The Intronless and TATA-less HumanTAF 55 Gene Contains a Functional Initiator and a Downstream Promoter Element
2001; Elsevier BV; Volume: 276; Issue: 27 Linguagem: Inglês
10.1074/jbc.m102875200
ISSN1083-351X
AutoresTianyuan Zhou, Cheng-Ming Chiang,
Tópico(s)RNA regulation and disease
ResumoHuman TAFII55 (hTAFII55) is a component of the multisubunit general transcription factor TFIID and has been shown to mediate the functions of many transcriptional activators via direct protein-protein interactions. To uncover the regulatory properties of the general transcription machinery, we have isolated thehTAF II 55 gene and dissected the regulatory elements and the core promoter responsible forhTAF II 55 gene expression. Surprisingly, the hTAF II 55 gene has a single uninterrupted open reading frame and is the only intronless general transcription factor identified so far. Its expression is driven by a TATA-less promoter that contains a functional initiator and a downstream promoter element, as illustrated by both transfection assays and mutational analyses. Moreover, this core promoter can mediate the activity of a transcriptional activator that is artificially recruited to the promoter in a heterologous context. Interestingly, in the promoter-proximal region there are multiple Sp1-binding sites juxtaposed to a single AP2-binding site, indicating that Sp1 and AP2 may regulate the core promoter activity of thehTAF II 55 gene. These findings indicate that a combinatorial regulation of a general transcription factor-encoding gene can be conferred by both ubiquitous and cell type-specific transcriptional regulators.AF349038 Human TAFII55 (hTAFII55) is a component of the multisubunit general transcription factor TFIID and has been shown to mediate the functions of many transcriptional activators via direct protein-protein interactions. To uncover the regulatory properties of the general transcription machinery, we have isolated thehTAF II 55 gene and dissected the regulatory elements and the core promoter responsible forhTAF II 55 gene expression. Surprisingly, the hTAF II 55 gene has a single uninterrupted open reading frame and is the only intronless general transcription factor identified so far. Its expression is driven by a TATA-less promoter that contains a functional initiator and a downstream promoter element, as illustrated by both transfection assays and mutational analyses. Moreover, this core promoter can mediate the activity of a transcriptional activator that is artificially recruited to the promoter in a heterologous context. Interestingly, in the promoter-proximal region there are multiple Sp1-binding sites juxtaposed to a single AP2-binding site, indicating that Sp1 and AP2 may regulate the core promoter activity of thehTAF II 55 gene. These findings indicate that a combinatorial regulation of a general transcription factor-encoding gene can be conferred by both ubiquitous and cell type-specific transcriptional regulators.AF349038 TATA-binding protein transcription factor IID a 55-kDa TBP-associated factor found in TFIID human TAFII55 specificity protein 1 activator protein 2 initiator element downstream promoter element kilobase pair polymerase chain reaction 1,4-piperazinediethanesulfonic acid human immunodeficiency virus type 1 nucleotide Studies on eukaryotic promoters have identified several core promoter elements, which are characteristic DNA sequences required for promoter function. The TATA box is an A/T-rich sequence located ∼25–30 nucleotides upstream of the transcription start site. It contains a consensus sequence, TATA(A/T)A(A/T), whose recognition by the TATA-binding protein (TBP)1 subunit of TFIID nucleates the formation of a preinitiation complex (1Breathnach R. Chambon P. Annu. Rev. Biochem. 