Portal de Periódicos da CAPES

Localization and Function of the Yeast Multidrug Transporter Tpo1p

2003; Elsevier BV; Volume: 278; Issue: 15 Linguagem: Inglês

10.1074/jbc.m210715200

1083-351X

Markus Albertsen, Inga Bellahn, Reinhard Krämer, Sabine Waffenschmidt,

Amino Acid Enzymes and Metabolism

In Saccharomyces cerevisiae four transporters, Tpo1p–Tpo4p, all members of the major facilitator superfamily, have been shown to confer resistance to polyamines. It was suggested that they act by pumping their respective substrate into the lumen of the vacuole depending on the proton gradient generated by the V-ATPase. Using sucrose gradient ultracentrifugation we found that an hemagglutinin (HA)-tagged Tpo1p as well as its HA-tagged Tpo2p–4p homologues co-localize with plasma membrane markers. Because the HA-tagged Tpo1p carrier protein proved to be functional in conferring resistance to polyamines in TPO1 knockouts, a function of Tpo1p in transport of polyamines across the plasma membrane seemed to be likely. The polyamine transport activity of wild type cells was compared with the respective activity of a TPO1 knockout strain. The results obtained strongly suggest that Tpo1p is a plasma membrane-bound exporter, involved in the detoxification of excess spermidine in yeast. When studying polyamine transport of wild type cells, we furthermore found that S. cerevisiae is excreting putrescine during the fermentative growth phase. In Saccharomyces cerevisiae four transporters, Tpo1p–Tpo4p, all members of the major facilitator superfamily, have been shown to confer resistance to polyamines. It was suggested that they act by pumping their respective substrate into the lumen of the vacuole depending on the proton gradient generated by the V-ATPase. Using sucrose gradient ultracentrifugation we found that an hemagglutinin (HA)-tagged Tpo1p as well as its HA-tagged Tpo2p–4p homologues co-localize with plasma membrane markers. Because the HA-tagged Tpo1p carrier protein proved to be functional in conferring resistance to polyamines in TPO1 knockouts, a function of Tpo1p in transport of polyamines across the plasma membrane seemed to be likely. The polyamine transport activity of wild type cells was compared with the respective activity of a TPO1 knockout strain. The results obtained strongly suggest that Tpo1p is a plasma membrane-bound exporter, involved in the detoxification of excess spermidine in yeast. When studying polyamine transport of wild type cells, we furthermore found that S. cerevisiae is excreting putrescine during the fermentative growth phase. hemagglutinin 4-morpholineethanesulfonic acid high pressure liquid chromatography Polyamines are essential compounds occurring in virtually all prokaryotic and eukaryotic cells (1Tabor C.W. Tabor H. Annu. Rev. Biochem. 1984; 53: 749-790Crossref PubMed Scopus (3236) Google Scholar). Because these compounds are toxic in higher concentrations, their intracellular content is tightly regulated by controlling biosynthesis and degradation and also by transport into intracellular storage compartments or out of the cell. In the yeast Saccharomyces cerevisiae the polyamines putrescine, spermidine, and spermine are found. All three compounds are actively transported into the vacuole by a substrate/nH+antiport mechanism (2Kakinuma Y. Masuda N. Igarashi K. Biochim. Biophys. Acta. 1992; 1107: 126-130Crossref PubMed Scopus (21) Google Scholar). Four transport proteins, Tpo1p–Tpo4p, have been postulated to be responsible for the polyamine transport capability of the yeast vacuolar membrane (3Tomitori H. Kashiwagi K. Sakata K. Kakinuma Y. Igarashi K. J. Biol. Chem. 1999; 274: 3265-3267Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar, 4Tomitori H. Kashiwagi K. Asakawa T. Kakinuma Y. Michael A.J. Igarashi K. Biochem. J. 2001; 353: 681-688Crossref PubMed Scopus (102) Google Scholar). According to their protein sequences, these four proteins are all members of a family of multidrug resistance transporters within the major facilitator superfamily. Tpo1p was identified by its sequence similarity to theBacillus subtilis multidrug transporter Blt, which is involved in spermidine excretion (5Woolridge D.P. Vazquez-Laslop N. Markham P.N. Chevalier M.S. Gerner E.W. Neyfakh A.A. J. Biol. Chem. 1997; 272: 8864-8866Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar). The other transporters of this group were found on the basis of sequence similarity to Tpo1p (4Tomitori H. Kashiwagi K. Asakawa T. Kakinuma Y. Michael A.J. Igarashi K. Biochem. J. 2001; 353: 681-688Crossref PubMed Scopus (102) Google Scholar). The function of all Tpo proteins was deduced from the phenotype of mutant strains. Their overexpression led to an increased tolerance for polyamines added to the growth medium, whereas a respective deletion rendered the cells more sensitive to polyamines. Evidence for their participation in