Portal de Periódicos da CAPES

Purification and Cloning of a Brefeldin A-inhibited Guanine Nucleotide-exchange Protein for ADP-ribosylation Factors

1999; Elsevier BV; Volume: 274; Issue: 18 Linguagem: Inglês

10.1074/jbc.274.18.12308

1083-351X

Akira Togawa, Naoko Morinaga, Masahito Ogasawara, Joel Moss, Martha Vaughan,

PARP inhibition in cancer therapy

Activation of ADP-ribosylation factors (ARFs), ∼20-kDa guanine nucleotide-binding proteins that play an important role in intracellular vesicular trafficking, depends on guanine nucleotide-exchange proteins (GEPs), which accelerate replacement of bound GDP with GTP. Two major families of ARF GEPs are known: ∼200-kDa molecules that are inhibited by brefeldin A (BFA), a fungal metabolite that blocks protein secretion and causes apparent disintegration of Golgi structure, and ∼50-kDa GEPs that are insensitive to BFA. We describe here two human brain cDNAs that encode BFA-inhibited GEPs. One is a ∼209-kDa protein 99.5% identical in deduced amino acid sequence (1,849 residues) to a BFA-inhibited ARF GEP (p200) from bovine brain. The other smaller protein, which is ∼74% identical (1,785 amino acids), represents a previously unknown gene. We propose that the former, p200, be named BIG1 for (brefeldin A-inhibited GEP1) and the second, which encodes a ∼202-kDa protein, BIG2. A protein containing sequences found in BIG2 had been purified earlier from bovine brain. Human tissues contained a 7.5-kilobase BIG1 mRNA and a 9.4-kilobase BIG2 transcript. The BIG1 andBIG2 genes were localized, respectively, to chromosomes 8 and 20. BIG2, synthesized as a His6 fusion protein in Sf9 cells, accelerated guanosine 5′-3-O-(thio)triphosphate binding by recombinant ARF1, ARF5, and ARF6. It activated native ARF (mixture of ARF1 and ARF3) more effectively than it did any of the nonmyristoylated recombinant ARFs. BIG2 activity was inhibited by BFA in a concentration-dependent manner but not by B17, a structural analog without effects on Golgi function. Although several clones for ∼50-kDa BFA-insensitive ARF GEPs are known, these new clones for the ∼200-kDa BIG1 and BIG2 should facilitate characterization of this rather different family of proteins as well as the elucidation of mechanisms of regulation of BFA-sensitive ARF function in Golgi transport. Activation of ADP-ribosylation factors (ARFs), ∼20-kDa guanine nucleotide-binding proteins that play an important role in intracellular vesicular trafficking, depends on guanine nucleotide-exchange proteins (GEPs), which accelerate replacement of bound GDP with GTP. Two major families of ARF GEPs are known: ∼200-kDa molecules that are inhibited by brefeldin A (BFA), a fungal metabolite that blocks protein secretion and causes apparent disintegration of Golgi structure, and ∼50-kDa GEPs that are insensitive to BFA. We describe here two human brain cDNAs that encode BFA-inhibited GEPs. One is a ∼209-kDa protein 99.5% identical in deduced amino acid sequence (1,849 residues) to a BFA-inhibited ARF GEP (p200) from bovine brain. The other smaller protein, which is ∼74% identical (1,785 amino acids), represents a previously unknown gene. We propose that the former, p200, be named BIG1 for (brefeldin A-inhibited GEP1) and the second, which encodes a ∼202-kDa protein, BIG2. A protein containing sequences found in BIG2 had been purified earlier from bovine brain. Human tissues contained a 7.5-kilobase BIG1 mRNA and a 9.4-kilobase BIG2 transcript. The BIG1 andBIG2 genes were localized, respectively, to chromosomes 8 and 20. BIG2, synthesized as a His6 fusion protein in Sf9 cells, accelerated guanosine 5′-3-O-(thio)triphosphate binding by recombinant ARF1, ARF5, and ARF6. It activated native ARF (mixture of ARF1 and ARF3) more effectively than