Transgenic Mice Demonstrate Novel Promoter Regions for Tissue-Specific Expression of the Urokinase Receptor Gene
2003; Elsevier BV; Volume: 163; Issue: 2 Linguagem: Inglês
10.1016/s0002-9440(10)63675-9
ISSN1525-2191
AutoresHeng Wang, John Hicks, Parham Khanbolooki, Sun-Jin Kim, Chunhong Yan, Yao Wang, Douglas Boyd,
Tópico(s)Signaling Pathways in Disease
ResumoThe urokinase-type plasminogen activator receptor (u-PAR) contributes to cell migration and proteolysis in normal and cancerous tissues. Currently, there are no reports on the regulatory regions directing tissue-specific expression. Consequently, we undertook a study to identify novel promoter regions required for expression of this gene in transgenic mice bearing a LacZ reporter regulated by varying amounts (0.4, 1.5, and 8.5 kb) of upstream sequence. The 0.4-kb u-PAR upstream sequence directed weak and strong LacZ expression in the placenta and epididymis, respectively, both of which are tissues that express endogenous u-PAR. Conversely, transgene expression in the apical cells of the colon positive for endogenous u-PAR protein required 1.5 kb of upstream sequence for optimal expression. Furthermore, chromatin accessibility assays coupled with real-time polymerase chain reaction suggested a putative regulatory region spanning −1295/−1192 driving u-PAR expression in colonic cells. Interestingly, placental transgene expression was augmented with the 8.5-kb upstream fragment compared with the shorter 1.5-kb fragment indicating contributing element(s) between −1.5 and −8.5 kb. Thus, while 0.4 kb of upstream sequence directs u-PAR expression in the epididymis, sequences located between −0.4 and −1.5 kb and between −1.5 and −8.5 kb are required for optimal tissue-specific expression in the colon and the placenta, respectively. The urokinase-type plasminogen activator receptor (u-PAR) contributes to cell migration and proteolysis in normal and cancerous tissues. Currently, there are no reports on the regulatory regions directing tissue-specific expression. Consequently, we undertook a study to identify novel promoter regions required for expression of this gene in transgenic mice bearing a LacZ reporter regulated by varying amounts (0.4, 1.5, and 8.5 kb) of upstream sequence. The 0.4-kb u-PAR upstream sequence directed weak and strong LacZ expression in the placenta and epididymis, respectively, both of which are tissues that express endogenous u-PAR. Conversely, transgene expression in the apical cells of the colon positive for endogenous u-PAR protein required 1.5 kb of upstream sequence for optimal expression. Furthermore, chromatin accessibility assays coupled with real-time polymerase chain reaction suggested a putative regulatory region spanning −1295/−1192 driving u-PAR expression in colonic cells. Interestingly, placental transgene expression was augmented with the 8.5-kb upstream fragment compared with the shorter 1.5-kb fragment indicating contributing element(s) between −1.5 and −8.5 kb. Thus, while 0.4 kb of upstream sequence directs u-PAR expression in the epididymis, sequences located between −0.4 and −1.5 kb and between −1.5 and −8.5 kb are required for optimal tissue-specific expression in the colon and the placenta, respectively. The urokinase-type plasminogen activator receptor (u-PAR), a 45- to 60-kd glycosylated cell surface receptor (u-PAR)1Nielsen L Kellerman GM Behrendt N Picone R Dano K Blasi F A 55, 000–60, 000 Mr receptor protein for urokinase-type plasminogen activator.J Biol Chem. 1988; 263: 2358-2363Abstract Full Text PDF PubMed Google Scholar linked to the cell surface via a glycolipid chain2Behrendt N Ploug M Patthy L Houen G Blasi F Dano K The ligand-binding domain of the cell surface receptor for urokinase-type plasminogen activator.J