1981; 50: 349-383Crossref PubMed Scopus (3292) Google Scholar, 2Hernandez N. Genes Dev. 1993; 7: 1291-1308Crossref PubMed Scopus (561) Google Scholar, 3Burley S.K. Roeder R.G. Annu. Rev. Biochem. 1996; 65: 769-799Crossref PubMed Scopus (621) Google Scholar). A second core promoter element, the initiator (Inr), contains a pyrimidine (Y)-rich core sequence, YYA+1N(T/A)YY, surrounding the transcription start site (4Smale S.T. Biochim. Biophys. Acta. 1997; 1351: 73-88Crossref PubMed Scopus (499) Google Scholar). The Inr is capable of directing accurate transcription initiation either alone or in conjunction with a TATA box or other core promoter elements (5Smale S.T. Baltimore D. Cell. 1989; 57: 103-113Abstract Full Text PDF PubMed Scopus (1148) Google Scholar, 6Carcamo J. Buckbinder L. Reinberg D. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 8052-8056Crossref PubMed Scopus (119) Google Scholar, 7Weis L. Reinberg D. FASEB J. 1992; 6: 3300-3309Crossref PubMed Scopus (356) Google Scholar, 8Javahery R. Khachi A. Lo K. Zenzie-Gregory B. Smale S.T. Mol. Cell. Biol. 1994; 14: 116-127Crossref PubMed Scopus (596) Google Scholar, 9Burke T.W. Kadonaga J.T. Genes Dev. 1996; 10: 711-724Crossref PubMed Scopus (324) Google Scholar, 10Kutach A.K. Kadonaga J.T. Mol. Cell. Biol. 2000; 20: 4754-4764Crossref PubMed Scopus (271) Google Scholar). Several protein factors, including the TAFII150/CIF150 component of TFIID (11Verrijzer C.P. Yokomori K. Chen J.-L. Tjian R. Science. 1994; 264: 933-941Crossref PubMed Scopus (178) Google Scholar, 12Verrijzer C.P. Chen J.-L. Yokomori K. Tjian R. Cell. 1995; 81: 1115-1125Abstract Full Text PDF PubMed Scopus (257) Google Scholar, 13Hansen S.K. Tjian R. Cell. 1995; 82: 565-575Abstract Full Text PDF PubMed Scopus (99) Google Scholar, 14Kaufmann J. Verrijzer C.P. Shao J. Smale S.T. Genes Dev. 1996; 10: 873-886Crossref PubMed Scopus (65) Google Scholar, 15Kaufmann J. Ahrens K. Koop R. Smale S.T. Müller R. Mol. Cell. Biol. 1998; 18: 233-239Crossref PubMed Scopus (54) Google Scholar, 16Martinez E. Ge H. Tao Y. Yuan C.-X. Palhan V. Roeder R.G. Mol. Cell. Biol. 1998; 18: 6571-6583Crossref PubMed Scopus (62) Google Scholar, 17Chalkley G.E. Verrijzer C.P. EMBO J. 1999; 18: 4835-4845Crossref PubMed Scopus (176) Google Scholar), RNA polymerase II (6Carcamo J. Buckbinder L. Reinberg D. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 8052-8056Crossref PubMed Scopus (119) Google Scholar), TFII-I/SPIN/BAP-135 (18Roy A.L. Meisterernst M. Pognonec P. Roeder R.G. Nature. 1991; 354: 245-248Crossref PubMed Scopus (364) Google Scholar, 19Roy A.L. Du H. Gregor P.D. Novina C.D. Martinez E. Roeder R.G. EMBO J. 1997; 16: 7091-7104Crossref PubMed Scopus (171) Google Scholar, 20Grueneberg D.A. Henry R.W. Brauer A. Novina C.D. Cheriyath V. Roy A.L. Gilman M. Genes Dev. 1997; 11: 2482-2493Crossref PubMed Scopus (118) Google Scholar, 21Yang W. Desiderio S. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 604-609Crossref PubMed Scopus (157) Google Scholar), USF (22Du H. Roy A.L. Roeder R.G. EMBO J. 1993; 12: 501-511Crossref PubMed Scopus (190) Google Scholar), and YY1 (23Seto E. Shi Y. Shenk T. Nature. 1991; 354: 241-244Crossref PubMed Scopus (337) Google Scholar), have been implicated in Inr function. However, the nucleation pathways of these Inr-targeting proteins have not yet been defined. The downstream promoter element (DPE), which is located 28–34 nucleotides downstream of the transcription start site in manyDrosophila TATA-less promoters (9Burke T.W. Kadonaga J.T. Genes Dev. 1996; 10: 711-724Crossref PubMed Scopus (324) Google Scholar, 10Kutach A.K. Kadonaga J.T. Mol. Cell. Biol. 2000; 20: 4754-4764Crossref PubMed Scopus (271) Google Scholar, 24Burke T.W. Kadonaga J.T. Genes Dev. 1997; 11: 