vacuolar polyamine uptake, however, was largely indirect. In the course of a project to identify new vacuolar transporters belonging to the class of secondary carriers, we were looking for a well characterized carrier of this type in the yeast vacuolar membrane to use as a control for localization assays. We chose Tpo1p because of its sequence similarity to the transport proteins we were interested in, in particular to Ycr023p. In an analysis of their subcellular distribution, however, we found that all Tpo transporters are actually localized in the cytoplasmic membrane. This observation encouraged us to perform a detailed study on Tpo1p function. The results obtained suggest that at least Tpo1p participates in polyamine export out of the cell. The haploid S. cerevisiaestrain 23344c (MATα ura3) was used as genetic background for all of the experiments. This strain is isogenic with Σ1278b (6Béchet J. Greenson M. Wiame J.M. Eur. J. Biochem. 1970; 12: 31-39Crossref PubMed Scopus (192) Google Scholar) and was kindly provided by Bruno André (Brussels, Belgium). The cells were grown aerobically at 30 °C. Preparation of yeast-rich (YPD) and synthetic complete minimal media followed standard recipes (7Dohmen R.J. Stappen R. McGrath J.P. Forrova H. Kolarov J. Goffeau A. Varshavsky A. J. Biol. Chem. 1995; 270: 18099-18109Abstract Full Text Full Text PDF PubMed Scopus (165) Google Scholar). Growth assays on solid media were performed using a modified citrate-buffered yeast minimal medium (8Jacobs P. Jauniaux J.C. Grenson M. J. Mol. Biol. 1980; 139: 691-704Crossref PubMed Scopus (112) Google Scholar) in which the Mg2+ content was limited to 50 μm to enhance polyamine sensitivity (9Maruyama T. Masuda N. Kakinuma Y. Igarashi K. Biochim. Biophys. Acta. 1994; 1194: 289-295Crossref PubMed Scopus (30) Google Scholar). For polyamine export experiments and for the preparation of vacuolar vesicles, a modified CBS medium described by Verduyn et al. (10Verduyn C. Postma E. Scheffers W.A. Van Dijken J.P. Yeast. 1992; 8: 501-517Crossref PubMed Scopus (1106) Google Scholar) was used, containing 20 g/liter glucose and 5 g/liter NH4SO4. Uracil auxotrophic strains were grown in the presence of 20 mg/liter uracil. The CBS medium was buffered with either 1% succinic acid adjusted to pH 5.8 with NaOH or 50 mm potassium phthalate at pH 5.5 Replacement of the TPO1 gene by lacZ was done via PCR-based gene targeting using the gene disruption cassette encoded by plasmid pUG6lacZ (11Boles E. de Jong-Gubbels P. Pronk J.T. J. Bacteriol. 1998; 180: 2875-2882Crossref PubMed Google Scholar). The plasmid contains the lacZ gene from Escherichia coli, followed by the dominant kanMX marker, and is a derivative of pUG6 described by Güldener et al. (12Güldener U. Heck S. Fielder T. Beinhauer J. Hegemann J.H. Nucleic Acids Res. 1996; 24: 2519-2524Crossref PubMed Scopus (1372) Google Scholar). The sequences of the primers used for the amplification of the disruption cassette were 5′-TTTTTTTTAGTCAAAGAAGCAAGAGAAAACTAGACAGAGACAATGTTCGTACGCTGCAGGTCGAC and 5′-AAAAATGCAAATATAGAAAGAGCATGATTTCTGCTTTTCTTTTTCGCATAGGCCACTAGTGGATCTG. Genomic HA1 tagging of the four TPO genes and of the open reading frame YCR023c was performed by using the plasmid pUG6-HA (13Buziol S. Becker J. Baumeister A. Jung S. Mauch K. Reuss M. Boles E. FEMS Yeast Res. 2002; 2: 283-291PubMed Google Scholar), which encodes three tandem repeats of a HA epitope followed by kanMX. Via PCR a DNA molecule was generated, consisting of a 3xHA-kanMX marker cassette flanked by short regions homologous to the end of the respective gene. The PCR primers used for this purpose consisted of 45 nucleotides corresponding to the genomic sequence ultimately upstream and downstream, respectively, of the stop codon of the gene to be tagged, followed by 20 nucleotides homologous to the pUG6-HA plasmid to amplify the epitope and the kanMX marker. After transformation of the 1.7-kb PCR product into strain 23344c and selection for resistance to G418 (200 mg/l) on YPD agar plates, the stop codon of the respective gene was usually replaced by3xHA-kanMX through homologous recombination. All of the gene modifications were verified by diagnostic PCR. A list of the strains used and generated in this study is given in TableI.Table IS. cerevisiae strains used in this studyStrainGenotypeSource23344cMATαura3Bruno André (Brussels, Belgium)WF 7MATα YCR023c-3xHA kanMX ura3Wolf Frommer (Tübingen, Germany)RK 25MATα TPO1–3xHA kanMX ura3This workRK 6MATαTPO2–3xHA kanMX ura3This workRK 13MATαTPO3–3xHA kanMX ura3This workRK 11MATαTPO4–3xHA kanMX ura3This workRK 26MATαtpo1::lacZ kanMX ura3This work Open table in a new tab The yeast expression vector pDR199 was obtained from Wolf Frommer (Tübingen, Germany). It is a derivative of pDR195 (14Rentsch D. Laloi M. Rouhara I. Schmelzer E. Delrot S. Frommer W.B. FEBS Lett. 1995; 370: 264-268Crossref PubMed Scopus (279) Google Scholar), which in turn was generated from YEplac195 (15Gietz R.D. Sugino A. Gene (Amst.). 