Biol Chem. 1991; 266: 7842-7847Abstract Full Text PDF PubMed Google Scholar, 3Ploug M Ronne E Behrendt N Jensen A Blasi F Dano K Cellular receptor for urokinase plasminogen activator.J Biol Chem. 1991; 266: 1926-1933Abstract Full Text PDF PubMed Google Scholar plays a critical role in cell migration, adhesion and extracellular matrix degradation in both physiology and pathology. In cancer, these cellular functions are critical requirements in tumor cell invasion4Romer J Lund LR Eriksen J Pyke C Kristensen P Dano K The receptor for urokinase-type plasminogen activator is expressed by keratinocytes at the leading edge during re-epithelialization of the mouse skin wounds.J Invest Dermatol. 1994; 102: 519-522Abstract Full Text PDF PubMed Google Scholar, 5Bugge TH Shu TT Flick MJ Daugherty CC Romer J Solberg H Ellis V Dano K Degen JL The receptor for urokinase-type plasminogen activator is not essential for mouse development or fertility.J Biol Chem. 1995; 270: 16886-16894Crossref PubMed Scopus (196) Google Scholar, 6Kook YH Adamski J Zelent A Ossowski L The effect of antisense inhibition of urokinase receptor in human squamous cell carcinoma on malignancy.EMBO J. 1994; 13: 3983-3991Crossref PubMed Scopus (176) Google Scholar, 7Quattrone A Fibbi G Anichini E Pucci M Zamperini A Capaccioli S Del Rosso M Reversion of the invasive phenotype of transformed human fibroblasts by anti-messenger oligonucleotide inhibition of urokinase receptor gene expression.Cancer Res. 1995; 55: 90-95PubMed Google Scholar and indeed, several previous observations indicate a prominent role for u-PAR in tumor cell invasion and metastasis. Thus, a high u-PAR protein level is predictive of shortened survival for patients with colon cancer8Stephens R Nielsem HJ Christensen IJ Thorlacius-Ussing O Sorensen S Dano K Brunner N Plasma urokinase receptor levels in patients with colorectal cancer: relationship to prognosis.J Natl Cancer Inst. 1999; 91: 869-874Crossref PubMed Scopus (286) Google Scholar, 9Ganesh S Sier CFM Heerding MM Griffioen G Lamers CBH Verspaget HW Urokinase receptor and colorectal cancer survival.Lancet. 1994; 344: 401-402Abstract PubMed Scopus (173) Google Scholar and gene expression profiling has revealed up-regulated expression of this binding site in various malignancies.10Nestl A Von Stein OD Zatloukal K Thies W-G Herrlich P Hofmann M Sleeman JP Gene expression patterns associated with the metastatic phenotype in rodent and human tumors.Cancer Res. 2001; 61: 1569-1577PubMed Google Scholar Furthermore, studies with pharmacological and peptide antagonists or antisense strategies directed against the u-PAR have demonstrated their efficacy against growth, angiogenesis, and invasiveness of divergent malignancies.6Kook YH Adamski J Zelent A Ossowski L The effect of antisense inhibition of urokinase receptor in human squamous cell carcinoma on malignancy.EMBO J. 1994; 13: 3983-3991Crossref PubMed Scopus (176) Google Scholar, 11Mishima K Mazar A Gown A Skelly M Ji X-D Wang X-D Jones TR Cavenee WK Huang H-J A peptide derived from the non-receptor-binding region of urokinase plasminogen activator inhibits glioblastoma growth and angiogenesis in vivo in combination with cisplatin.Proc Natl Acad Sci USA. 2000; 97: 8484-8489Crossref PubMed Scopus (91) Google Scholar, 12Mohanam S Chintala SK Go Y Bhattarcharya A Boyd D Rao JS In vitro inhibition of human glioblastoma cell line invasiveness by antisense uPA receptor.Oncogene. 