3020-3031Crossref PubMed Scopus (396) Google Scholar), has a consensus sequence, (A/G)G(A/T)CGTG, and can be recognized by the dTAFII60 and dTAFII40 components ofDrosophila TFIID (9Burke T.W. Kadonaga J.T. Genes Dev. 1996; 10: 711-724Crossref PubMed Scopus (324) Google Scholar, 24Burke T.W. Kadonaga J.T. Genes Dev. 1997; 11: 3020-3031Crossref PubMed Scopus (396) Google Scholar). This finding suggests that TFIID is likely to be the DPE-binding factor. Interestingly, negative cofactor 2 (NC2 or Dr1-Drap1), initially characterized as a TBP-inhibitory activity on a TATA-containing promoter (25Meisterernst M. Roeder R.G. Cell. 1991; 67: 557-567Abstract Full Text PDF PubMed Scopus (227) Google Scholar, 26Inostroza J.A. Mermelstein F.H. Ha I. Lane W.S. Reinberg D. Cell. 1992; 70: 477-489Abstract Full Text PDF PubMed Scopus (292) Google Scholar, 27Goppelt A. Stelzer G. Lottspeich F. Meisterernst M. EMBO J. 1996; 15: 3105-3116Crossref PubMed Scopus (129) Google Scholar, 28Mermelstein F. Yeung K. Cao J. Inostroza J.A. Erdjument-Bromage H. Eagelson K. Landsman D. Levitt P. Tempst P. Reinberg D. Genes Dev. 1996; 10: 1033-1048Crossref PubMed Scopus (113) Google Scholar), has recently been shown to facilitate transcription from DPE-driven promoters (29Willy P.J. Kobayashi R. Kadonaga J.T. Science. 2000; 290: 982-985Crossref PubMed Scopus (133) Google Scholar). It seems that TFIID and NC2, two of the DPE-acting factors, may work synergistically through the DPE, although their functional relationship remains to be elucidated. Another upstream core promoter element, (G/C)(G/C)(G/A)CGCC, was identified through binding site selection as a GC-rich sequence recognized by TFIIB (30Lagrange T. Kapanidis A.N. Tang H. Reinberg D. Ebright R.H. Genes Dev. 1998; 12: 34-44Crossref PubMed Scopus (304) Google Scholar). This TFIIB recognition element (BRE) is located immediately upstream of the TATA box and can be used to modulate preinitiation complex assembly in eukaryotic cells (30Lagrange T. Kapanidis A.N. Tang H. Reinberg D. Ebright R.H. Genes Dev. 1998; 12: 34-44Crossref PubMed Scopus (304) Google Scholar) as well as in Archaea (31Qureshi S.A. Jackson S.P. Mol. Cell. 1998; 1: 389-400Abstract Full Text Full Text PDF PubMed Scopus (118) Google Scholar). Analysis of the promoter database reveals that 57% of theDrosophila core promoters do not contain a TATA box, and the DPE occurs in ∼40% of the Drosophila promoters (10Kutach A.K. Kadonaga J.T. Mol. Cell. Biol. 2000; 20: 4754-4764Crossref PubMed Scopus (271) Google Scholar). Although such statistical data are not yet available for the human genome, it appears that the promoters of human housekeeping genes, oncogenes, growth factors, and transcription factors often lack a TATA box (32Zhang M.Q. Genome Res. 1998; 8: 319-326Crossref PubMed Scopus (93) Google Scholar). In addition, many natural promoters contain distinct combinations of core promoter elements whose differential utilization plays an important role in regulating gene expression in a spatial, temporal, or lineage-specific manner (13Hansen S.K. Tjian R. Cell. 1995; 82: 565-575Abstract Full Text PDF PubMed Scopus (99) Google Scholar, 33Novina C.D. Roy A.L. Trends Genet. 1996; 12: 351-355Abstract Full Text PDF PubMed Scopus (141) Google Scholar, 34Ren B. Maniatis T. EMBO J. 1998; 17: 1076-1086Crossref PubMed Scopus (22) Google Scholar). Human TAFII55 (hTAFII55) was first identified as an RNA polymerase II-specific TBP-associated factor (TAFII) in TFIID (35Chiang C.-M. Roeder R.G. Science. 1995; 267: 531-536Crossref PubMed Scopus (352) Google Scholar, 36Lavigne A.-C. Mengus G. May M. Dubrovskaya V. Tora L. Chambon P. Davidson I. J. Biol. Chem. 1996; 271: 19774-19780Abstract Full Text Full Text PDF PubMed Scopus (43) Google Scholar) and, like many other TAFIIs, was also detected in the TBP-free-TAFII-containing complex (37Wieczorek E. Brand M. Jacq X. Tora L. Nature. 