1988; 74: 527-534Crossref PubMed Scopus (2528) Google Scholar). The plasmid contains a copy of the PMA1 promoter and the terminator region of the ADH1 gene. The TPO1gene was amplified via PCR using genomic DNA of strain 23344c as template and cloned between promoter and terminator using anXmaI and an XhoI site. The PCR primers forTPO1 were 5′-GCGTCCCCGGGATGTCGGATCATTCTCCCATT and 5′-GCGTCCTCGAGTTAAGCGGCGTAAGCATACTT. The underlined sequences indicate the XmaI and XhoI sites, respectively. The TPO1–3xHA fusion gene was amplified via PCR with genomic DNA from strain RK 25 as template using the same 5′ primer as for the amplification of the unmodified TPO1. The sequence of the 3′ primer was GCGTCCTCGAGTTAGGCGGCGTAGTCAGGAAC, with the XhoI site underlined. The PCR fragment was inserted into pDR199 by using theXmaI and the XhoI site between PMA1promoter and ADH1 terminator. Accuracy of the constructs was verified by sequencing. The plasmids were transformed into yeast according to Gietz et al. (16Gietz R.D. Schiestl R.H. Willems A.R. Woods R.A. Yeast. 1995; 11: 355-360Crossref PubMed Scopus (1712) Google Scholar). Subcellular localization of triple HA-tagged proteins was determined following the protocol of Sorin et al. (17Sorin A. Rosas G. Rajini R. J. Biol. Chem. 1997; 272: 9895-9901Abstract Full Text Full Text PDF PubMed Scopus (219) Google Scholar). The cells were grown in 600 ml of YPD medium to A600 of 2–3. NaN3 (10 mm) was added prior to harvesting, and the culture was chilled on ice. The cells were converted to spheroplasts by adding lysing enzymes (Sigma) in a concentration of 1 mg/ml in S/K buffer (1.2 m sorbitol, 100 mmpotassium phosphate, pH 7.5) and incubating for 45 min at 30 °C. The spheroplasts were suspended in 4 ml of lysis buffer (0.3 msorbitol, 20 mm triethanolamine acetate, pH 7.2, 1 mm EDTA, supplemented with a commercially available protease inhibitor mixture (Complete, EDTA-free; Roche Molecular Biochemicals) and homogenized by 30 strokes of a Wheaton A Dounce homogenizer. Unlysed cells were removed by centrifugation (800 ×g for 3 min at 4 °C), and the supernatant was layered on top of a noncontinuous gradient ranging from 18 to 54% (w/v) sucrose in 10 mm Hepes, pH 7.1, 1 mm EDTA (10 steps of 4% difference each). The gradients were centrifuged for 2 h at 40,000 rpm (4 °C) in a Beckmann SW41 Ti rotor and fractionated manually from top to bottom (12 fractions of 1 ml each). Isolated fractions were diluted (1:5) in 100 mm Tris-Cl, pH 7.5, 150 mm NaCl, 5 mm EDTA, and the membranes were pelleted by ultracentrifugation (100,000 × g for 2 h at 4 °C). The resulting pellets were incubated on ice (30 min) in 400 μl of Tris buffer (see above) containing 5 murea. They were again centrifuged (17,000 × g for 45 min at 4 °C) and finally resuspended in 100 μl of SDS sample buffer. The proteins were separated by SDS-PAGE (12%) and electroblotted onto nitrocellulose membranes using a semidry transfer system. For immunodetection a monoclonal anti-HA (Roche Molecular Biochemicals), a monoclonal anti-Vph1p (kindly provided by Patricia M. Kane, Syracuse, NY), and a polyclonal anti-Pma1p (kindly provided by Bruno André, Brussels, Belgium) were used as first antibody. The respective secondary antibody coupled to horseradish peroxidase and the enhanced chemiluminescence detection system (Invitrogen) was used for visualization. The cells were grown overnight in synthetic complete minimal medium, harvested atA600 = 1.0, washed twice in the same volume of 20 mm Na/Hepes buffer, pH 7.2, containing 10 mmglucose and resuspended at A600 = 1.0 in the same buffer. Transport assays were done at 30 °C and started by adding [14C]spermine to a final concentration of 20 or 100 μm. 100-μl aliquots were filtered at defined time points through nitrocellulose filters that were preincubated in 100 mm LiCl containing 1 mm spermine. The radioactivity trapped on the filters was determined in a liquid scintillation counter. The preparation of vacuolar vesicles was done following a slightly modified protocol of Ohsumi and Anraku (18Ohsumi Y Anraku Y. J. Biol. Chem. 1981; 256: 2079-2082Abstract Full Text PDF PubMed Google Scholar). The cells were grown in CBS medium buffered with 50 mmpotassium phthalate, pH 5.5, and supplemented with 10 mmputrescine and 1 mm of each spermidine and spermine to anA600 of 2–3. The cells were harvested and resuspended in 100 mm Tris-sulfate, pH 9.4, 10 mm dithiothreitol to yield a concentration of 0.5 g of cell fresh weight/ml. The cells were shaken for 10 min at 30 °C, centrifuged, and resuspended to 0.15 g of cell fresh weight/ml in SOB (1.2 m sorbitol, 5 mm MES-Tris, pH 6.9). The spheroplasts were generated by incubation with lysing enzymes (Sigma) (1 mg/5 × 108 cells) for 30 min at 30 °C. The spheroplasts were washed