1997; 14: 1351-1359Crossref PubMed Scopus (102) Google Scholar, 13Hollas W Blasi F Boyd D Role of the urokinase receptor in facilitating extracellular matrix invasion by cultured colon cancer.Cancer Res. 1991; 51: 3690-3695PubMed Google Scholar, 14Rabbani SA Gladu J Urokinase receptor antibody can reduce tumor volume and detect the presence of occult tumor metastases in vivo.Cancer Res. 2002; 62: 2390-2397PubMed Google Scholar The u-PAR contributes to the aforementioned cellular functions via different mechanisms. First, the serine protease urokinase bound to this receptor activates plasminogen at a much faster rate than fluid-phase plasminogen activator, thereby augmenting extracellular matrix degradation.15Ellis V Behrendt N Dano K Plasminogen activation by receptor-bound urokinase.J Biol Chem. 1991; 266: 12752-12758Abstract Full Text PDF PubMed Google Scholar Second, the binding site clears urokinase-inhibitor complexes from the extracellular space16Cubellis M Wun T Blasi F Receptor-mediated internalization and degradation of urokinase is caused by its specific inhibitor PAI-1.EMBO J. 1990; 9: 1079-1085Crossref PubMed Scopus (332) Google Scholar, 17Conese M Olson D Blasi F Protease nexin-1-urokinase complexes are internalized and degraded through a mechanism that requires both urokinase receptor and α2-macroglobulin receptor.J Biol Chem. 1994; 269: 17886-17892Abstract Full Text PDF PubMed Google Scholar via an α2 macroglobulin receptor-dependent mechanism. Third, the u-PAR interacts with the extracellular domain of integrins thereby mediating cell adhesion and migration.18Wei Y Lukashev M Simon DI Bodary SC Rosenberg S Doyle MV Chapman HA Regulation of integrin function by the urokinase receptor.Science. 1996; 273: 1551-1555Crossref PubMed Scopus (699) Google Scholar, 19Yebra M Parry GCN Stromblad S Mackman N Rosenberg S Mueller BM Cheresh DA Requirement of receptor-bound urokinase-type plasminogen activator for integrin αvβ5-directed cell migration.J Biol Chem. 1996; 271: 29393-29399Crossref PubMed Scopus (224) Google Scholar Recently, it has been shown that the seven-transmembrane receptor FPR-like receptor-1/lipoxin A4 receptor, a G-protein-coupled receptor directly interacts with a soluble cleaved form of u-PAR to induce chemotaxis.20Resnati M Pallavicini I Wang JM Oppenheim J Serhan CN Romano M Blasi F The fibrinolytic receptor for urokinase activates the G protein-coupled chemotactin receptor FPRL1/LXA4R.Proc Natl Acad Sci USA. 2002; 99: 1359-1364Crossref PubMed Scopus (329) Google Scholar The amount of u-PAR protein is controlled mainly at the transcriptional level, although altered message stability and receptor recycling also contributes to the quantity of this gene product.21Shetty S Kumar A Idell S Posttranscriptional regulation of urokinase receptor mRNA: identification of a novel urokinase receptor mRNA binding protein in human mesothelioma cells.Mol Cell Biol. 1997; 17: 1075-1083Crossref PubMed Scopus (107) Google Scholar Our laboratory and others have previously reported several upstream transcriptional elements regulating u-PAR expression in tissue culture. In the first study, Soravia et al22Soravia E Grebe A De Luca P Helin K Suh TT Degen JL Blasi F A conserved TATA-less proximal promoter drives basal transcription from the urokinase-type plasminogen activator receptor gene.Blood. 1995; 86: 624-635Crossref PubMed Google Scholar demonstrated that the basal expression of the gene was regulated via Sp1 motifs located about 100 bp upstream of the transcriptional start site. Subsequently, our laboratory showed that both constitutive and phorbol 12-myristate 13-acetate (PMA)-inducible expression of the gene required a footprinted region (−190/−171) of the promoter containing an AP-1 motif23Lengyel E Wang H Stepp E Juarez J Doe W Pfarr CM Boyd D Requirement of an upstream AP-1 motif for the constitutive and phorbol ester-inducible expression of the urokinase-type plasminogen activator receptor gene.J Biol Chem. 1996; 271: 23176-23184Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar as well as a second