and JMRD3 were cultured in complete medium (α-modified minimum essential medium supplemented with glutamine, 100 units/ml penicillin, 100 mg/ml streptomycin, 0.1 mM non-essential amino acids, and 1 mM sodium pyruvate) plus 10% heat-inactivated fetal calf serum in a 5% CO2 atmosphere at 37°C. Cells were inoculated at 0.5-1 × 105 cells/ml and grown exponentially for 3-4 days. Viability of cells was determined by trypan blue dye exclusion.Transient Transfection AnalysisClonal lines of RWLeu-4 and JMRD3 cells expressing similar numbers of VDR as judged by ligand binding assays were grown as described above. Triplicate cultures containing five million cells were transfected in a Bio-Rad gene pulser at 960 microfarads, 300 V with 20 μg of the pGL2-(OC-VDRE)2 luciferase reporter construct (kindly provided by Dr. L. Freedman, Memorial Sloan-Kettering Cancer Center) and 1 μg of cytomegalovirus promoter/human growth hormone construct in the presence or absence of 50 nM 1,25-VD3. Fourteen hours after transfection, luciferase activity was assayed(27Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. John Wiley & Sons, Inc., New York1988Google Scholar), and growth hormone was measured from 100 μl of supernatant by radioimmunoassay (Allegro human growth hormone kit, Nichols Institute Diagnostics (San Juan Capistrano, CA). Promoter activity is expressed as -fold induction of normalized relative light units. Normalized relative light units are derived by dividing luciferase activity by growth hormone to account for transfection efficiency.Extraction of Nuclear ProteinsNuclear extracts from VD3-sensitive and -resistant cells treated with 50 nM VD3 for varying lengths of time as indicated in the text and figures were isolated by a modification of the method described by Dignam et al.(28Dignam J.D. Lebovitz R.M. Roeder R.G. Nucleic Acids Res. 1983; 11: 1475-1489Crossref PubMed Scopus (9142) Google Scholar). Briefly, 50 million VD3 treated or control cells were scraped, collected by centrifugation at 400 × g, and washed once with ice-cold phosphate-buffered saline (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4•7H2O, 1.4 mM KH2PO4). All subsequent manipulations were carried out at 4°C. The cells were resuspended in 0.5 ml of ice-cold hypotonic buffer with proteinase inhibitors (10 mM Hepes, pH 7.9, 10 mM KCl, 0.1 mM Na2EDTA, 5 mM dithiothreitol, 10 μg/ml each of aprotinin, leupeptin, Pefabloc® SC (Boehringer Mannheim), pepstatin) and immediately centrifuged at 400 × g for 10 min. The cell pellet was resuspended in the same buffer, allowed to swell for 10 min, and the cells were disrupted by 10-12 strokes in a Dounce homogenizer with a tight fitting pestle. The nuclei were pelleted by centrifugation at 14,000 rpm for 5 min in a refrigerated Eppendorf microcentrifuge and the cytosolic fraction removed. The nuclei were resuspended in 0.25 ml of high salt buffer with proteinase inhibitors (20 mM Hepes, pH 7.9, 20% glycerol, 120 mM NaCl, 300 mM KCl, 2 mM MgCl2, 5 mM dithiothreitol, 0.1 mM Na2EDTA, 10 μg/ml each of aprotinin, leupeptin, Pefabloc, and pepstatin) and incubated for 30 min. The nuclei were then pelleted by centrifugation at 40,000 rpm in a type 50 rotor (Beckman), and the supernatant was removed, dialyzed against 230 ml of storage buffer (20 mM Hepes, pH 7.9, 20% glycerol, 100 mM KCl, 0.1 mM Na2EDTA, 5 mM dithiothreitol) for 1-2 h, diluted with storage buffer to a final protein concentration of 5 μg/μl, and stored in small aliquots at −80°C. Protein concentrations were determined by the method of Bradford (37Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (213377) Google Scholar) (Bio-Rad) using IgG as a standard.DNA Synthesis, Purification, and LabelingOligonucleotides were synthesized on an Applied Biosystems, Inc. model 392 or 394 synthesizer. Oligonucleotides used for electrophoretic mobility shift analysis were annealed and purified by non-denaturing gel electrophoresis using standard techniques(27Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. John Wiley & Sons, Inc., New York1988Google Scholar). Oligonucleotides were labeled with [α-32P]dCTP, [α-32P]dATP, or [γ-32P]ATP by standard filling-in or end-labeling techniques(27Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. John Wiley & Sons, Inc., New York1988Google Scholar). Unincorporated nucleotides were removed using NucTrap push columns (Stratagene).Electrophoretic Mobility Shift AnalysisSamples containing 10-15 μg of protein from nuclear extracts of sensitive or resistant cells were used in DNA binding reactions. Each reaction had a final volume of 20 μl containing 10 mM Tris-HCl, pH 7.8, 0.5 mM Na2EDTA, 10 mM β-mercaptoethanol, 100 mM KCl, 10% glycerol, 1 μg of poly(dI•dC), and 10 fmol of radiolabeled oligonucleotides (20,000-40,000 dpm). The sequence CTAGTGCTCGGGTAGGGGTGACTCACCGGGTGAACGGGGGCATCT and its complement were used as the human osteocalcin-VD3-response element; CTAGACGCTTGATGACTCAGCCGGAA and its complement as the consensus AP-1 oligonucleotide; and CTAGTGCTCGGGTAGAGGTCAAGGAGGTCACTCGAC and its complement as the DR3-VDRE. Oligonucleotides containing the NF-κB consensus (AGTTGAGGGGACTTTCCCAGGC) sequence purchased from Promega Biotech were used as a negative control. Binding reactions were incubated for 20 min at room temperature. Supershifting experiments using antibodies against Jun and Fos family members were performed by adding 0.1-3 μg of specific antibody after the initial incubation of extracts with radiolabeled probes. Antibodies were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA) (anti-c-Jun, SC-45X; anti-JunD, SC-74X; anti-c-Fos, SC-52X; anti-FosB, SC-48X; anti-Fra2, SC-57X) or Oncogene Sciences (Oncogene Sciences, Uniondale, NY) (anti-c-Jun, P6; anti-c-Fos, OP-17; anti-JunB, PC-28). Antibodies against JunB and JunD were also kindly provided by Dr. R. Bravo (Bristol-Myers Squibb). Anti-NFκB (Santa Cruz Biotechnology, Inc., SC-109X) was used as nonspecific, control antibody. Binding reactions were continued for 30 min after addition of antibodies. The reaction products were separated on 5% non-denaturing polyacrylamide gels using the 0.5 × Tris/borate/EDTA buffer system (44.5 mM Tris base, 44.5 mM sodium borate, 1 mM Na2EDTA) (27Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. John Wiley & Sons, Inc., New York1988Google Scholar) and visualized by autoradiography.Immunoblot AnalysisNuclear extracts were prepared from RWLeu-4 and JMRD3 or the cloned cells as described above, and 10-μg aliquots of each extract were separated on a 10% SDS-polyacrylamide gel. The proteins were then electrotransferred to Hybond™ membranes (Amersham Corp.), and the membrane were blocked with powdered milk and incubated with a 1:1500 dilution of anti-c-Jun, anti-JunB, anti-junD, anti-c-Fos, anti-FosB, or anti-Fra2 obtained from Santa Cruz Biotechnology, Inc. or Oncogene Sciences, Inc. Horseradish peroxidase-coupled second antibody (Amersham Corp.) was used to visualize the cross-reactive bands by enhanced chemiluminescence (ECL) (Amersham Corp.). Nonspecific binding was determined by omitting the first antibody or by blocking with a 