twice in SOB and resuspended in buffer A (12% Ficoll, 10 mm MES-Tris, pH 6.9, 100 μmMgCl2), protease inhibitors (Complete; Roche Molecular Biochemicals) were added, and the suspension was homogenized by seven strokes of a Wheaton A Dounce homogenizer. The resulting suspension was transferred to a centrifuge tube, overlaid with half the volume of buffer A, and centrifuged at 60,000 × g for 1 h and 15 min. The white floating layer that appeared after centrifugation was transferred to an ultracentrifuge tube, adjusted with buffer A (see above) to 6 ml, and overlaid with 6 ml of buffer B (8% Ficoll, 10 mm MES-Tris, pH 6.9, 100 μmMgCl2). After further centrifugation (60,000 ×g for 1 h and 15 min), vacuolar vesicles formed a white layer on top of the solution. They were aspirated, suspended in 100 mm MES-Tris, pH 6.9, 100 mm KCl, 20 μm MgCl2, frozen under liquid nitrogen, and stored for further use at −80 °C. The enzyme assays were done according to Roberts et al. (19Roberts C.J. Raymond C.K. Yamashiro C.T. Stevens T.H. Methods Enzymol. 1991; 194: 644-661Crossref PubMed Scopus (287) Google Scholar). Phenylalanine transport measurements were performed according to Sato et al. (20Sato T. Ohsumi Y. Anraku Y. J. Biol. Chem. 1984; 259: 11505-11508Abstract Full Text PDF PubMed Google Scholar), and spermine import was determined after Kakinuma et al.(2Kakinuma Y. Masuda N. Igarashi K. Biochim. Biophys. Acta. 1992; 1107: 126-130Crossref PubMed Scopus (21) Google Scholar). The cells were grown overnight in succinate-buffered CBS medium in the presence of 10 mm spermidine and harvested atA600 = 1.3–1.5 by centrifugation. The cell pellets were washed three times in medium without polyamines but containing only 1 g/liter NH4SO4 and finally resuspended in the same medium. The cell suspension was incubated at 30 °C with agitation, and aliquots were taken at defined time points. To analyze spermidine efflux, the cells were immediately separated from the medium by centrifugation (11,000 × g for 3 min), and released spermidine was quantified using high performance liquid chromatography according to Price et al. (21Price N.P.J. Firmin J.L. Gray D.O. J. Chromatogr. 1992; 598: 51-57Crossref Scopus (36) Google Scholar). Extraction of total polyamines was performed according to Tomitori et al.(4Tomitori H. Kashiwagi K. Asakawa T. Kakinuma Y. Michael A.J. Igarashi K. Biochem. J. 2001; 353: 681-688Crossref PubMed Scopus (102) Google Scholar). Yeast cells were incubated in 10% trichloroacetic acid at 65 °C for 1 h. Derivatization and quantification by high performance liquid chromatography were done as described above. In the course of an approach to identify new vacuolar transporters, we determined the subcellular localization of various putative transport proteins that have been fused C-terminally to a triple HA epitope tag. A version of Tpo1p with the same tag was generated as bona fide control, because we considered it to be an established vacuolar transporter (3Tomitori H. Kashiwagi K. Sakata K. Kakinuma Y. Igarashi K. J. Biol. Chem. 1999; 274: 3265-3267Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar,4Tomitori H. Kashiwagi K. Asakawa T. Kakinuma Y. Michael A.J. Igarashi K. Biochem. J. 2001; 353: 681-688Crossref PubMed Scopus (102) Google Scholar). The intracellular localization was determined by sucrose density gradient centrifugation of membrane preparations isolated from yeast cells carrying the respective fusion construct as the only gene copy. Defined fractions were separated by SDS-PAGE and subsequently analyzed by immunoblotting (Fig. 1). Although the 3xHA-tagged version of Ycr023p co-localized with the 100-kDa subunit of the vacuolar ATPase (Vph1p), the Tpo1p-3xHA fusion co-localized with the plasma membrane ATPase (Pma1p), thus raising the question of whether tagging of Tpo1p leads to mislocalization, although the HA tag is not known to direct proteins to the plasma membrane. To get further evidence we tested the functionality of the HA fusion of Tpo1p. Disruption of TPO1 leads to increased polyamine sensitivity of the mutant cells, when grown under Mg2+-limiting conditions (3Tomitori H. Kashiwagi K. Sakata K. Kakinuma Y. Igarashi K. J. Biol. Chem. 1999; 274: 3265-3267Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar). This phenotype should be rescued by expression of the HA-modified version of the transporter if this fusion is functional. We thus transformed a plasmid encoded version of TPO1–3xHA into a strain in which TPO1had been replaced by a lacZ-kanMX deletion cassette. The fused gene on the plasmid was expressed under the control of thePMA1 promoter. The resulting yeast cells were tested for spermidine sensitivity in comparison with the wild type and thetpo1::lacZ strain, each transformed with the empty vector (Fig. 2). We found that synthesis of the HA-tagged Tpo1p leads to markedly increased spermidine tolerance. Because