1998; 393: 187-191Crossref PubMed Scopus (225) Google Scholar). However, TAFII55 is not present in some other TAFII-containing complexes, such as human PCAF (38Ogryzko V.V. Kotani T. Zhang X. Schlitz R.L. Howard T. Yang X.-J. Howard B.H. Qin J. Nakatani Y. Cell. 1998; 94: 35-44Abstract Full Text Full Text PDF PubMed Scopus (466) Google Scholar) and yeast SAGA complexes (39Grant P.A. Schieltz D. Pray-Grant M.G. Steger D.J. Reese J.C. Yates J.R. Workman J.L. Cell. 1998; 94: 45-53Abstract Full Text Full Text PDF PubMed Scopus (386) Google Scholar), suggesting that TAFII55 has unique properties distinct from its role as a structural component of TFIID and of TBP-free-TAFII-containing complex. This idea is further substantiated by the finding that TAFII55 can interact with many transcription factors, including Sp1, YY1, USF, CTF, adenovirus E1A, and HIV-1 Tat (35Chiang C.-M. Roeder R.G. Science. 1995; 267: 531-536Crossref PubMed Scopus (352) Google Scholar), and can also mediate vitamin D3 and thyroid hormone receptor activation in a ligand-independent manner (40Lavigne A.-C. Mengus G. Gangloff Y.-G. Wurtz J.-M. Davidson I. Mol. Cell. Biol. 1999; 19: 5486-5494Crossref PubMed Google Scholar), consistent with a coactivator role of TAFII55 in transcriptional regulation. Moreover, TAFII55 may be implicated in mRNA 3′ end processing, as it shows strong affinity toward the human cleavage-polyadenylation specificity factor (41Dantonel J.-C. Murthy K.G. Manley J.L. Tora L. Nature. 1997; 389: 399-402Crossref PubMed Scopus (253) Google Scholar). TAFII55 homologues have also been identified in several organisms. The mouse homologue, mTAFII55, is 95% identical to its human counterpart (42Wu S.-Y. Thomas M.C. Hou S.Y. Likhite V. Chiang C.-M. J. Biol. Chem. 1999; 274: 23480-23490Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar), and the Saccharomyces cerevisiae homologue, yTaf67, is essential for cellular viability 2S.-Y. Wu and C.-M. Chiang, unpublished data. 2S.-Y. Wu and C.-M. Chiang, unpublished data. (43Moqtaderi Z. Yale J.D. Struhl K. Buratowski S. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 14654-14658Crossref PubMed Scopus (84) Google Scholar). Recently, the Schizosaccharomyces pombe homologue of yTaf67, Ptr6p (poly(A)+ RNA transport), was shown to be involved in nucleocytoplasmic transport of mRNAs during a genetic screen for mutants that accumulate mRNAs in the nucleus (44Shibuya T. Tsuneyoshi S. Azad A.K. Urushiyama S. Ohshima Y. Tani T. Genetics. 1999; 152: 869-880Crossref PubMed Google Scholar). Moreover, proteins that share high sequence homology with hTAFII55 have also been identified in Caenorhabditis elegans(GenBankTM accession number Z67755) and Drosophila melanogaster (GenBankTM accession number AF017096). The chromosomal location of the hTAF II 55gene has been mapped to 5q31, where chromosomal mutations have been associated with stomach adenocarcinoma (45Purrello M. Di Pietro C. Viola A. Rapisarda A. Stevens S. Guermah M. Tao Y. Bonaiuto C. Arcidiacono A. Messina A. Sichel G. Grzeschik K.-H. Roeder R. Oncogene. 1998; 16: 1633-1638Crossref PubMed Scopus (20) Google Scholar), suggesting thathTAF II 55 or other genes localized in this region may act as an oncogene. Interestingly, Northern blot analysis showed that hTAFII55 is differentially expressed in various human tissues. 3C.-M. Chiang, unpublished data. 3C.-M. Chiang, unpublished data. In addition, we observed that in a HeLa-derived cell line that conditionally expresses FLAG-tagged hTAFII55, the overall level of the induced tagged protein and the endogenous untagged hTAFII55 protein remains constant (46Wu S.