it did any of the nonmyristoylated recombinant ARFs. BIG2 activity was inhibited by BFA in a concentration-dependent manner but not by B17, a structural analog without effects on Golgi function. Although several clones for ∼50-kDa BFA-insensitive ARF GEPs are known, these new clones for the ∼200-kDa BIG1 and BIG2 should facilitate characterization of this rather different family of proteins as well as the elucidation of mechanisms of regulation of BFA-sensitive ARF function in Golgi transport. ADP-ribosylation factors (ARFs) 1The abbreviations used are: ARF(s), ADP-ribosylation factor(s); GEP, guanine nucleotide-exchange protein; BFA, brefeldin A; GTPγS, guanosine 5′-3-O-(thio)triphosphate PCR, polymerase chain reaction; kb, kilobase(s); bp, base pair(s); AEBSF, 4-(2-aminoethyl)butylsulfonyl fluoride; PH domain, pleckstrin homology domainare ∼20-kDa guanine nucleotide-binding proteins, initially identified by their ability to enhance cholera toxin-catalyzed ADP-ribosylation of the GTP-binding protein Gαs (1Kahn R.A. Gilman A.G. J. Biol. Chem. 1984; 259: 6228-6234Abstract Full Text PDF PubMed Google Scholar). ARFs are ubiquitous in eukaryotic cells from Giardia to human and are known to play an important role in intracellular vesicular trafficking (for review, see Ref. 2Moss J. Vaughan M. J. Biol. Chem. 1995; 270: 12327-12330Crossref PubMed Scopus (272) Google Scholar), as well as to activate phospholipase D (3Brown H.A. Gutowski S. Moomaw C.R. Slaughter C. Sternweis P.C. Cell. 1993; 75: 1137-1144Abstract Full Text PDF PubMed Scopus (823) Google Scholar, 4Cockcroft S. Thomas G.M. Fensome A. Geny B. Cunningham E. Gout I. Hiles I. Totty N.F. Truong O. Hsuan J.J. Science. 1994; 263: 523-526Crossref PubMed Scopus (586) Google Scholar). Six mammalian ARFs, identified by cDNA cloning, are grouped into three classes based on size, amino acid sequence, phylogenetic analysis, and gene structure: ARFs 1–3 in class I, ARFs 4 and 5 in class II, and ARF6 in class III (5Tsuchiya M. Price S.R. Tsai S.-C. Moss J. Vaughan M. J. Biol. Chem. 1991; 266: 2772-2777Abstract Full Text PDF PubMed Google Scholar, 6Welsh C.F. Moss J. Vaughan M. Mol. Cell. Biochem. 1994; 138: 157-166Crossref PubMed Scopus (46) Google Scholar). Like other GTPases that regulate many kinds of intracellular processes, ARFs are active and associate with membranes when GTP is bound, whereas inactive ARF·GDP is cytosolic. Replacement of GDP by GTP is accelerated by ARF GEPs or guanine nucleotide-exchange proteins, several of which have been identified (7Moss J. Vaughan M. J. Biol. Chem. 1998; 273: 21431-21434Abstract Full Text Full Text PDF PubMed Scopus (299) Google Scholar). These include Gea1 and Gea2 from yeast (8Peyroche A. Paris S. Jackson C.L. Nature. 1996; 384: 479-481Crossref PubMed Scopus (236) Google Scholar), mammalian B2-1 or cytohesin-1 (9Liu L. Pohajdak B. Biochim. Biophys. Acta. 1992; 1132: 75-78Crossref PubMed Scopus (64) Google Scholar) and cytohesin-2 or ARNO (10Chardin P. Paris S. Antonny B. Robineau S. Béraud-Dufour S. Jackson C.L. Chabre M. Nature. 1996; 384: 481-484Crossref PubMed Scopus (409) Google Scholar), which are 83% identical in amino acid sequence, and GRP1 (general receptor forphosphoinositides), a third member of the cytohesin group (11Klarlund J.K. Guilherme A. Holik J.J. Virbasius J.V. Chawla A. Czech M.P. Science. 1997; 275: 1927-1930Crossref PubMed Scopus (372) Google Scholar). All ARF GEPs of known structure contain Sec7 domains (8Peyroche A. Paris S. Jackson C.L. Nature. 1996; 384: 479-481Crossref PubMed Scopus (236) Google Scholar, 9Liu L. Pohajdak B. Biochim. Biophys. Acta. 1992; 1132: 75-78Crossref PubMed Scopus (64) Google Scholar, 10Chardin P. Paris S. Antonny B. Robineau S. Béraud-Dufour S. Jackson C.L. Chabre M. Nature. 