the functionality of the HA fusion of Tpo1p could be demonstrated, we tried to get further evidence for the Tpo1 protein being located in the plasma membrane, where it should contribute to polyamine transport. Because the localization of Tpo1p in the plasma membrane was contradictory to the proposed function in vacuolar polyamine transport, we tested first whether polyamine import into cells is influenced by TPO1 deletion. An earlier report had indicated that a TPO1 deletion strain shows spermine import rates similar to wild type cells (3Tomitori H. Kashiwagi K. Sakata K. Kakinuma Y. Igarashi K. J. Biol. Chem. 1999; 274: 3265-3267Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar), whereas a decreased import rate inTPO1 deletions was reported later (4Tomitori H. Kashiwagi K. Asakawa T. Kakinuma Y. Michael A.J. Igarashi K. Biochem. J. 2001; 353: 681-688Crossref PubMed Scopus (102) Google Scholar). We found, however, no difference in spermine uptake activity between thetpo1::lacZ strain and wild type using 100 μm (Fig. 3) or 20 μm spermine (not shown), suggesting that Tpo1p is not involved in polyamine import of yeast cells and/or that Tpo2p-Tpo4 may complement the knockout of Tpo1p. In view of several reports describing Tpo1p as vacuolar polyamine importer, we tried to account for an impairment in vacuolar polyamine uptake after TPO1deletion. Consequently, we prepared vacuolar vesicles from wild type cells and tpo1::lacZ mutants, respectively, grown in the presence of 10 mm putrescine, 1 mm spermidine, and 1 mm spermine. Polyamines were added to the growth medium because a stimulatory impact of externally added polyamines on TPO1 expression had been reported recently (4Tomitori H. Kashiwagi K. Asakawa T. Kakinuma Y. Michael A.J. Igarashi K. Biochem. J. 2001; 353: 681-688Crossref PubMed Scopus (102) Google Scholar). The polyamine concentrations employed led to a markedly increased intracellular polyamine level (about 4-fold in the case of putrescine and spermine, and about 2-fold for spermidine), which should be high enough to enhance the expression ofTPO1. We optimized the protocol for the isolation of vacuolar vesicles, which led to preparations of high purity (TableII). The ATPase activity of the vesicle preparation was completely inhibited by the addition of the V-ATPase-specific inhibitor concanamycin A (not shown), proving that significant contaminations of plasma membrane and mitochondria were virtually absent. The vesicles were used to determine the uptake of amino acids (20Sato T. Ohsumi Y. Anraku Y. J. Biol. Chem. 1984; 259: 11505-11508Abstract Full Text PDF PubMed Google Scholar) and spermine (2Kakinuma Y. Masuda N. Igarashi K. Biochim. Biophys. Acta. 1992; 1107: 126-130Crossref PubMed Scopus (21) Google Scholar). Because phenylalanine uptake measurements in particular were highly reproducible in isolated vacuolar vesicles, we used this carrier activity to normalize the spermine uptake rate and thus to eliminate possible variations caused by the vesicle preparation, a strategy that was not employed in the original report of Tomitori et al. (4Tomitori H. Kashiwagi K. Asakawa T. Kakinuma Y. Michael A.J. Igarashi K. Biochem. J. 2001; 353: 681-688Crossref PubMed Scopus (102) Google Scholar), who reported a slightly decreased import activity for vacuolar vesicles prepared from a TPO1 deletion strain compared with wild type. But this correction might be crucial, because we found that although the absolute values varied slightly for each preparation, the relative uptake rates measured were essentially the same for the two strains (Fig. 4). Furthermore, the maximal amount of accumulated spermine was very similar for the two vesicular preparations when normalized to the maximum of accumulated phenylalanine. We thus conclude that the TPO1 deletion had no effect on spermine import into vacuolar vesicles.Table IIPurity of vacuolar vesiclesMarker enzymeEnrichmentYield%Vacuolar markers Dipeptidyl aminopeptidase B47-fold10 α-Mannosidase45-fold10Marker enzymes of contaminating fractions Dipeptidyl aminopeptidase A (Golgi)11-fold2.3 Cytochromec oxidase (mitochondria)3-fold0.7 Open table in a new tab The absence of theTPO1 gene causes increased polyamine sensitivity, indicating a function for Tpo1p in the detoxification of polyamines (Fig. 2 and Ref. 3Tomitori H. Kashiwagi K. Sakata K. Kakinuma Y. Igarashi K. J. Biol. Chem. 1999; 274: 3265-3267Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar). Detoxification in general can be mediated either by transport into the vacuole or out of the cell across the plasma membrane. The results presented so far favor the latter possibility. Thus, we analyzed the putative polyamine efflux mediated by Tpo1p. Because little is known about polyamine export in budding yeast, we investigated first whether polyamines might be released into the medium during growth, as has been reported for other microorganisms (22Schiller D. Kruse D. Kneifel H. Kramer R. Burkovski A. J. Bacteriol. 