-Y. Chiang C.-M. BioTechniques. 1996; 21: 718-725Crossref PubMed Scopus (18) Google Scholar). This indicates a tight regulation overhTAF II 55 expression in vivo. In order to understand the regulation ofhTAF II 55 gene expression and to gain further insight into the regulatory pathways of general transcription factor-encoding genes, we dissected the cis-acting elements and trans-acting factors that regulate the expression of thehTAF II 55 gene. Our studies indicate thathTAF II 55 gene expression is combinatorially regulated by both ubiquitous and cell type-specific transcription factors. Moreover, we have characterized the core promoter elements of the hTAF II 55 gene, which surprisingly contains a single uninterrupted open reading frame whose expression is driven by a TATA-deficient promoter with a functional initiator and a DPE. Collectively, these findings uncover unusual features of hTAF II 55 gene structure and regulatory properties that are significantly different from other general transcription factor-encoding genes. A human genomic library, derived from the HT1080 human fibrosarcoma cell line and cloned in the λ-DASH II vector (Stratagene), was screened with a32P-labeled DNA fragment spanning the first 474 nucleotides (cut between the HpaI andEcoRI sites) of the hTAFII55 cDNA (35Chiang C.-M. Roeder R.G. Science. 1995; 267: 531-536Crossref PubMed Scopus (352) Google Scholar). From ∼1 × 106 plaque-forming units, 12 positive clones were isolated. The inserts were individually cloned into theNotI site of pBS-SK (+) (Stratagene). A clone, pBS/3′-8, which contains an insert of ∼17 kb, including regions 5′ and 3′ ofhTAFII55, was manually sequenced (GenBankTM accession number AF349038). A 1459-bp genomic DNA fragment that extends 1436 bp upstream and 23 bp downstream of the 5′ end of the hTAFII55 cDNA (35Chiang C.-M. Roeder R.G. Science. 1995; 267: 531-536Crossref PubMed Scopus (352) Google Scholar) was amplified by polymerase chain reaction (PCR) from pBS/3′-8 using an upstream KpnI site-containing primer (5′ CATTCTGGTACCAGGCACTGGGACAC 3′) and a downstream BglII site-containing primer (5′ AGCGCGAGATCTTGCCGAGAGG 3′). The amplified DNA fragment was then cloned into pGL2-Basic (Promega) between the KpnI andBglII sites. The resulting construct was denoted pGL2-TAF55(−1372/+87). A series of hTAF II 55 promoter deletion constructs, including pGL2-TAF55(−128/+87), pGL2-TAF55(−99/+87), pGL2-TAF55(−71/+87), pGL2-TAF55(−55/+87), pGL2-TAF55(−26/+87), pGL2-TAF55(−128/+36), pGL2-TAF55(−71/+36), pGL2-TAF55(−55/+36), and pGL2-TAF55(−26/+36) were similarly made in pGL2-Basic by using primer pairs with introduced KpnI and BglII sites at their 5′ and 3′ ends, respectively. The numbers in the deletion constructs indicate the boundaries of the inserts relative to the transcription start site. The plasmids pGL2-TAF55(−748/+87) and pGL2-TAF55(−281/+87) were created by first cleaving pGL2-TAF55(−1372/+87) with ScaI or XbaI, filling in the XbaI-digested end with Klenow enzyme, and releasing the inserts with BglII. The promoter-containing fragments were then cloned into pGL2-Basic between the BglII site and the Klenow- filled-in XhoI site to generate pGL2-TAF55(−748/+87) and pGL2-TAF55(−281/+87), respectively. The plasmid pGL2-TAF55(−161/+87) was generated by cloning a PCR fragment, amplified with an upstream primer spanning −161 to −144 and the same downstream BglII site-containing primer ending at +87, between the BglII site and the Klenow-filled-in XhoI site of pGL2-Basic. Similarly, the plasmid pGL2-TAF55(−1372/−140) was made by inserting a PCR fragment, amplified with the same upstream KpnI site-containing primer ending at −1372 and a downstream primer spanning −157 to −140, between the KpnI site and the Klenow-filled-inXhoI