10-fold excess of antibody-specific peptides purchased from Santa Cruz Biotechnology, Inc.RESULTS AND DISCUSSIONAlthough no differences were detected between the VDRs expressed in the sensitive and resistant cells, analysis of electrophoretic mobility shift assays (EMSA) shows that differences in the DNA binding activity are present in nuclear extracts from control (Fig. 1, lanes1-5) or VD3-treated cells (Fig. 1, lanes6-10). The band labeled VDR, identified by competition with unlabeled OC-VDREs (lanes2 and 7), a consensus VDRE (lanes3 and 8), and by blocking with the 9a7 anti-VDR antibody (data not shown), is present in both sensitive and resistant cell extracts. Lanes1 and 6 of both A and B show that the VDR is induced in both cell types although VDR binding in JMRD3 cell extracts is slightly less than that seen in RWLeu-4 extracts. However, in agreement with previous findings(23Lasky S.R. Posner M.R. Iwata K. Santos M.A. Yen A. Samuel V. Clark J. Maizel A.L. Blood. 1994; 84: 4283-4294Crossref PubMed Google Scholar), transient transfection experiments (Fig. 2) using luciferase reporter plasmids containing two copies of the OC-VDRE demonstrate that both cell lines are equally responsive to induction by VD3.Figure 2:Analysis of VD3 responsiveness of RWLeu-4 and JMRD3 cells by transient transfection. Triplicate cultures containing five million RWLeu-4 (solidbars) or JMRD3 (hatchedbars) cells were transfected with 20 μg of pGL2-(OC-VDRE)2 (kindly provided by Dr. L. Freedman, Memorial Sloan-Kettering Cancer Center) and 1 μg of cytomegalovirus promoter/human growth hormone construct in the absence or presence of 50 nM VD3. Fourteen hours after transfection luciferase activity was assayed, and growth hormone was measured from 100 μl of supernatant by radioimmunoassay techniques. Promoter activity is expressed as -fold induction of relative light units divided by growth hormone expression (normalized relative light units).View Large Image Figure ViewerDownload Hi-res image Download (PPT)Because AP-1 binds to the OC-VDRE(22Lian J.B. Stein G.S. Bortell R. Owen T.A. J. Cell. Biochem. 1991; 45: 9-14Crossref PubMed Scopus (77) Google Scholar, 29Schule R. Umesono K. Mangelsdorf D.J. Bolado J. Pike J.W. Evans R.M. Cell. 1990; 61: 497-504Abstract Full Text PDF PubMed Scopus (421) Google Scholar), it was suspected that other bands in the EMSA might contain Jun and Fos proteins. Experiments were undertaken to determine if the activity of AP-1 is modified during VD3-induced inhibition of proliferation using competition binding experiments with excess unlabeled oligonucleotides containing a consensus AP-1 binding site. Fig. 1(lanes4 and 9) shows that AP-1 binding activity is present in nuclear extracts of the sensitive and resistant cells but that AP-1 binding is increased by VD3 treatment of the sensitive cells and is decreased by VD3 treatment of the resistant cells. The slowest migrating band, seen only in VD3-treated RWLeu-4 cell extracts (lane6), is competed by the OC-VDRE (lane7), DR3-VDRE (lane8), AP-1 consensus sequences (lane9), as well as anti-VDR antibodies (data not shown) and therefore appears to contain both VDR and AP-1 associated with the same molecule. Binding specificity is indicated by the failure of oligonucleotides containing NFκB consensus sequences to block the binding of any bands.EMSA supershifting experiments were performed to determine whether differences in AP-1 binding activity are due to the differential activation of specific members of the Jun and Fos families. Antibodies specific for the Jun and