Portal de Periódicos da CAPES

X-gene Product of Hepatitis B Virus Induces Apoptosis in Liver Cells

1998; Elsevier BV; Volume: 273; Issue: 1 Linguagem: Inglês

10.1074/jbc.273.1.381

1083-351X

Hongtae Kim, Hyun‐Sook Lee, Yungdae Yun,

Cell death mechanisms and regulation

Hepatitis B virus is a causative agent of hepatocellular carcinoma, and in the course of tumorigenesis, the X-gene product (HBx) is known to play important roles. Here, we investigated the transforming potential of HBx by conventional focus formation assay in NIH3T3 cells. Cells were cotransfected with the HBx expression plasmid along with other oncogenes including Ha-ras, v-src, v-myc, v-fos, and E1a. Unexpectedly, the introduction of HBx completely abrogated the focus-forming ability of all five tested oncogenes. In addition, the cotransfection of Bcl-2, an apoptosis inhibitor, reversed the HBx-mediated inhibition of focus formation, suggesting that the observed repression of focus formation by HBx is through the induction of apoptosis. Next, to test unequivocally whether HBx induces apoptosis in liver cells, we established stable Chang liver cell lines expressing HBx under the control of a tetracycline-inducible promoter. Induction of HBx in these cells in the presence of 1% calf serum resulted in typical apoptosis phenomena such as DNA fragmentation, nuclear condensation, and fragmentation. Based on these results, we propose that HBx sensitizes liver cells to apoptosis upon hepatitis B virus infection, contributing to the development of hepatitis and the subsequent generation of hepatocellular carcinoma. Hepatitis B virus is a causative agent of hepatocellular carcinoma, and in the course of tumorigenesis, the X-gene product (HBx) is known to play important roles. Here, we investigated the transforming potential of HBx by conventional focus formation assay in NIH3T3 cells. Cells were cotransfected with the HBx expression plasmid along with other oncogenes including Ha-ras, v-src, v-myc, v-fos, and E1a. Unexpectedly, the introduction of HBx completely abrogated the focus-forming ability of all five tested oncogenes. In addition, the cotransfection of Bcl-2, an apoptosis inhibitor, reversed the HBx-mediated inhibition of focus formation, suggesting that the observed repression of focus formation by HBx is through the induction of apoptosis. Next, to test unequivocally whether HBx induces apoptosis in liver cells, we established stable Chang liver cell lines expressing HBx under the control of a tetracycline-inducible promoter. Induction of HBx in these cells in the presence of 1% calf serum resulted in typical apoptosis phenomena such as DNA fragmentation, nuclear condensation, and fragmentation. Based on these results, we propose that HBx sensitizes liver cells to apoptosis upon hepatitis B virus infection, contributing to the development of hepatitis and the subsequent generation of hepatocellular carcinoma. Hepatitis B virus is a small DNA virus with a 3.2-kilobase partially double-stranded DNA genome and is a causative agent of acute and chronic hepatitis (1Ganem D. Varmus H.E. Annu. Rev. Biochem. 1987; 56: 651-693Crossref PubMed Scopus (821) Google Scholar). Through epidemiological studies, chronic hepatitis B virus infection has been linked to the high incidence of hepatocellular carcinoma (HCC) 1The abbreviations used are: HCC, hepatocellular carcinoma; DMEM, Dulbecco's modified Eagle's medium; PBS, phosphate-buffered saline. generation (2Beasly R.P. Lin C.-C. Hwang L.Y. Chen C.-S. Lancet. 