2000; 182: 6247-6249Crossref PubMed Scopus (42) Google Scholar, 23Davis R.H. Ristow J.L. Arch. Biochem. Biophys. 1989; 271: 315-322Crossref PubMed Scopus (30) Google Scholar). Wild type and tpo1::lacZ cells were grown from A600 = 0.5 to stationary phase in succinate-buffered CBS medium. Putrescine and spermidine excreted into the medium were quantified. Spermine could not be determined as a contaminant in the synthetic growth medium and interfered with the quantitative HPLC analysis. We found that wild type and mutant cells in fact excrete putrescine but not spermidine until they reach the diauxic shift (Fig. 5) after ∼24 h. The putrescine release of the two strains was indistinguishable, suggesting that Tpo1p is not involved in this process. Although spermidine is the most abundant polyamine in yeast cells (Ref. 9Maruyama T. Masuda N. Kakinuma Y. Igarashi K. Biochim. Biophys. Acta. 1994; 1194: 289-295Crossref PubMed Scopus (30) Google Scholar; see also Fig.6B), we did not observe release of this solute under normal growth conditions. To challenge yeast cells for spermidine export, we increased the intracellular spermidine content by growing cells in the presence of this compound. The cells were cultured in the presence of 10 mm spermidine in succinate-buffered CBS medium under nonlimiting Mg2+-conditions, where both wild type and mutants are more tolerant to polyamine stress, and the spermidine concentrations applied are thus not toxic for both strains. During the incubation the total intracellular spermidine content of yeast cells in the logarithmic growth phase increased significantly from about 8 to 25 nmol/mg cell dry mass (Fig. 6B). After washing and resuspending in polyamine-free medium, the accumulated spermidine was released. We found a significant difference between wild type and tpo1deletion mutant under these conditions. Spermidine efflux of thetpo1::lacZ cells was significantly decreased as compared with the wild type (Fig. 6A). The observed difference in efflux rates was not due to a different preloading of cells with spermidine, as can be seen in Fig. 6B. To provide a solid basis for the observed difference in polyamine excretion, the initial efflux rates of 15 independent cultures of wild type and mutant cells, respectively, were determined. It could be shown that the spermidine efflux rate of the TPO1 deletion strain drops to 49 ± 28% of wild type rates (Fig. 6C). These experiments indicate a function of Tpo1p in spermidine detoxification. Preloading yeast cells with putrescine unfortunately led to widely varying results; however, in a series of experiments we did not observe a statistically significant difference between the wild type and theTPO1 deletion strain in terms of putrescine efflux activity (not shown). If the observed impairment of spermidine efflux was indeed a consequence of the TPO1 deletion, the introduction of plasmid-borne Tpo1p should lead to an increase of the spermidine export rate. Therefore, we constructed a plasmid expressing TPO1 under control of thePMA1 promoter and transformed this construct into thetpo1::lacZ strain. Expression of the plasmid encoded gene was controlled by analyzing polyamine sensitivity of the resulting yeast, which was in fact highly decreased (not shown). The initial spermidine export rates of this strain were determined and gave values in the same range as observed for the wild type (Fig.6C). When the tpo1::lacZstrain was transformed with the empty vector, the export rates were in the same range as observed for the TPO1 deletion without any plasmid (not shown). The initially accumulated spermidine concentration was unchanged in both experiments. Because TPO1 was found to complement the described phenotype, we consider Tpo1p to be a plasma membrane-bound exporter involved in spermidine export. The fact that Tpo1p was localized in the plasma membrane raises the question on the location of the other described polyamine transporters in S. cerevisiae, i.e. whether Tpo2p, Tpo3p, and Tpo4p are located in the plasma membrane as well (4Tomitori H. Kashiwagi K. Asakawa T. Kakinuma Y. Michael A.J. Igarashi K. Biochem. J. 2001; 353: 681-688Crossref PubMed Scopus (102) Google Scholar). We therefore generated three strains bearing 3xHA-tagged versions of TPO2, TPO3, and TPO4, respectively, as the only gene copy. Using sucrose density gradient centrifugation, we fractionated membrane preparations of these strains and found that all of the TPO gene products localize in the same fraction, which was identified as plasma membrane fraction before (Fig. 7; compare Fig. 1). An involvement of the three yeast polyamine transporters in transport of these solutes across the plasma membrane seems to be likely and will be analyzed in the future. The expression and subsequent detection of epitope-tagged proteins has turned out to be a powerful method in unraveling the subcellular localization of proteins. By applying this approach we found that a triple HA-tagged version of Ycr023p co-localized with the vacuolar ATPase, using sucrose gradient centrifugation as the analytical method. Ycr023p is a member of the multidrug resistance family and most probably functions in the detoxification of hazardous compounds into the vacuolar lumen. It has been shown that its deletion confers resistance to allylglycine (25Bianchi M.M. Sartori G. Vandenbol M. Kaniak A. Ucceletti D. Mazzoni C. Di Rago J.