footprinted region (−148/−124) bound with an AP-2α-related factor and Sp1/Sp3.24Allgayer H Wang H Wang Y Heiss MM Bauer R Nyormoi O Boyd DD Transactivation of the urokinase-type plasminogen activator receptor gene through a novel promoter motif bound with an activator protein-2α-related factor.J Biol Chem. 1999; 274: 4702-4714Crossref PubMed Scopus (36) Google Scholar Hapke and co-workers25Hapke S Gawaz M Dehne K Kohler J Marshall JF Graeff H Schmitt M Reuning U Lengyel E β3A-integrin down-regulates the urokinase-type plasminogen activator receptor (u-PAR) through a PEA3/ets transcriptional silencing element in the u-PAR promoter.Mol Cell Biol. 2001; 21: 2118-2132Crossref PubMed Scopus (55) Google Scholar implicated a PEA3/Ets silencing motif located at −248 while Wang et al26Wang Y Dang J Wang H Allgayer H Murrell GA Boyd D Identification of a novel nuclear factor-κ B sequence involved in expression of the urokinase-type plasminogen activator receptor.Eur J Biochem. 2000; 267: 3248-3254Crossref PubMed Scopus (68) Google Scholar demonstrated a novel NF-κB element (located at −45)required for expression of this gene in cultured cells. While these studies have been informative, they have two limitations. First, they provide no information on tissue-specific regulation of gene expression. Second, since the aforementioned studies all used transiently transfected, non-integrated reporter plasmids, the influence of the chromatin structure (DNA wrapped around core histone proteins in the nucleus) on gene expression is not addressed. To overcome these limitations, we have used a transgenic approach to identify previously undescribed regions of the u-PAR promoter required for its expression in its chromatinized environment in u-PAR-expressing tissues in the mouse. The −0.4 u-PAR LacZ transgene was constructed as follows. The nucleotide fragment (−392/+52 relative to the transcription start site) derived from −398 u-PAR23Lengyel E Wang H Stepp E Juarez J Doe W Pfarr CM Boyd D Requirement of an upstream AP-1 motif for the constitutive and phorbol ester-inducible expression of the urokinase-type plasminogen activator receptor gene.J Biol Chem. 1996; 271: 23176-23184Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar was digested with XbaI and the fragment cloned into the SmaI site of pBSSK-AUG-β-Gal plasmid upstream of the β-Galactosidase (LacZ) coding sequence. To generate the −1.5 u-PAR LacZ transgene, the nucleotide sequence (−1469/+52 relative to the transcription start site) was generated by PCR from normal human genomic DNA and subcloned into pBSSK-AUG-β-Gal as described for the shorter fragment. To generate the −8.5 u-PAR LacZ transgene, a nucleotide fragment spanning −8500/+52 (relative to the transcription start site) of the u-PAR gene was derived by PCR from cosmid R23816 (kindly provided by Lawrence Livermore National Laboratory, Livermore, CA). This cosmid includes the nucleotide sequence spanning chromosome 19q 13.2 from AKT 2 to D19S178 of which approximately 15 kb corresponds to the u-PAR flanking sequence. The PCR-amplified insert was subcloned into the NotI/XbaI site of the pJ251 reporter plasmid upstream of the β-Galactosidase coding sequence. DNA sequencing, restriction digestions and PCR were used to confirm orientation, nucleotide sequence and integrity of the 3 constructs. Founder mice were generated by the MD Anderson Cancer Transgenic Core Facility using B6D2F1J mice (a cross of the C57BL6 and DBA2 mouse strains) essentially as described previously.27Hogan B Beddington R Costantini F Ley E Production of transgenic mice.in: Hogan B Beddington R Costantini F Ley E Manipulating the Mouse Embryo. Cold Spring Harbor Laboratory Press, Plainview, New York1994: 217-252Google Scholar Briefly, purified, linear