site of pGL2-Basic. Promoter constructs containing nucleotide substitutions in the sequence motifs of Sp1, AP2, Inr, and DPE (denoted by asterisks) were individually generated by PCR amplification with primer pairs spanning the mutated nucleotides according to the QuikChange site-directed mutagenesis protocol (Stratagene). The plasmids pGL2-TAF55(−71/+36)Sp1*-60, pGL2-TAF55(−71/+36)AP2*, pGL2-TAF-55(−71/+36)Sp1*-60/AP2*, pGL2-TAF55(−71/+36)Sp1*-20, pGL2-TAF55(−26/+36)Inr*, pGL2-TAF55(−26/+36)DPE*, and pGL2-TAF55(−26/+36)Inr*DPE* were constructed in the backbone of pGL2-TAF55(−71/+36) or pGL2-TAF55(−26/+36) using primer pairs containing the introduced mutations as shown in Figs. 4B and5A. For five Gal4-binding site-containing constructs, theSacI-PstI fragment of pG5HMC2AT (47Chiang C.-M. Ge H. Wang Z. Hoffmann A. Roeder R.G. EMBO J. 1993; 12: 2749-2762Crossref PubMed Scopus (171) Google Scholar) with 5 Gal4-binding sites was first cloned into pBS-SK(+) between SacI and PstI sites to generate pBS-5Gal, from which theSmaI-KpnI fragment was isolated and cloned into pGL2-TAF55(−26/+36), pGL2-TAF55(−26/+36)Inr*, pGL2-TAF55(−26/+36)DPE*, pGL2-TAF55(−26/+36)Inr*DPE*, and pGL2-Basic at the same enzyme-cutting sites to create pGL2–5Gal(−26/+36)WT, pGL2–5Gal(−26/+36)Inr*, pGL2–5Gal(−26/+36)DPE*, pGL2–5Gal(−26/+36)Inr*DPE*, and pGL2–5Gal, respectively. All constructs were confirmed by restriction enzyme digestion and DNA sequencing.Figure 5Inr and DPE are both important core promoter elements for hTAF II 55 gene expression.A, mutations at the Inr and the DPE reducehTAF II 55 promoter activity. Transient transfection and reporter gene assays were performed as described under "Experimental Procedures" using plasmids containing either wild-type or mutated nucleotides at the Inr and/or the DPE of thehTAF II 55 promoter fragment spanning −26 to +36. The pGL2-Basic plasmid (vector) containing no insert was also used for transfection as control. Luciferase activity was normalized to that of the wild-type promoter construct, pGL2-TAF55(−26/+36), and presented in the bar graph witherror bars showing standard deviation. Asterisksand × indicate mutations introduced at specific protein-binding motifs in the plasmids. The nucleotides changed in each motifs are denoted at the bottom. B, the Inr and DPE modules of the hTAF II 55 core promoter can mediate transcriptional activation in a heterologous promoter context. Transient transfection was performed in C-33A cells by cotransfecting different amounts of the Gal4-VP16-expressing plasmid (pSGVP), together with either wild-type (WT) or mutated reporter constructs driven by 5 Gal4-binding sites as indicated.View Large Image Figure ViewerDownload (PPT) The HIV-1 promoter construct pGL2-HIV(−167/+80) was created by transferring the XhoI-HindIII fragment, which contains the HIV-1 promoter region spanning −167 to +80, from p-167 (48Rosen C.A. Sodroski J.G. Haseltine W.A. Cell. 1985; 41: 813-823Abstract Full Text PDF PubMed Scopus (500) Google Scholar) into the same enzyme-cutting sites in pGL2-Basic. The pBS-TAF55(−128/+87) plasmid used to generate riboprobe for RNase protection analysis was created by subcloning theSmaI-HindIII fragment from pGL2-TAF55(−128/+87) into the same enzyme-cutting sites of pBS-SK(+). The other plasmids, pHIV+58 (49Kato H. Horikoshi M. Roeder R.G. Science. 1991; 251: 1476-1479Crossref PubMed Scopus (107) Google Scholar), pGL7072-161 (50Hou S.Y. Wu S.-Y. Zhou T. Thomas M.C. Chiang C.-M. Mol. Cell. Biol. 2000; 20: 113-125Crossref PubMed Scopus (41) Google Scholar), pSGVP (51Sadowski I. Ma J. Triezenberg S. Ptashne M. Nature. 