1996; 384: 481-484Crossref PubMed Scopus (409) Google Scholar, 11Klarlund J.K. Guilherme A. Holik J.J. Virbasius J.V. Chawla A. Czech M.P. Science. 1997; 275: 1927-1930Crossref PubMed Scopus (372) Google Scholar, 12Telemenakis I. Benseler F. Stenius K. Südhof T.C. Brose N. Eur. J. Cell. Biol. 1997; 74: 143-149PubMed Google Scholar, 13Franco M. Boretto J. Robineau S. Monier S. Goud B. Chardin P. Chavrier P. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 9926-9931Crossref PubMed Scopus (85) Google Scholar). Sec7 was identified in a group of conditionally lethal yeast mutants as a gene involved in Golgi vesicular trafficking and secretion (14Achstetter T. Franzusoff A. Field C. Schekman R. J. Biol. Chem. 1988; 263: 11711-11717Abstract Full Text PDF PubMed Google Scholar). The Sec7 gene product is a ∼230-kDa phosphoprotein that moves between membrane and cytosolic fractions (15Franzusoff A. Schekman R. EMBO J. 1989; 8: 2695-2702Crossref PubMed Scopus (170) Google Scholar). Its Sec7 domain was demonstrated relatively recently to function as a brefeldin A (BFA)-inhibited ARF GEP (16Sata M. Donaldson J.G. Moss J. Vaughan M. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 4204-4208Crossref PubMed Scopus (78) Google Scholar). BFA is a fungal fatty acid metabolite with a monocyclic lactone ring that blocks protein secretion reversibly and causes apparent collapse of Golgi membranes into the endoplasmic reticulum (17Misumi Y. Misumi Y. Miki K. Takatsuki A. Tamura G. Ikehara Y. J. Biol. Chem. 1986; 261: 11398-11403Abstract Full Text PDF PubMed Google Scholar, 18Lippincott-Schwartz J. Yuan L.C. Bonifacino J.S. Klausner R.D. Cell. 1989; 10: 801-813Abstract Full Text PDF Scopus (1315) Google Scholar). These effects result from BFA inhibition of GEP-catalyzed ARF activation (GTP binding) (19Donaldson J.G. Finazzi D. Klausner R.D. Nature. 1992; 360: 350-352Crossref PubMed Scopus (596) Google Scholar, 20Helms J.B. Rothman J.E. Nature. 1992; 360: 352-354Crossref PubMed Scopus (585) Google Scholar). The two major types of ARF GEPs differ in size and susceptibility to inhibition by BFA. Their Sec7 domains contain the determinants of GEP activity as well as its BFA sensitivity. The larger ∼200-kDa GEPs (e.g. Sec7, Gea1, and Gea2 from yeast) are inhibited by BFA, whereas those of the cytohesin family are BFA-insensitive, ∼50-kDa proteins. Morinaga et al. (21Morinaga N. Tsai S.-C. Moss J. Vaughan M. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 12856-12860Crossref PubMed Scopus (134) Google Scholar, 22Morinaga N. Moss J. Vaughan M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 12926-12931Crossref PubMed Scopus (83) Google Scholar) reported the purification and cloning of a BFA-inhibited ARF GEP from bovine brain, which was referred to as p200. We describe here the cloning from a human brain library of two GEP cDNAs. One, with a deduced amino acid sequence (1,849 residues) 99.5% identical to that of p200, probably represents the human form of p200. The other, encoding a 202-kDa protein 74% identical in sequence, is a new BFA-inhibited human GEP. We propose that because of their BFA sensitivity and size relative to the cytohesins, these mammalian ARF GEPs be named BIG1 (forBFA-inhibited GEP) and BIG2, respectively. [α-32P]dCTP, [γ-32P]dATP, and [35S]GTPγS were purchased from NEN Life Science Products. All restriction enzymes andTaq polymerase used to prepare BIG1-In and BIG2-In were purchased from Roche Molecular Biochemicals (formerly Boehringer Mannheim). Sources of other materials are noted below or have been reported (22Morinaga N. Moss J. Vaughan M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 12926-12931Crossref PubMed Scopus (83) Google Scholar). All plasmids were purified using Qiagen Plasmid Midi kits (Qiagen, Chatsworth, CA). An Applied Biosystems Inc. 373 DNA sequenator was used for sequencing. 