DNA comprised of the fused u-PAR promoter fragment-LacZ reporter (1 ng/μl) dissolved in a TE buffer (10 mmol/L Tris (pH 7.4), 0.1 mmol/L EDTA) was microinjected into the pronuclei of fertilized mouse eggs when the eggs were at their maximum size but before the nuclear membrane disappeared before first cleavage. Eggs that survived the injections were transferred into the oviduct of 0.5-day post-coitus pseudopregnant female mice. Mice born from microinjected eggs (founders) were subsequently screened by Southern blotting for transgene integration (see below). Positive founder lines were maintained by crossing with C57 Black breeders. Tissues were fixed for 1 hour at 4°C with a 0.1 mol/L phosphate-buffered solution (pH 7.3) containing 0.2% glutaraldehyde, 2% formalin, 5 mmol/L EGTA, 2 mmol/L MgCl2. Tissues were subsequently rinsed three times in a 0.1 mol/L phosphate-buffered solution (pH 7.3) containing 0.1% sodium deoxycholate, 0.2% NP40, 2 mmol/L MgCl2. After this, tissues were stained for LacZ expression overnight with a solution containing 1 mg/ml X-gal, 5 mmol/L potassium ferricyanide, and 5 mmol/L potassium ferrocyanide. The following day, tissues were rinsed and paraffin-embedded. Counterstaining with Nuclear Fast Red was accomplished after de-paraffinization. X-gal staining intensity was quantified with Optima (version 6.5) software (Media Cybernetics, Silver Spring, MD) using a minimum of five independent measurements (3 μm) per slide. For each construct, transgene expression was determined in mice derived from at least three independent founder lines. Results were only regarded as valid if the observations were made in at least two of the three founder lines. Western blotting for u-PAR was performed as described previously with modifications.28Allgayer H Wang H Gallick GE Crabtree A Mazar A Jones T Kraker AJ Boyd DD Transcriptional induction of the urokinase receptor gene by a constitutively active Src: requirement of an upstream motif (-152/-135) bound with Sp1.J Biol Chem. 1999; 274: 18428-18445Crossref PubMed Scopus (70) Google Scholar Tissues were homogenized in a buffer containing 10 mmol/L Tris-HCl (pH7.4), 150 mmol/L NaCl, 1.0% Triton-X 100, 0.5% NP-40, 1 mmol/L EDTA (pH 8), 1 mmol/L EGTA (pH 8), 1 mmol/L phenylmethylsulfonyl fluoride, and 10 μg/ml Aprotinin. After centrifugation, proteins in the supernatant (10 μg) were resolved in a 10% polyacrylamide gel under non-reducing conditions. Following protein transfer to a polyvinylidene difluoride membrane, the membrane was blocked in a 3% bovine serum albumin solution overnight. Subsequently, the blot was probed with 2 μg/ml of a rabbit polyclonal anti-mouse u-PAR antibody29Solberg H Ploug M Hoyer-Hansen G Nielsen BS Lund LR The murine receptor for urokinase-type plasminogen activator is primarily expressed in tissues actively undergoing remodeling.J Histochem Cytochem. 2001; 49: 237-246Crossref PubMed Scopus (110) Google Scholar for 2 hours. After multiple rinses, the blot was incubated with an anti-rabbit secondary antibody horseradish peroxidase-conjugate (1:5000) and immunoreactive products visualized by enhanced chemiluminescence. Loading equality was checked with an antibody to GAPDH (# 374-Chemicon; Temecula, CA). This method was carried out essentially as described previously29Solberg H Ploug M Hoyer-Hansen G Nielsen BS Lund LR The murine receptor for urokinase-type plasminogen activator is primarily expressed in tissues actively undergoing remodeling.J Histochem Cytochem. 