1988; 335: 563-564Crossref PubMed Scopus (973) Google Scholar), pSG424 (52Sadowski I. Ptashne M. Nucleic Acids Res. 1989; 17: 7539Crossref PubMed Scopus (471) Google Scholar), and pGL2-Control (Promega) have already been described. C-33A cells, which were derived from human cervical carcinoma, were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum in humidified 5% CO2incubator at 37 °C. Transient transfection was carried out in C-33A cells with 4 μg of each reporter plasmid, either alone or in conjunction with varying amounts of the Gal4-VP16-expressing plasmid (pSGVP) supplemented with the cloning vector (pSG424) to a total of 1 μg, using the calcium phosphate precipitation method as described (53Chiang C.-M. Broker T.R. Chow L.T. J. Virol. 1991; 65: 3317-3329Crossref PubMed Google Scholar). The transfected cells, after rinsing twice with 1× PBS, were collected 24 h post-transfection by a rubber policeman and resuspended in 100 μl of T250E5 buffer (250 mm Tris-HCl, pH 7.6, and 5 mm EDTA). Cell lysates were then prepared by three cycles of freezing and thawing in liquid nitrogen and a 37 °C water bath. Following centrifugation at 4 °C for 10 min, 2 μl of the supernatant was mixed with 350 μl of luciferase buffer (25 mm HEPES, pH 7.8, 5 mm ATP, 15 mmMgSO4) with luciferase assays conducted by automatically injecting 100 μl of 0.2 mm luciferin (Analytical Luminescence Laboratory) into the samples and measuring the luminescence for 12 s after an initial 2-s delay, using a Monolight 2010 luminometer (Analytical Luminescence Laboratory). Transfection and reporter gene assays were performed independently at least four times, each in duplicate. In vitro transcription was performed with HeLa nuclear extracts and analyzed by primer extension as described (50Hou S.Y. Wu S.-Y. Zhou T. Thomas M.C. Chiang C.-M. Mol. Cell. Biol. 2000; 20: 113-125Crossref PubMed Scopus (41) Google Scholar). The Luc-5 primer (5′ CTCTTCATAGCCTTATGCAG 3′) and the Luc-1 primer (5′ TCTTTATGTTTTTGGCGTCT 3′) that anneal to nucleotides 151–170 and 81–100, respectively, of pGL2-Basic were used for examining products derived fromhTAF II 55 promoter-containing constructs, whereas a chloramphenicol acetyltransferase primer (5′ CAACGGTGGTATATCCAGTG 3′) that anneals to nucleotides 4936–4953 of pSV2CAT (54Gorman C.M. Moffat L.F. Howard B.H. Mol. Cell. Biol. 1982; 2: 1044-1051Crossref PubMed Scopus (5292) Google Scholar) was used for determining the product derived from pHIV+58. All the primer extension products were analyzed on an 8 murea, 5% Long Ranger (FMC) polyacrylamide gel together with the dideoxynucleotide sequencing products generated with the phosphorylated forms of the corresponding primers. Total cellular RNA was prepared from eight 100-mm plates of 80% confluent C-33A cells by guanidinium thiocyanate/phenol extraction method using 8 ml of Trizol reagent (Life Technologies, Inc.) according to the manufacturer's instructions. Poly(A)+ RNA was isolated by first passing heat-treated total cellular RNA, after mixing with an equal volume of 2× loading buffer, through a 1-ml oligo(dT)-cellulose (Amersham Pharmacia Biotech) column, which was pre-equilibrated with 1× loading buffer (20 mm Tris-HCl, pH 7.6, 0.5 m LiCl, 1 mm EDTA, and 0.1% SDS). The flow-through fraction was collected, denatured at 65 °C for 5 min, chilled on ice, and loaded again onto the column. This process was repeated for two additional times. The column was then washed with 6–8 column volumes of 1× loading buffer. Poly(A)+ RNA was eluted with 1 column volume of elution buffer (10 mm Tris-HCl, pH 7.5, 1 mm EDTA, and 0.05% SDS) for a total of three times, precipitated with ethanol, and finally resuspended in diethyl pyrocarbonate-treated water. An antisense riboprobe, corresponding to +87 to −128 of thehTAF II 55 promoter region with flanking polylinker sequences, was synthesized by transcribing theBamHI-linearized