500 ng of plasmid DNA, 3.2 pmol of primer, and 8 μl of Terminator Ready Reaction Mix (Perkin-Elmer) were used for cycle sequencing (25 cycles of 96 °C for 30 s, 50 °C for 15 s, and 60 °C for 4 min) in total volume of 20 μl. Probes for screening a human frontal cortex λ-ZAP cDNA library (1.2 × 106 plaque-forming units) (Stratagene) were prepared by PCR with bovine BIG1 cDNA (22Morinaga N. Moss J. Vaughan M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 12926-12931Crossref PubMed Scopus (83) Google Scholar) as template. Sequences were: nucleotides 306–762 (probe 1), 2086–2728 (probe 2), and 5207–5541 (probe 3). Prehybridization overnight at 42 °C in 10% dextran sulfate, 1% SDS, 50 mm Tris, pH 7.4, 0.5 m NaCl, and 30% formamide was followed by hybridization with 50 ng of radiolabeled probe (2 × 105 cpm/ml) in 100 ml of the same buffer overnight at 42 °C. Filters were then washed with 2 × SSC and 0.1% SDS at room temperature for 10 min twice and 1 × SSC and 0.1% SDS at 50 °C for 10 min. Two positive plaques were obtained with probe 1. The first contained bases 1–2487 of the BIG2 coding region named BIG2-N. (Base numbers are relative to A of ATG, equal to 1.) The other contained bases 1–420 of BIG1 (named BIG1-N). One plaque obtained with probe 2 contained bases 1738–4657 of BIG1 (named BIG1-C), and one with probe 3 (BIG2-C) contained bases 3514–5860 of BIG2. The sequence between BIG2-N and BIG2-C was obtained by a nested PCR. Primers for the first PCR (30 cycles of 94 °C for 1 min, 50 °C for 1 min, and 72 °C for 2 min) were BIG2-N bases 2359–2385 (forward) and 3655–3631 in BIG2-C (reverse), with 1 μl of human adrenal gland QUICK-Clone cDNA (CLONTECH) as template (total volume 100 μl). A sample (10 μl) of this PCR mixture was used as template in a nested PCR (30 cycles of 94 °C for 1 min, 52 °C for 1 min, and 72 °C for 2 min) with forward primer In-F (bases 2374–2402) and reverse primer In-R (bases 3593–3570). The single 1.2-kb product was subcloned in pCR2.1 (Invitrogen) to produce BIG2-In. Sequencing of the individual fragments generated a composite BIG2. The sequence between bases 421 and 1737 in BIG1 was obtained by an analogous procedure. Primers for the first PCR (30 cycles of 94 °C for 1 min, 55 °C for 1 min, and 72 °C for 2 min) were bases 275–299 in BIG1-N (forward) and 1886–1860 in BIG1-C (reverse). A sample (2 μl) of this PCR product was used as template in a nested PCR (30 cycles of 94 °C for 1 min, 52 °C for 1 min, and 72 °C for 2 min) with bases 300–329 (forward) and 1836–1811 (reverse) as primers. The 1.5-kb product was subcloned in pCR2.1 (named BIG1-In). Sequence of the 3′-terminus of the BIG1 cDNA was obtained by a rapid amplification of cDNA ends procedure using 2.5 units ofPfu DNA polymerase (Stratagene) and a Marathon Ready cDNA kit (CLONTECH), which included the DNA template and two reverse primers with adapters (AP-1 and AP-2). Gene-specific primers in BIG1-C were bases 4468–4491 (G-1, forward) and bases 4587–4611 (G-2, forward). In the first PCR (total volume 50 μl), 1 μl of template with G-1 and AP-1 was used for 30 cycles of 94 °C for 1 min, 68 °C for 1 min, and 72 °C for 3 min. 1 μl of this PCR mixture was used as template in the second PCR (total volume 50 μl) with G-2 and AP-2 for 30 cycles of 94 °C for 1 min, 65 °C for 1 min, and 72 °C for 3 min. The PCR product, which was purified using a QIAEX II gel extraction kit (Qiagen), was subcloned in pCR-Blunt (Invitrogen) and sequenced. Sequences of these cDNAs yielded a composite BIG1 sequence. For insertion of BIG2 into the baculovirus transfer vector pAcHLT-C (Pharmingen), restriction sites for NdeI and NotI were