-P. Carignani G. Slonimski P.R. Frontali L. Yeast. 1999; 15: 513-526Crossref PubMed Scopus (21) Google Scholar). Unexpectedly, triple HA-tagged versions of all four polyamine transporters, Tpo1p-4p, that have been described in S. cerevisiae so far co-localized with the plasma membrane ATPase. Despite the fact that tags in general might cause mislocalization of proteins, we decided to carefully re-evaluate whether these transporters were in fact plasma membrane bound and thus not involved in vacuolar transport of polyamines as had been described before (4Tomitori H. Kashiwagi K. Asakawa T. Kakinuma Y. Michael A.J. Igarashi K. Biochem. J. 2001; 353: 681-688Crossref PubMed Scopus (102) Google Scholar). Direct localization studies of these proteins had not been performed so far; their intracellular localization had been deduced indirectly from physiological experiments with Tpo1p being the best studied protein of this group (3Tomitori H. Kashiwagi K. Sakata K. Kakinuma Y. Igarashi K. J. Biol. Chem. 1999; 274: 3265-3267Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar, 4Tomitori H. Kashiwagi K. Asakawa T. Kakinuma Y. Michael A.J. Igarashi K. Biochem. J. 2001; 353: 681-688Crossref PubMed Scopus (102) Google Scholar, 24do Valle Matta M.A. Jonniaux J.L. Balzi E. Goffeau A. van den Hazel B. Gene (Amst.). 2001; 272: 111-119Crossref PubMed Scopus (44) Google Scholar). We provide experimental evidence for a role of Tpo1p in transport across the plasma membrane, which is based on the observations that the HA-tagged protein is functional and that aTPO1 knockout is not impaired in uptake of polyamines into vacuolar vesicles. The observation of Tomitori et al. (3Tomitori H. Kashiwagi K. Sakata K. Kakinuma Y. Igarashi K. J. Biol. Chem. 1999; 274: 3265-3267Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar) that vesicles prepared from TPO1-overexpressing strains show an increased spermine import activity is most probably due to mislocalization of the overproduced protein. In this study we could show that a strain deleted in TPO1 shows a significant defect in spermidine secretion under conditions in which the cells are challenged by incubation in medium containing high levels of polyamines. We thus conclude that Tpo1p is a plasma membrane-embedded carrier protein. The arguments that Tpo2p, Tpo3p, and Tpo4p have the same subcellular location are so far exclusively based on results of sucrose gradient fractionation and need further experimental proof. Export of polyamines, especially of putrescine as the key metabolite in polyamine biosynthesis, had been described for some prokaryotic (22Schiller D. Kruse D. Kneifel H. Kramer R. Burkovski A. J. Bacteriol. 2000; 182: 6247-6249Crossref PubMed Scopus (42) Google Scholar) and eukaryotic organisms (23Davis R.H. Ristow J.L. Arch. Biochem. Biophys. 1989; 271: 315-322Crossref PubMed Scopus (30) Google Scholar), as well as for cultured mammalian cells (26Tjandrawinata R.R. Hawel III, L. Byus C.V. J. Immunol. 1994; 152: 3039-3052PubMed Google Scholar). The biological significance of this process is most probably related to the fact that although polyamines are pivotal for many physiological processes, they are toxic when present in high levels, so that cells had to develop mechanisms for controlling the intracellular pools (27Igarashi K. Kashiwagi K. Biochem. Biophys. Res. Commun. 2000; 271: 559-564Crossref PubMed Scopus (737) Google Scholar). Although the regulation of biosynthesis is certainly a possibility to control nontoxic levels (28Coffino P. Biochimie (Paris). 2001; 83: 319-323Crossref PubMed Scopus (69) Google Scholar), excretion provides an additional rationale. Taking into account that re-uptake is guaranteed by the presence of importer systems, a possible loss of precursors can be avoided. Putrescine export had not been studied in detail inS. cerevisiae before. When trying to establish a function of Tpo1p in polyamine export, we therefore asked whether yeast had developed mechanisms for putrescine homoeostasis similar to other microorganisms and whether Tpo1p might be involved in that process. Although we were able to detect significant putrescine export which, interestingly, was restricted to the fermentative growth phase, Tpo1p is obviously not involved in this process to a