Fos family members were added after a preincubation of extracts with radiolabeled OC-VDRE as indicated in the legend for Fig. 3. Both RWLeu-4 (Fig. 3A) and JMRD3 (Fig. 3B) express active JunD (supershifted band in lane4) and c-Fos (supershifted band in lane 5) proteins before treatment with VD3. However, VD3 treatment of the RWLeu-4 cells increases the DNA binding activity of JunD (Fig. 3A, compare lanes4 and 11) but decreases JunD DNA binding activity in JMRD3 cells (Fig. 3B, compare lanes4 and 11). No consistent changes in other members of the Jun and Fos families are detected in extracts from either cell population using this technique. Fig. 4 shows that the increase in JunD DNA binding in the sensitive cells (Fig. 4A) is dependent upon the length of treatment with VD3 but that JunD participation in AP-1 binding complexes in the resistant cells (Fig. 4B) decreases over this period of treatment. Taken together these results indicate that VD3 differentially regulates the DNA binding activity of AP-1 transcription factors, particularly those complexes containing JunD proteins.Figure 3:EMSA supershifting of OC-VDRE binding bands in RWLeu-4 (A) or JMRD3 (B) nuclear extracts. OC-VDRE binding by nuclear extracts from untreated cells (lanes 1-7) or cells treated for 72 h with 50 nM VD3 (lanes 8-14) was performed as described in Fig. 1. Antibodies (0.1-1 μg) against Jun and Fos family members were then added, and the incubations continued for an additional 30 min. Reaction products were separated and visualized as described in Fig. 1. Lanes1 and 8 contain no antibodies; lanes2 and 9 contain anti-c-Jun; lanes3 and 10 contain anti-JunB; lanes4 and 11 contain anti-JunD; lanes5 and 12 contain anti-c-Fos; lanes6 and 13 contain anti-FosB; lanes7 and 14 contain anti-Fra2. SS, supershifted bands.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Figure 4:EMSA supershift of JunD and FosB in OC-VDRE complexes from extracts treated for 0-72 h with VD3. Nuclear extracts were prepared from RWLeu-4 (A) or JMRD3 (B) cells treated with 50 nM VD3 for 0 (lanes1-3), 24 h (lanes 4-6), 48 h (lanes 7-9), or 72 h (lanes 10-12). EMSA supershift assays were performed with 15 μg of nuclear extract as described in Fig. 3. Lanes 1, 4, 7, and 10 contain no added antibodies; lanes 2, 5, 8, and 11 contain 1 μg of antibody against JunD proteins; lanes 3, 6, 9, and 12 contain 1 μg of antibody against FosB as an isotype-specific negative control. Lane13 contains 72-h extracts with 100-fold molar excess of unlabeled OC-VDRE added.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Western immunoblots, shown in Fig. 5, confirm that JunD protein in nuclear extracts increases in the sensitive cells after VD3 treatment while the level of detectable JunD protein decreases in extracts from the resistant cells. Slight increases are seen in JunB, FosB, and Fra1 expression in RWLeu-4 cells, although differences in the participation of these proteins in AP-1 complexes that bind to the OC-VDRE have not been detected. In addition, this figure shows that extended treatment of RWLeu-4 cells with VD3 causes JunD to form a doublet band on immunoblots (lanes3 and 4). This could be due to alterations in the structure of JunD, perhaps through changes in phosphorylation, that could modulate the activity or accumulation of the transcription factor(30Papavassiliou A.G. Anticancer Res. 1993; 13: 2213-2220PubMed Google Scholar, 31Abate C. Baker S.J. Lees M.S. Anderson C.W. Marshak D.R. Curran T. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 6766-6770Crossref PubMed Scopus (60) Google Scholar).Figure 5:Detection of AP-1 oncoproteins by Western immunoblotting. Nuclear extracts were prepared from RWLeu-4 (lanes 1-4) and JMRD3 (lanes5-8) cells treated with 50 nM VD3 for 0 h (lanes 1 and 5), 24 h (lanes 2 and 6), 48 h (lanes 3 and 7), and 72 h (lanes 4 and 8). Aliquots containing 10 μg of protein were separated on a 10% SDS-polyacrylamide gel and transferred to Hybond™ membranes (Amersham Corp.). Membranes were blocked, incubated with antibodies, and visualized by ECL as described under "Experimental Procedures." Nonspecific binding was determined by omitting the first antibody or by blocking with a 10-fold excess of antibody-specific peptides.View Large Image Figure ViewerDownload Hi-res image Download (PPT)These results show that both the VD3-sensitive RWLeu-4 and VD3-resistant JMRD3 CML cell lines express active VDRs that are capable of binding to VDREs. The primary difference detected between the sensitive and resistant cell lines lies in the expression or activity of the AP-1 transcription factors. In particular, the DNA binding activity of JunD in AP-1 complexes is increased in the sensitive cells but is decreased in the resistant cells. This observation is particularly salient considering the results of Pfarr et al.(32Pfarr C.M. Mechta F. Spyrou G. Lallemand D. Carillo S. Yaniv M. Cell. 1994; 76: 747-760Abstract Full Text PDF PubMed Scopus (284) Google Scholar), which demonstrate that JunD can decrease the transforming ability of activated Ras proteins. In CML, the fusion of the bcr and abl proto-oncogenes results in the expression of a chimeric p210bcr-abl tyrosine kinase that can circumvent the need for extracellular signals to activate the Ras signal transduction pathway, thus leading to uncontrolled proliferation (33Daley G.Q. Van Etten R.A. Baltimore D. Science. 1991; 247: 824-830Crossref Scopus (1913) Google Scholar, 34Thomas M. Kosciolek B. Wang N. Rowley P. Leuk. Res. 1994; 18: 401-408Crossref PubMed Scopus (13) Google Scholar) or escape from apoptosis(35Smetsers T. Skorski T. van de Locht L. Wessels H. Pennings A. De W.T. Calabretta B. Mensink E. Leukemia (Baltimore). 1994; 8: 129-140PubMed Google Scholar, 36Bedi A. Zehnbauer B.A. Barber J.P. Sharkis S.J. Jones R.J. Blood. 1994; 83: 2038-2044Crossref PubMed Google Scholar). Therefore, the increased JunD activity in response to VD3 in the sensitive cells may indirectly inhibit the proliferative signals from p210bcr-abl and lead to a cessation of proliferation and induction of differentiation.The results presented here suggest that the anti-proliferative actions of VD3 in these CML cells are mediated, at least in part, by alterations in the nature of the Jun and Fos family members in AP-1 transcription factors. These changes could differentially regulate the expression of specific subsets of genes that are integral to the process of proliferation. INTRODUCTION1,25-Dihydroxyvitamin D3 (VD3) 1The abbreviations used are: VD31,25-dihydroxyvitamin D3VDR1,25-dihydroxyvitamin D3 receptorVDRE1,25-dihydroxyvitamin D3-response elementOC-VDREosteocalcin-VDREDR3-VDREdirect repeat with 3-nucleotide spacer VDREAP-1activator protein-1CMLchronic myelogenous leukemiaEMSAelectrophoretic mobility shift assay(s). plays an important role in regulating the proliferation and differentiation of myeloid cells(1Pols H. Birkenhäger J.C. Foekens J.A. Van L.J. J. Steroid Biochem. Mol. Biol. 1990; 37: 873-876Crossref PubMed Scopus (100) Google Scholar, 2Suda T. Shinki T. Takahashi N. Annu. Rev. Nutr. 1990; 10: 195-211Crossref PubMed Scopus (98) Google Scholar, 3Koeffler H.P. Neth O. Gallo R.C. Greaves M.F. Janka G.E. Vitamin D: Myeloid Differentiation and Proliferation. Haematology and Blood Transfusion. Vol. 29. Springer-Verlag, Berlin/Heidelberg1985: 409-417Google Scholar, 4Studzinski G.P. McLane J.A. Uskokovic M.R. Crit. Rev. Eukaryotic Gene Expression. 