introduced, respectively, before the initiation and after the termination codons of BIG2. To insert the NdeI site, the forward primer was 5′-CATATGTATGCAGGAGAGCCAGACCAAG-3′ including theNdeI site (italics) and BIG2 initiation codon (underlined) with reverse primer (bases 298–274) and 500 ng of BIG2-N as template in a PCR (100 μl) with 5 units of Taq polymerase for 30 cycles of 94 °C for 30 s, 65 °C for 30 s, and 72 °C for 30 s. The 305-bp PCR product was subcloned into pCR-2.1 vector. The DNA excised from the purified plasmid withHindIII (site in pCR 2.1 vector) and NheI (base 219 of BIG2) was ligated to BIG2-N, which had been digested with the same enzymes, and named BIG2-Nde-Nhe. To ligate BIG2-Nde-Nhe and BIG2-In, BIG2-In (bases 2374–3593) was the DNA template with primers In-F and In-R and 2.5 units of PfuDNA polymerase (total volume 100 μl) for the first PCR (30 cycles of 94 °C for 1 min, 65 °C for 1 min, and 72 °C for 3 min). The 1.2-kb product (1.2-kb PCR) was purified using a QIAEXII gel extraction kit and eluted in 40 μl of distilled water. 1 μl of 1.2-kb PCR product and 500 ng of BIG2-N were used as templates in the second PCR (30 cycles of 94 °C for 1 min, 65 °C for 1 min, and 72 °C for 4 min) with Pfu DNA polymerase, forward primer (bases 1826–1848), and reverse primer In-R (total volume 100 μl). The 1.7-kb PCR (bases 1836–3593), which was purified using a QIAEXII gel extraction kit, was subcloned into pCR-Blunt vector. The plasmid DNA was digested with AatII (base 1849 of BIG2) andSpeI (site in pCR-Blunt vector). The excised DNA and the BIG2-Nde-Nhe, which had been digested with AatII andXbaI, were ligated and subcloned (named BIG2-Nde-Xba). To insert an NotI site after the termination codon, primers were BIG2 bases 3516–3540 (forward) and 5′-GCGGCCG CTACCACACTGGTG-3′ (reverse), which has an NotI site (italics) and the termination codon of BIG2 (underlined), with Pfu DNA polymerase (2.5 units) and 500 ng of BIG2-C as template in a volume of 100 μl for 30 cycles of 94 °C for 1 min, 65 °C for 1 min, and 72 °C for 4 min. The 1.8-kb PCR product was purified using a QIAEXII Gel Extraction kit and subcloned into pCR-Blunt vector (named BIG2-Not). BIG2-C (500 ng) and 1 μl of 1.2-kb PCR were used as templates for PCR (30 cycles of 94 °C/1 min, 60 °C/1 min, 72 °C/4 min) with primers In-F and bases 4249–4222 (reverse) in a total volume of 100 μl to obtain bases 2374–4249 (1.9 kb). The 1.9-kb PCR product was subcloned into pCR-Blunt vector (named BIG2-Nsi-ClaI) based on subsequent digestion with Nsi and ClaI. A 1.7-kbp DNA excised from BIG2-Not with ClaI and NotI was ligated to BIG2-Nsi-ClaI, which had been digested with ClaI (base 3791) and NotI (named BIG2-Nsi-Not). To construct the full-length BIG2 DNA, the 2.4-kb DNA, excised from BIG2-Nsi-Not with NsiI (base 2986 of BIG2) andNotI, was ligated to BIG2-Nde-Xba which had been digested with NsiI and NotI. The subcloned plasmid DNA was named BIG2-Full. BIG2-Full, excised withNdeI and NotI, was ligated to the baculovirus transfer vector pAcHLT-C with the His6 sequence encoded at its NH2 terminus. A sample (2 μg) and 0.5 μg of BaculoGold DNA (Pharmingen) were mixed with 2 × 106Sf9 cells in 3 ml of TNM-FH Insect medium (Pharmingen). After incubation at 27 °C for 5 days, a sample (10 μl) of the cell supernatant (Sup 1) was added to 1 × 105 Sf9 cells in 3 ml of medium followed by incubation for 5 days at 27 °C before the supernatant was collected (Sup 2). Sf9 cells (2 × 107) were added to 1 ml of Sup 2 and 30 ml of TNM-FH. After 5 days at 27 °C, cells were harvested by centrifugation, suspended in 1 ml of ice-cold 10 mm sodium phosphate (pH 8.0) and 100 mm NaCl containing 8 μg of benzamidine hydrochloride, 0.5 mm AEBSF, 5 μg of phenanthroline, 5 μg of