2001; 49: 237-246Crossref PubMed Scopus (110) Google Scholar with minor modifications in that blocking was accomplished with 5% normal horse serum/1% normal goat serum and 3,3′ diaminobenzidine tetrahydrochloride (DAB) was used as substrate for visualization of immunoreactive products. As a control, the primary anti-u-PAR antibody was replaced with an equivalent amount of non-immune rabbit IgG. Counterstaining was achieved with hematoxylin. Southern blotting was carried out as described by our lab.30Wang H Skibber J Juarez J Boyd D Transcriptional activation of the urokinase receptor gene in invasive colon cancer.Int J Cancer. 1994; 58: 650-657Crossref PubMed Scopus (40) Google Scholar Tail tissues were digested with proteinase K in a buffer containing 0.5% SDS, 25 mmol/L EDTA, 10 mmol/L NaCl, and 10 mmol/L Tris-Cl (pH 8.0). Genomic DNA purified by multiple extractions with phenol/chloroform:isoamyl-alcohol (24:1) and RNA-ase treatment (37°C, 1 hour) was digested at 37°C, overnight with restriction endonucleases (EcoRV/Asp718- for the −0.4 and −1.5 and EcoRV/EcoRI for the −8.5 u-PAR LacZ constructs, respectively). Cleavage products were resolved by electrophoresis and transferred to a nylon filter after acid/base treatment. The transgene was detected using a radioactive ClaI/EcoRV-generated 0.3 kb cDNA complementary to the LacZ coding sequence. These were performed essentially as described elsewhere.31Weinmann AS Plevy SE Smale ST Rapid and selective remodeling of a positioned nucleosome during the induction of IL-12 p50 transcription.Immunity. 1999; 11: 665-675Abstract Full Text Full Text PDF PubMed Scopus (158) Google Scholar, 32Rao S Procko E Shannon MF Chromatin remodeling, measured by a novel real-time polymerase chain reaction assay, across the proximal promoter region of the IL-2 gene.J Immunol. 2001; 167: 4494-4503Crossref PubMed Scopus (176) Google Scholar Briefly, 5 × 106 cells were resuspended in hypotonic buffer (10 mmol/L Tris-HCl, pH 7.4, 10 mmol/L NaCl, 3 mmol/L MgCl2, 0.15 mmol/L spermine, and 0.5 mmol/L spermidine), and incubated on ice for 5 minutes. NP-40 was then added (final concentration, 0.5%) and the cells vortexed and incubated on ice for another 5 minutes. Nuclei were harvested by centrifugation, washed twice with RE buffer (10 mmol/L Tris-HCl, pH 7.4, 50 mmol/L NaCl, 10 mmol/L MgCl2, 0.2 mmol/L EDTA, 0.2 mmol/L EGTA, 1 mmol/L DTT, 0.15 mmol/L spermine, and 0.5 mmol/L spermidine), and then resuspended in 90 μl buffer H (Roche Applied Science, Indianapolis, IN).Restriction digestions were performed at 37°C with 100 U of PstI for the indicated times. The reactions were terminated with 2X proteinase K buffer (100 mmol/L Tris-HCl, pH 7.5, 200 mmol/L NaCl, 2 mmol/L EDTA, 1% SDS). Reaction mixtures were then supplemented with 50 μl 2X proteinase K buffer, 50 μl RE buffer, and 50 μg RNase A and incubated for 30 minutes. Subsequently, 80 μg proteinase K was added and the reaction continued at 37°C overnight. Genomic DNA was harvested by phenol/chloroform extractions and ethanol precipitation, and then dissolved in TE buffer. Real-time PCR was then used to determine the amount of uncut DNA. This method was performed with an ABI Prism 7000 Sequence Detection System (Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. DNA samples (100 ng) were mixed with 1X SYBR Green PCR master mix (Applied Biosystems) and 1 μmol/L of each primer (−1295/−1275- 5′GCAGTGGTGCAATCATAGCTC3′ and −1192/−1213- 5′AGTGGCCCGTACTTGTAGTCCT 3) and loaded into the ABI Detection System. After incubating at 95°C for 10 minutes to activate the AmpliTaq Gold enzyme, the mixes were subjected to 40 amplification cycles (15 seconds at 95°C for denaturation and 1 minute for annealing and extension at 60°C). After PCR, a Ct value was obtained using the software provided by the manufacturer. A ΔCt value reflecting the difference in Ct values between the digestion samples at different time points (Sn) and undigested sample (S0) was calculated32Rao S Procko E Shannon MF Chromatin remodeling, measured by a novel real-time polymerase chain reaction assay, across the proximal promoter region of the IL-2 gene.J Immunol. 