1993; 3: 279-312PubMed Google Scholar). Many of the effects of VD3 are mediated through the binding and activation of high affinity nuclear receptors (VDRs) (5Pike J.W. Annu. Rev. Nutr. 1991; 11: 189-216Crossref PubMed Scopus (283) Google Scholar) that show extensive sequence similarity to steroid, thyroid, retinoid, and orphan nuclear receptors(6McDonnell D. Pike J.W. O'Malley B.W. J. Steroid Biochem. 1988; 30: 41-46Crossref PubMed Scopus (54) Google Scholar, 7Umesono K. Murakami K.K. Thompson C.C. Evans R.M. Cell. 1991; 65: 1255-1266Abstract Full Text PDF PubMed Scopus (1488) Google Scholar). The activity and response element specificity of the VDR can be enhanced by nuclear accessory factors such as the retinoid receptors and other non-receptor transcription factors such as activator protein-1 (AP-1)(8Liao J. Ozono K. Sone T. McDonnell D.P. Pike J.W. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 9751-9755Crossref PubMed Scopus (165) Google Scholar, 9Yu V.C. Delsert C. Andersen B. Holloway J.M. Devary O.V. Näär A.M. Kim S.Y. Boutin J.M. Glass C.K. Rosenfeld M.G. Cell. 1991; 67: 1251-1266Abstract Full Text PDF PubMed Scopus (1051) Google Scholar).Much attention has focused upon the AP-1 transcription factor, which consists of a family of proteins related to and including the c-Fos (FosB, Fra1, and Fra2) and c-Jun (JunB, JunD) proto-oncogene products (10Pfahl M. Endocr. Rev. 1993; 14: 651-658Crossref PubMed Scopus (447) Google Scholar, 11Radler P.A. Gebel S. Sachsenmaier C. König H. Krämer M. Oehler T. Streile M. Ponta H. Rapp U. Rahmsdorf H.J. Cato A. Angel P. Herrlich P. Ann. N. Y. Acad. Sci. 1993; 684: 127-148Crossref PubMed Scopus (47) Google Scholar). The dimeric forms of Jun and Fos family members bind to DNA exhibiting a consensus sequence of TGA(C/T)TCA while monomers are unable to functionally bind to DNA. These genes are expressed in a cell stage, lineage, and inducer-specific manner(11Radler P.A. Gebel S. Sachsenmaier C. König H. Krämer M. Oehler T. Streile M. Ponta H. Rapp U. Rahmsdorf H.J. Cato A. Angel P. Herrlich P. Ann. N. Y. Acad. Sci. 1993; 684: 127-148Crossref PubMed Scopus (47) Google Scholar, 12Angel P. Allegretto E.A. Okinko S.T. Hattori K. Boyle W.J. Hunter T. Karin M. Nature. 1988; 332: 166-171Crossref PubMed Scopus (683) Google Scholar, 13Vedeckis W.V. Proc. Soc. Exp. Biol. Med. 1992; 199: 1-12Crossref PubMed Scopus (21) Google Scholar), and it has been demonstrated that although the Jun family members can bind to the same DNA sequences, they do so with different affinities and may elicit different responses with regard to expression of target genes(14Deng T. Karin M. Genes & Dev. 1993; 7: 479-490Crossref PubMed Scopus (287) Google Scholar, 15Doucas V. Spyrou G. Yaniv M. EMBO J. 1991; 10: 2237-2245Crossref PubMed Scopus (106) Google Scholar, 16Ryseck R.P. Kovary K. Bravo R. Oncogene. 