aprotinin, and 5 μg of leupeptin, placed on ice for 45 min, and finally lysed by freezing and thawing twice. Clear lysate was separated from cellular debris by centrifugation (20,000 ×g, 15 min). The lysate (1 ml) was mixed with 0.3 ml of nickel-nitrilotriacetic acid agarose (Qiagen). After 1 h at 4 °C, the affinity matrix was washed five times with 1-ml portions of 5 mm imidazole and 50 mm sodium phosphate (pH 8.0) in 300 mm NaCl, 10% glycerol, and 0.5 mm AEBSF. Bound protein was eluted with 100 mmimidazole and 50 mm sodium phosphate (pH 6.0) in the same solution of 300 mm NaCl, 10% glycerol, and 0.5 mm AEBSF. The eluted protein was dialyzed against 20 mm Tris-HCl (pH 8.0), 1 mm EDTA, 1 mm NaN3, 1 mm dithiothreitol, 0.25m sucrose, 5 mm MgCl2, 0.5 mm AEBSF, and 30 mm NaCl overnight at 4 °C. Prehybridization and hybridization with a human Multiple Tissue Northern (MTN) (CLONTECH) were carried out according to the manufacturer's instructions. For prehybridization, ExpressHyb solution (CLONTECH) was used at 60 °C for 30 min. DNA probes, a 382-bp PCR product representing bases 121–502, in the 3′-untranslated region of BIG2 and a 467-bp PCR product corresponding to bases 715–1181 in the coding region of BIG1 were labeled with [α-32P]dCTP using a random primed DNA labeling kit (Roche Molecular Biochemicals). After hybridization, membranes were washed at room temperature with 2 × SSC and 0.05% SDS for 30 min, 2 × SSC and 0.1% SDS at 50 °C for 20 min, and 1 × SSC and 0.1% SDS at 50 °C for 10 min. For hybridization with glyceraldehyde-3-phosphate dehydrogenase mRNA, 20 pmol of oligonucleotide (ACACAAATTCGAAGCTAAATAAAGCCGAGAGCTGGTAGT) was labeled with [γ-32P]dATP using 10 units of polynucleotide kinase (Roche Molecular Biochemicals). 1.5 × 107 cpm of this or other labeled probe was used in 10 ml of ExpressHyb solution. Membranes were washed at room temperature in 2 × SSC and 0.05% SDS for 40 min 2 × SSC and 0.1% SDS at 42 °C for 15 min. Autoradiography film was exposed overnight at −80 °C. The NIGMS human/rodent somatic cell hybrid panel 2, version 3, containing DNA samples from human IMR-91 cells (NAIMR91), Chinese hamster RJK88 cells, and mouse 3T6 cells, was purchased from the Corielle Institute for Medical Research.Taq DNA polymerase (5 units) was used to prepare all DNA probes for chromosomal localizations. To construct the BIG1 probe, PCR R-1 was carried out with 2 μl of human/rodent hybrid cell genomic DNA as template, the forward primer 5′-CATTTACATCCCTCTGCTCTTT-3′ (which starts 24 bp downstream of the termination codon), and reverse primer 5′-TTTCTTCTTCTCTCCCCACTCC-3′ (which starts 425 bp downstream of the termination codon) for 30 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s (total volume 20 μl). An intron from BIG2 was amplified from 200 ng of human genomic DNA (CLONTECH), with forward primer CL2-A (bases 2359–2385) and reverse primer (bases 2591–2568), in a volume of 100 μl for 30 cycles of 94 °C for 1 min, 65 °C for 1 min, and 72 °C for 2 min. The single PCR product was sequenced to verify the presence of the 622-bp intron at position 2533 in the coding region and ligated into pCR2.1. Human/rodent hybrid cell genomic DNA (2 μl) was used as template in PCR R-2 (total volume 20 μl) with forward primer CL2-A and reverse primer 5′-ACTCCTAAATCCTCCCAACC-3′ (bases 533–514 of the intron) for 30 cycles of 94 °C for 1 min, 55 °C for 1 min, and 72 °C for 1 min. GEP stimulation of [35S]GTPγS binding to ARF was assayed using a rapid filtration procedure. Partially purified ARF (predominantly ARFs 1 and 3) was prepared from bovine brain cytosol (21Morinaga N. Tsai S.-C. Moss J. Vaughan M. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 12856-12860Crossref PubMed Scopus (134) Google Scholar). Assays, which were incubated for 20 min at 25 °C, contained 4 μm[35S]GTPγS (5 × 106 cpm), 20 mm Tris-HCl (pH 8.0), 1 mm dithiothreitol, 3 mm MgCl2, 1 mm EDTA, 50 μg of bovine serum albumin, and 10 μg of phosphatidylserine with ARF substrate and GEP preparation as indicated (final volume, 50 μl). Assays were terminated by transfer to nitrocellulose filters (Millipore Corp.) followed by six washes, each with 2 ml of ice-cold buffer containing 20 mm Tris-HCl (pH 8.0), 100 mmNaCl, 1 mm dithiothreitol, 1 mm EDTA, and 3 mm MgCl2. Filters were dissolved in scintillation fluid for radioassay. Data presented are means ± S.E. of values from triplicate determinations. BIG2 was initially purified as part of a macromolecular complex of ∼670 kDa from bovine brain. After separation of complex components by SDS-polyacrylamide gel electrophoresis, proteins of ∼200 (p200) and 190 kDa exhibited BFA-inhibited ARF GEP activity (22Morinaga N. Moss J. Vaughan M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 12926-12931Crossref PubMed Scopus (83) Google Scholar). Sequences of peptides from p200 were used as the basis for cloning the bovine cDNA for BIG1. Cloning of human BIG1 and BIG2 cDNAs is described under "Experimental Procedures." The cDNA for human BIG2 encodes a protein of 1,785 amino acids with a calculated molecular weight of 202,000. Both human and bovine BIG1 are somewhat larger with 1,849 amino acids and molecular weights of 209,000. Sequences of nine peptides produced by tryptic digestion of the p190 that had been purified from bovine brain (22Morinaga N. Moss J. Vaughan M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 12926-12931Crossref PubMed Scopus (83) Google Scholar) are included in the deduced amino acid sequence of BIG2 (TableI). Seven are identical. In peptide 2 (19 amino acids), a phenylalanine in the human clone is tyrosine in the bovine, and in peptide 8 (9 amino acids), an alanine in the bovine sequence is proline in the human. Both differences are considered conservative. Peptides 2 and 3 are from the Sec7 domains.Table IAmino acid sequence of nine peptides from BIG2PeptideSequencePosition1LIAYGHITGNAPDSGAPGK94–1122QFLQEQGMLGTSVEDIAQF663–681Y3PEEYLSSIYE811–8204RYLSGSGR1012–10195ELANFRFQ1173–11806DFLRPFEHIMK1182–11927HLDVDLDRQSLSSIDK1502–15178NPSERGQSQ1518–1526A9NYEQRTVL1631–1638Shown is the deduced sequence from the human brain BIG2 cDNA. Below peptides 2 and 8 are shown only those amino acids that differ in the tryptic peptides from purified bovine brain BIG2 (22Morinaga N. Moss J. Vaughan M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 12926-12931Crossref PubMed Scopus (83) Google Scholar). Open table in a new tab Shown is the deduced sequence from the human brain BIG2 cDNA. Below peptides 2 and 8 are shown only those amino acids that differ in the tryptic peptides from purified bovine brain BIG2 (22Morinaga N. Moss J. Vaughan M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 12926-12931Crossref PubMed Scopus (83) Google Scholar). The deduced amino acid sequence of human BIG2 is aligned with those of human and bovine BIG1 in Fig. 1. BIG2, which is overall 74% identical to human BIG1, is 90% identical in the 190 amino acids of the Sec7 domain (Fig.2). The BIG2 Sec7 domain is only ∼50% identical to the Sec7 domains of the BFA-insensitive cytohesins B2-1, ARNO, and GRP1 (which are themselves 85–90% identical), slightly less so to those from yeast Sec7 and EMB30, and only 34% identical to the Sec7 sequence from yeast Gea1 (Table II). Outside of the Sec7 domain, BIG1 and BIG2 have other large regions of >70% identity, much greater overall similarity than, for example, to the yeast Sec7 itself (Fig. 3).Figure 2Alignment of deduced amino acid sequences of Sec7 domains of ARF GEPs. The amino acid sequences are presented as in Fig. 1 for hBIG2, hBIG1, ySec7 (14Achstetter T. Franzusoff A. Field C. Schekman R. J. Biol. Chem. 1988; 263: 11711-11717Abstract Full Text PDF PubMed Google Scholar), EMB30 (12Telemenakis I. Benseler F. Stenius K. Südhof T.C. Brose N. Eur. J. Cell. Biol. 1997; 74: 143-149PubMed Google Scholar), yGea1 (8Peyroche A. Paris S. Jackson C.L. Nature. 