2001; 167: 4494-4503Crossref PubMed Scopus (176) Google Scholar by subtracting the Ct value for the former from the latter ie, ΔCt = Ct(S0) − Ct(Sn). The PstI uncut DNA amount in the digested samples was then calculated by raising 2 to the ΔCt power followed by multiplying by 100 (100 ng is the uncut DNA amount for the undigested sample), ie, uncut DNA amount for the samples = 100 * 2ΔCt. Therefore, the cut DNA amount equals to 100 − 100 * 2ΔCt, and the cut % was calculated as follows: cut % = 100 × (cut amount/total amount) = 100 * ((100 − 100 * 2ΔCt)/100) = 100*(1 − 2ΔCt) = 100 * (1 − 2(Ct(S0) − Ct(Sn))). Transgenic mice bearing a LacZ reporter regulated by varying amounts of the 5′ u-PAR sequence (Figure 1, A to D) were generated. Southern blotting (Figure 1, B to D) using a ClaI/EcoRV-generated cDNA corresponding to the LacZ coding sequence (Figure 1A, probe) verified the presence of the integrated constructs bearing 0.4, 1.5, and 8.5 kb of upstream sequence (Figure 1, B to D, respectively) in the transgenic mice. Subsequent analysis of transgene expression was performed on mice showing a similar band intensity in Southern blots indicative of comparable copy number. Because our studies using transiently transfected plasmids in tissue culture had revealed that 0.4 kb of upstream sequence was sufficient for “driving” expression of this gene, we first asked whether this amount of upstream sequence could also regulate expression of a LacZ reporter in transgenic mice in a manner coincident with expression of the endogenous u-PAR gene. In normal mice, the placenta, characterized by its extensive tissue remodeling reminiscent of invasive cancer, has the highest constitutive expression of the u-PAR gene of all organs examined.33Almus-Jacobs F Varki N Sawdey MS Loskutoff DJ Endotoxin stimulates expression of the murine urokinase receptor gene in vivo.Am J Pathol. 1995; 147: 688-698PubMed Google Scholar Thus, we first determined whether the −0.4 u-PAR LacZ transgene was expressed in this organ. F1 mice shown to be positive for this transgene (Figure 1B) by Southern blotting were mated, 14-day placentas harvested, fixed, and either stained with X-gal or subjected to immunohistochemistry for the endogenous u-PAR protein. Expectedly, strong u-PAR protein immunoreactivity was evident in this tissue (Figure 2A, arrows) and staining was specific because it was abolished with non-immune rabbit IgG. More importantly, transgene expression as indicated by X-gal staining (Figure 2B, right, arrows) was evident in the placentas although the X-gal staining intensity was weak. LacZ expression was evident in placentas derived from at least four separate founder lines (Table 1). No X-gal staining was observed in placentas derived from breeder mice (Figure 2B, left). Thus, the 0.4-kb upstream sequence directs weak u-PAR expression in this tissue.Table 1Summary of LacZ Expression DataTransgene ExpressionPlacentaColonSkin (wounding)EpididymisConstructExpressionIntensityExpressionIntensityExpressionIntensityExpressionIntensity0.4 u-PAR4/4+0/5—0/4—2/3+++1.5 u-PAR3/3+5/6++0/4—7/7+++8.5 u-PAR5/6++4/5+0/4—3/3+++ Open table in a new tab Although it has not been reported previously, we made the serendipitous observation that the epididymis strongly expresses endogenous u-PAR protein as evident by immunohistochemistry (Figure 2C, arrows). We therefore determined if 0.4 kb of upstream sequence was sufficient for regulating LacZ expression in this tissue (Figure 2D). Although no X-gal staining was observed in breeder mice (Figure 2D, left), widespread strong LacZ expression was evident (Figure 2D, right, arrows) in the pseudostratified