1990; 5: 1091-1093PubMed Google Scholar). Since alterations in AP-1 activity can interfere with normal cell cycle progression, this transcription factor may modulate the expression of genes involved in cell growth and differentiation(17Angel P. Karin M. Biochim. Biophys. Acta. 1991; 1072: 129-157Crossref PubMed Scopus (3248) Google Scholar, 18Bradley M.O. Manam S. Kraynak A.R. Nichols W.W. Ledwith B.J. Ann. N. Y. Acad. Sci. 1992; 660: 124-135Crossref PubMed Scopus (4) Google Scholar, 19Curran T. Franza B.R.J. Cell. 1988; 55: 395-397Abstract Full Text PDF PubMed Scopus (1309) Google Scholar). Considering that VD3 treatment causes myeloid leukemia cells to differentiate into monocyte/macrophage-like cells and cease proliferating(3Koeffler H.P. Neth O. Gallo R.C. Greaves M.F. Janka G.E. Vitamin D: Myeloid Differentiation and Proliferation. Haematology and Blood Transfusion. Vol. 29. Springer-Verlag, Berlin/Heidelberg1985: 409-417Google Scholar, 20Lasky S.R. Bell W. Huhn R.D. Posner M.R. Wiemann M. Calabresi P. Eil C. Cancer Res. 1990; 50: 3087-3094PubMed Google Scholar), one might expect that the activity of members of the Fos and Jun families would be modified during VD3-induced inhibition of proliferation and induction of differentiation(21Kolla S.S. Studzinski G.P. Cancer Res. 1994; 54: 1418-1421PubMed Google Scholar, 22Lian J.B. Stein G.S. Bortell R. Owen T.A. J. Cell. Biochem. 1991; 45: 9-14Crossref PubMed Scopus (77) Google Scholar).Investigations into the effects of VD3 on the human chronic myelogenous leukemia (CML) cell line RWLeu-4 have shown that subnanomolar concentrations of VD3 inhibit the proliferation and induce monocyte/macrophage-like differentiation of these cells(20Lasky S.R. Bell W. Huhn R.D. Posner M.R. Wiemann M. Calabresi P. Eil C. Cancer Res. 1990; 50: 3087-3094PubMed Google Scholar). To further investigations into the mechanism of the anti-proliferative action of this hormone, a variant of the RWLeu-4 cell line, called JMRD3, in which proliferation is not inhibited by VD3 concentrations greater than 0.1 μM, has been derived(23Lasky S.R. Posner M.R. Iwata K. Santos M.A. Yen A. Samuel V. Clark J. Maizel A.L. Blood. 1994; 84: 4283-4294Crossref PubMed Google Scholar). Although most previously described VD3-resistant cell lines have mutations in the VDR(24Feldman D. Malloy P.J. Mol. Cell. Endocrinol. 1990; 72: C57-C62Crossref PubMed Scopus (48) Google Scholar, 25Hughes M. Malloy P. Kieback D. Kesterson R. Pike J.W. Feldman D. O'Malley B. Science. 1988; 242: 1702-1705Crossref PubMed Scopus (418) Google Scholar, 26Malloy P. Hochberg Z. Pike J. Feldman D. J. Clin. Endocrinol. Metab. 1989; 68: 263-269Crossref PubMed Scopus (78) Google Scholar), initial characterization of the VDR expressed in RWLeu-4 and JMRD3 cells indicates that there are no significant differences in the affinity for VD3 or number of receptors expressed in these lines(23Lasky S.R. Posner M.R. Iwata K. Santos M.A. Yen A. Samuel V. Clark J. Maizel A.L. Blood. 1994; 84: 4283-4294Crossref PubMed Google Scholar). Furthermore, no differences are found in the DNA coding for the receptor or the induction of VD3-responsive genes in the sensitive and resistant cells(23Lasky S.R. Posner M.R. Iwata K. Santos M.A. Yen A. Samuel V. Clark J. Maizel A.L. Blood. 1994; 84: 4283-4294Crossref PubMed Google Scholar).A series of experiments are reported herein which show that nuclear extracts from the sensitive and resistant cells express VDRs that bind to the human osteocalcin-vitamin D-response element (OC-VDRE) along with AP-1 proteins and that the activity of these complexes is regulated by VD3. We also show that the inhibition of proliferation by VD3 in the sensitive cells is accompanied by an increase in the DNA binding activity of AP-1 and that JunD is a major constituent of these AP-1 complexes. These results suggest that AP-1, and in particular JunD, may play an important role in the anti-proliferative actions of VD3.