1996; 384: 479-481Crossref PubMed Scopus (236) Google Scholar), hB2-1 (9Liu L. Pohajdak B. Biochim. Biophys. Acta. 1992; 1132: 75-78Crossref PubMed Scopus (64) Google Scholar), hARNO (10Chardin P. Paris S. Antonny B. Robineau S. Béraud-Dufour S. Jackson C.L. Chabre M. Nature. 1996; 384: 481-484Crossref PubMed Scopus (409) Google Scholar), and mGRP1 (11Klarlund J.K. Guilherme A. Holik J.J. Virbasius J.V. Chawla A. Czech M.P. Science. 1997; 275: 1927-1930Crossref PubMed Scopus (372) Google Scholar). Alignments were produced by GeneWorks 2.5.1 and adjusted by inspection.View Large Image Figure ViewerDownload (PPT)Table IIPercentage identity and similarity of amino acid sequences of Sec7 domains of nine proteins with ARF GEP activityEMB30hBIG2hBIG1bBIG1ySec7EMB30GealB2–1GRP1ARNOhBIG2—9089464234515147hBIG195—99474235515047bBIG19499—474234514947ySec7676968—4334464546EMB3060616061—31454442Gea14848485444—323130B2–1676870676349—9087GRP167676666644794—85ARNO6466666964489695—Percentage identities are shown above and similarities below the diagonal. A, G. P, S, T/I, L, M, V/H, K, R/F, W, Y/D, E, N, Q were considered as conservative differences for calculation of similarity. References for sequences are in the legend for Fig. 2. Open table in a new tab Figure 3Percentage identity of amino acid sequences of hBIG2 and hBIG1 or ySec7. Residue numbers follow the name of each protein with arrows indicating Sec7 domains. The percentage of identical amino acids is recorded in each segment of the diagram and the range indicated with shading from >90% identity (black) to <20% (white). With the exception of the Sec7 domains, divisions were arranged to maximize identity of hBIG2 with hBIG1 (above) or ySec7 (below), thereby accounting for the differences in segmentation of the two proteins. Alignments were produced by GeneWorks 2.5.1. The Clustal program and the following parameters were used: cost to open a gap = 5, cost to lengthen a gap = 5, gap penalty = 3, number of top diagonals = 5, window size = 5, PAM matrix = Identity, k-tuple size = 1, consensus cutoff = 50%.View Large Image Figure ViewerDownload (PPT) Percentage identities are shown above and similarities below the diagonal. A, G. P, S, T/I, L, M, V/H, K, R/F, W, Y/D, E, N, Q were considered as conservative differences for calculation of similarity. References for sequences are in the legend for Fig. 2. On Northern blots with poly(A)+ RNA from six human tissues (Fig.4), a single 7.5-kb band hybridized with BIG1 cDNA; a 9.4-kb transcript hybridized with the BIG2 probe. When quantified by densitometry and expressed as a fraction of the density of the corresponding glyceraldehyde-3-phosphate dehydrogenase mRNA, BIG1 mRNA in placenta and lung was considerably more abundant than it was in heart, brain, kidney, or pancreas. The amounts of BIG2 mRNA were relatively similar in all of those tissues. The BIG1 cDNA hybridized clearly with a single band (400 bp) from chromosome 8 (data not shown) and with a band of the same size in the lane containing NAIMR91 DNA (positive control). The BIG2 probe hybridized with a 700-bp band from chromosome 20, which was also present in the total human DNA (data not shown). No hybridization with DNA from other chromosomes was detected. To demonstrate the GEP activity of BIG2, it was synthesized as a His6 fusion protein in Sf9 cells. After purification on nickel-nitrilotriacetic a