pBS-TAF55(−128/+87) template with 2 units of T7 RNA polymerase in the presence of 2 μCi/μl [α-32P]CTP, 10 μm CTP, 0.1 mmATP, UTP, and GTP, 40 mm Tris-HCl, pH 8.0, 8 mmMgCl2, 50 mm NaCl, 30 mmdithiothreitol, 1 unit/μl RNasin (Promega), and 2 mmspermidine in a 25-μl mixture. The reaction was conducted at 37 °C for 60 min. The riboprobe was then separated on a 4% polyacrylamide-8m urea gel, eluted from the gel slice in elution buffer (0.5 m ammonium acetate, 10 mm magnesium acetate, 0.1% SDS, and 1 mm EDTA), extracted with phenol/chloroform, precipitated with ethanol, and finally dissolved in 50 μl of 1× hybridization buffer (40 mm PIPES, pH 6.7, 0.4 m NaCl, and 1 mm EDTA). RNase protection assay was carried out as described previously (55Melton D.A. Krieg P.A. Rebagliati M.R. Maniatis T. Zinn K. Green M.R. Nucleic Acids Res. 1984; 12: 7035-7056Crossref PubMed Scopus (4054) Google Scholar) with minor modifications. Briefly, ∼5 × 105 cpm of thein vitro synthesized riboprobe was mixed with 3 μg of poly(A)+ RNA in a 30-μl reaction mixture containing 80% formamide in a final 1× hybridization buffer, overlaid with mineral oil, heated at 90 °C for 10 min, and hybridized at 58 °C overnight. The hybridization reaction was then quenched on dry ice and incubated with 350 μl of RNase solution containing 14 μg of RNase A (Sigma), 50 units of RNase T1 (Amersham Pharmacia Biotech), 0.3m NaCl, 10 mm Tris-HCl, pH 7.5, and 5 mm EDTA at 30 °C for 60 min. The ribonucleases were degraded by adding 50 μg of proteinase K (U. S. Biochemical Corp.) and 5 μl of 10% SDS and incubated for another 15 min at 37 °C. The protected fragments were purified by phenol/chloroform extraction, precipitated twice with ethanol, and finally analyzed on a 5% polyacrylamide-urea gel with a DNA sequencing ladder loaded in parallel as size markers. The migration differences between the protected RNA fragments and the DNA size markers were adjusted using undigested riboprobe as standard. To understand the regulatory properties of general transcription factor-encoding genes, we isolated a dozen genomic clones from an HT1080 human fibrosarcoma genomic library using probes derived from hTAFII55 cDNA (35Chiang C.-M. Roeder R.G. Science. 1995; 267: 531-536Crossref PubMed Scopus (352) Google Scholar). One of the isolated clones, 3′-8, containing the entire open reading frame and flanking regions was completely sequenced (17,042 bp, GenBankTM accession numberAF349038). The hTAF II 55 gene, which encodes a component of the eukaryotic core promoter-binding factor TFIID, encompasses the complete cDNA sequence ofhTAF II 55, suggesting that it is an intronless gene (Fig. 1A). This finding is surprising, given the fact that the human general transcription factor-encoding genes so far identified, including TFIIA (α/β and γ), TFIIB, TFIIEα, TFIIEβ, the RAP30 and RAP74 subunits of TFIIF, components (p89, p80, p62, p52, p44, p34, CDK7, cyclin H, and MAT1) of TFIIH, TBP, and other TAFIIs in TFIID, all have introns (data not shown). The possibility that our hTAF II 55 genomic DNA was derived from retrotransposition of the hTAFII55 cDNA was excluded for the following reasons. First, a poly(A) tail sequence found at the 3′ end of the hTAFII55 cDNA (35Chiang C.-M. Roeder R.G. Science. 1995; 267: 531-536Crossref PubMed Scopus (352) Google Scholar) is absent in all of our genomic clones. The hTAFII55 sequences identified in the genomic clones and the cDNA diverge at the 3′ cleavage site where poly (A) addition occurs (data not shown), indicating that reverse transcription and retroviral insertion are unlikely to be involved in generating the genomic copy. Second, all of our independent clones that extended beyond the 3′ end of the hTAFII55 cDNA had identical seque
Referência(s)