columnar epithelial cells of the epididymis derived from mice positive for the construct. Moreover, LacZ expression was coincident with the strong immunoreactivity evident in this tissue. On the other hand, spermatozoa apparent in the luminal space were negative for expression of the endogenous u-PAR and the transgene. Thus for two organs that constitutively express the endogenous mouse u-PAR gene, 0.4 kb of 5′ flanking sequence weakly activates the LacZ reporter in the placenta whereas this reporter is strongly activated in the epididymis. Kristensen and co-workers34Kristensen P Eriksen J Blasi F Dano K Two alternatively spliced mouse urokinase receptor mRNAs with different histological localization in the gastrointestinal tract.J Cell Biol. 1992; 115: 1763-1771Crossref Scopus (99) Google Scholar previously reported that the luminal surface epithelial cells of the gastrointestinal tract were positive for endogenous u-PAR expression, possibly related to their ability to shed from the crypt in the normal progression from the basal to the apical region. Thus, we examined LacZ expression in the colon derived from multiple founders. However, in no case was LacZ expression evident in this tissue (Table 1). Thus, it is likely that regulatory region(s) outside of the 0.4-kb upstream fragment are required for expression in the crypt cells at the luminal surface. We therefore investigated the expression of a LacZ reporter regulated by a longer fragment (1.5 kb) of the u-PAR upstream sequence. F1 offspring positive for the transgene were sacrificed and the large intestine was harvested and analyzed either for endogenous u-PAR protein or for LacZ expression. Expectedly, the luminal surface epithelial cells were strongly positive for u-PAR protein (Figure 3A) and abolition of this immunoreactivity by omission of the anti-u-PAR antibody confirmed the specificity. Parallel studies using X-gal to stain for LacZ expression confirmed strong expression of the transgene in the luminal epithelial cells of the colon (Figure 3B, right, arrows) coincidental with the expression of the endogenous u-PAR gene. In contrast, colon from non-transgenic breeder mice proved negative for LacZ expression (Figure 3B, left panel). LacZ expression in the transgenic mice was evident in mice derived from multiple founders (Table 1). Thus, these findings suggest that a region residing between −0.4 and −1.5 kb is required for expression of the endogenous u-PAR gene in the luminal epithelial cells of the colon. Similar to the shorter construct, the −1.5-kb regulatory sequence also directed LacZ expression in the epididymis and in the placenta (data not shown). However, we saw no greater LacZ staining (either in intensity or the amount of tissue) in the placenta (Table 1), suggesting that this longer fragment provided no additional regulatory elements for controlling u-PAR expression in this tissue. During re-epithelialization, u-PAR mRNA expression is strongly expressed by the keratinocytes at the leading edge of the mouse skin wound.4Romer J Lund LR Eriksen J Pyke C Kristensen P Dano K The receptor for urokinase-type plasminogen activator is expressed by keratinocytes at the leading edge during re-epithelialization of the mouse skin wounds.J Invest Dermatol. 1994; 102: 519-522Abstract Full Text PDF PubMed Google Scholar Thus, we also determined whether 1.5 kb of u-PAR 5′ flanking sequence was sufficient for transgene expression in repair of this tissue. Mice positive for the transgene were wounded superficially and, after varying times, sacrificed and analyzed either for endogenous u-PAR expression by Western blotting (Figure 4A) or for LacZ expression (Figure 4B). As expected, endogenous u-PAR expression was strongly induced within 2
Referência(s)