significant extent, because wild type and the TPO1 disruption strain had equal export activity. We cannot rule out, however, that redundant transporters may adjust their putrescine export activities in the deletion strain to compensate for the missing TPO1function. When cells are stressed under conditions of growth in the presence of high levels of polyamines, a detoxification mechanism has to exist to overcome toxic intracellular levels that may arise because of the presence of polyamine importers. This could in principle be achieved by regulating the uptake activity and/or the activity of exporters for these solutes. We therefore preloaded yeast cells with polyamines and followed the efflux after transfer of cells into polyamine-free medium. Tpo1p was shown not to contribute significantly to putrescine tolerance (3Tomitori H. Kashiwagi K. Sakata K. Kakinuma Y. Igarashi K. J. Biol. Chem. 1999; 274: 3265-3267Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar); thus we concentrated on the analysis of spermidine export, which was in fact affected by TPO1 deletion. The decrease in excretion activity was significant and could be reverted by introducing a plasmid-encoded copy of TPO1, proving that the phenotype observed was a direct consequence of the missing TPO1 gene. The rescued strain showed spermidine export rates comparable with the wild type (Fig. 6C), which was also the reason for the polyamine tolerance that we found when testing the functionality of theTPO1–3xHA construct (Fig. 2). In the latter experiment we even observed an increased tolerance of thetpo1::lacZ strain containingTPO1–3xHA on a plasmid, compared with wild type, which was most probably due to the experimental conditions applied. Spermidine tolerance was assayed under magnesium limitation, a condition that leads to enhanced polyamine uptake (9Maruyama T. Masuda N. Kakinuma Y. Igarashi K. Biochim. Biophys. Acta. 1994; 1194: 289-295Crossref PubMed Scopus (30) Google Scholar), thus generating higher intracellular levels than the 4-fold increase we observed when challenging the cells for export measurements. Furthermore, it has been shown that polyamine stress in combination with Mg2+limitation leads to increased TPO1 mRNA abundance, even in aTPO1-overexpressing strain (4Tomitori H. Kashiwagi K. Asakawa T. Kakinuma Y. Michael A.J. Igarashi K. Biochem. J. 2001; 353: 681-688Crossref PubMed Scopus (102) Google Scholar). This might explain the overcompensation of spermidine sensitivity observed with the plate assay in contrast to our observation in the spermidine export measurements, which were performed under Mg2+ excess. Unfortunately, we were not able to provide appropriate growth medium completely devoid of a contaminant, which interfered with spermine analysis by HPLC. The contribution of Tpo1p in spermine export thus remains an unsettled question. The data presented so far favor a function of Tpo1p in detoxification of high intracellular polyamine levels. This observation is interesting in the context of other recent publications on the properties of Tpo1p. This transporter has been reported to confer resistance to a variety of structurally nonrelated toxic compounds like quinidine and cycloheximide (24do Valle Matta M.A. Jonniaux J.L. Balzi E. Goffeau A. van den Hazel B. Gene (Amst.). 2001; 272: 111-119Crossref PubMed Scopus (44) Google Scholar), mycophenolic acid (29Desmoucelles C. Pinson B. Saint-Marc C. Daignan-Fornier B. J. Biol. Chem. 2002; 277: 27036-27044Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar), or 2-methyl-4-chlorophenoxyacetic acid and 2,4-dichlorophenoxyacetic acid (30Teixeira M.C. Sa-Correia I. Biochem. Biophys. Res. Commun. 2002; 292: 530-537Crossref PubMed Scopus (60) Google Scholar), suggesting an broad substrate specificity, which is characteristic for multidrug resistance proteins (5Woolridge D.P. Vazquez-Laslop N. Markham P.N. Chevalier M.S. Gerner E.W. Neyfakh A.A. J. Biol. Chem. 1997; 272: 8864-8866Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar). Furthermore, TPO1 was recently shown to be a target for the regulators Pdr1p (24do Valle Matta M.A. Jonniaux J.L. Balzi E. Goffeau A. van den Hazel B. Gene (Amst.). 2001; 272: 111-119Crossref PubMed Scopus (44) Google Scholar) and Pdr3p (30Teixeira M.C. Sa-Correia I. Biochem. Biophys. Res. Commun. 2002; 292: 530-537Crossref PubMed Scopus (60) Google Scholar), both of which mediate multidrug resistance. This further emphasizes the concept that the primary function of Tpo1p in S. cerevisiae is the detoxification of hazardous compounds, which includes excess spermidine. We thank Bruno André for wild type yeast strain 23344c and the anti-Pma1p-antiserum, Wolf Frommer for yeast strain WF 7 and the expression vector pDR199, Eckhard Boles for the pUG6 derivatives, and Patty Kane for anti-Vph1p antibodies. We are indebted to Rolf Hecker for help establishing the HPLC analysis.