1981; ii: 1129-1133Abstract Scopus (417) Google Scholar). Among the four proteins translated from the hepatitis B virus genome, the X-gene product (HBx) has drawn much attention for its role as a transacting factor for exploitation of the host cell machinery. Up to now, several significant discoveries have been made regarding the functions of HBx, and from these studies, HBx was established as essential in viral replication, HCC, and the activation of certain signal transduction pathways (3Rossner M.T. J. Med. Virol. 1992; 36: 101-117Crossref PubMed Scopus (192) Google Scholar, 4Cromlish J.A. Trends Microbiol. 1996; 4: 270-274Abstract Full Text PDF PubMed Scopus (46) Google Scholar). Although there is a controversy about the role of HBx in viral replication, the X-gene product was shown to be required for the replication of woodchuck hepatitis virus in animal studies, which are considered to reflect the in vivo phenomenon more precisely (5Chen H.S. Kaneko S. Girones R. Anderson R.W. Hornbuckle W.E. Tennant B.C. Cote P.J. Gerin J.L. Purcell R.H. Miller R.H. J. Virol. 1993; 67: 1218-1226Crossref PubMed Google Scholar, 6Zoulim F. Saputelli J. Seeger C. J. Virol. 1994; 68: 2026-2030Crossref PubMed Google Scholar). A similar conclusion was drawn by us in a transfection-based replication assay (7Lee H. Lee Y.-H. Huh Y.-S. Moon H. Yun Y. J. Biol. Chem. 1995; 270: 31405-31412Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar). Generally, it is believed that HBx contributes to the generation of hepatocellular carcinoma. HBx was reported to induce transformation of NIH3T3 cells (8Shirakata Y. Kawada M. Fujiki Y. Sano H. Oda M. Yaginuma K. Kobayashi M. Koike K. Jpn. J. Cancer Res. 1989; 80: 617-621Crossref PubMed Scopus (168) Google Scholar). Furthermore, the development of HCC was observed in HBx transgenic liver (9Kim C.-M. Koike K. Saito I. Miyamura T. Jay G. Nature. 1991; 351: 317-320Crossref PubMed Scopus (1056) Google Scholar). A possible mechanism of HBx-mediated HCC is the disruption of p53 function as a tumor suppressor. There are several reports describing the direct association between HBx and p53 (7Lee H. Lee Y.-H. Huh Y.-S. Moon H. Yun Y. J. Biol. Chem. 1995; 270: 31405-31412Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar,10Feitelson M.A. Zhu M. Duan L.-X. London W.T. Oncogene. 1993; 8: 1109-1117PubMed Google Scholar, 11Wang X.W. Forrester K. Yeh H. Feitelson M.A. Gu J.-R. Harris C.C. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 2230-2234Crossref PubMed Scopus (637) Google Scholar, 12Truant R. Antunovic J. Greenblatt J. Prives C. Cromlish J.A. J. Virol. 1995; 69: 1851-1859Crossref PubMed Google Scholar). Such interaction presumably suppresses p53 function in G1 cell cycle arrest. The other possible mechanism is based on the ability of HBx to activate cellular signal transduction pathways. HBx stimulates theras/raf/mitogen-activated protein kinase cascade, leading to the activation of AP-1-dependent transcriptional activation (13Benn J. Schneider R.J. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 10350-10354Crossref PubMed Scopus (404) Google Scholar, 14Natoli G. Avantaggiati M.L. Chirillo P. Costanzo A. Artini M. Balsano C. Levrero M. Mol. Cell. Biol. 1994; 14: 989-998Crossref PubMed Scopus (125) Google Scholar). In addition, c-Jun N-terminal kinase (15Benn J. Su F. Doria M. Schneider R.J. J. Virol. 1996; 70: 4978-4985Crossref PubMed Google Scholar) and NF-κB (16Su F. Schneider R.J. J. Virol. 1996; 70: 4558-4566Crossref PubMed Google Scholar, 17Chirillo P. Falco M. Puri P.L. Artini M. Balsano C. Levrero M. Natoli G. J. Virol. 1996; 70: 641-646Crossref PubMed Google Scholar) were shown to be activated by HBx. Probably, through the combined actions of the mechanisms listed above, HBx contributes to tumorigenesis. In fact, HBx has been shown to deregulate the cell cycle check point controls through the activation of ras (18Benn J. Schneider R.J. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 11215-11219Crossref PubMed Scopus (266) Google Scholar). It seems that most animal viruses have evolved strategies to block and/or induce apoptosis depending on the cellular environment (19Teodoro J.G. Branton P.E. J. Virol. 1997; 71: 1739-1746Crossref PubMed Google Scholar). The representative examples of the viral transactivators inducing apoptosis include E1a of adenovirus (20Lowe S.W. Ruley H.E. Genes Dev. 1993; 7: 535-545Crossref PubMed Scopus (613) Google Scholar, 21Debbas M. White E. Genes Dev. 1993; 7: 546-554Crossref PubMed Scopus (836) Google Scholar), Tax of human T-cell leukemia virus (22Yamada T. Yamaoka S. Goto T. Nakai M. Tsujimoto Y. Hatanaka M. J. Virol. 1994; 68: 3374-3379Crossref PubMed Google Scholar), and Tat of human immunodeficiency virus (23Li C.J. Friedman D.J. Wang C. Metelew V. Pardel A.B. Science. 1995; 268: 429-431Crossref PubMed Scopus (549) Google Scholar). On the other hand, other viral transactivators such as E1b of adenovirus (21Debbas M. White E. Genes Dev. 1993; 7: 546-554Crossref PubMed Scopus (836) Google Scholar, 24Rao L. Debbas M. Sabbatini P. Hockenbery D. Korsmeyer S. White E. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 7742-7746Crossref PubMed Scopus (659) Google Scholar) and IE1 and IE2 of cytomegalovirus (25Zhu H. Shen Y. Shenk T. J. Virol. 1995; 69: 7960-7970Crossref PubMed Google Scholar) were shown to have the ability to block apoptosis. As for hepatitis B virus, HBx was shown to block the apoptosis induced by the overexpression of p53 (26Wang X.W. Gibson M.K. Vermeulen W. Yeh H. Forrester K. Stüzbecher H.-W. Hoeijmakers J.H.J. Harris C.C. Cancer Res. 1995; 55: 6012-6016PubMed Google Scholar). Notably, as exemplified by E1a/E1b of adenovirus (20Lowe S.W. Ruley H.E. Genes Dev. 1993; 7: 535-545Crossref PubMed Scopus (613) Google Scholar, 21Debbas M. White E. Genes Dev. 1993; 7: 546-554Crossref PubMed Scopus (836) Google Scholar, 25Zhu H. Shen Y. Shenk T. J. Virol. 1995; 69: 7960-7970Crossref PubMed Google Scholar) or T-antigen of SV40 (27Fromm L. Shawlot W. Gunning K. Butel J.S. Overbeek P.A. Mol. Cell. Biol. 1994; 14: 6743-6754Crossref PubMed Scopus (96) Google Scholar, 28McCarthy S.A. Symonds H.S. Dyke T.V. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 3979-3983Crossref PubMed Scopus (112) Google Scholar), viral gene products from the same virus may either block or induce apoptosis. During the study of the HBx-mediated transformation process, we found that HBx sensitizes/induces apoptosis in liver cells. This observation may provide a pathogenic mechanism of hepatitis B virus-related hepatitis and subsequent hepatocellular carcinoma generation. The expression plasmid of HBx and internal deletion mutants pcDNA-X, Xdel-1, and Xdel-2 were described previously (7Lee H. Lee Y.-H. Huh Y.-S. Moon H. Yun Y. J. Biol. Chem. 1995; 270: 31405-31412Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar). The plasmids employed for transformation assay, pMT13S (29Zerler B. Moran B. Maruyama K. Moomaw J. Grodzicker T. Ruley H.E. Mol. Cell. Biol. 1986; 6: 887-899Crossref PubMed Scopus (90) Google Scholar), pEJ (30Newbold R.F. Overell R.W. Nature. 1983; 304: 648-651Crossref PubMed Scopus (323) Google Scholar), pMC29 (31Heaney M.L. Pierce J. Parsons J.T. J. Virol. 1986; 60: 167-176Crossref PubMed Google Scholar), pFBJ/R (32Miller A.D. Verma I.M. Curran T. J. Virol. 1985; 55: 521-526Crossref PubMed Google Scholar), and pcDNAv-src, encode the E1a 13 S gene product, Ha-ras, v-myc, v-fos, and v-src, respectively, and have been described. The human Bcl-2 expression plasmid has been described (33Borzillo G.V. Endo K. Tsujimoto Y. Oncogene. 1992; 7: 869-876PubMed Google Scholar). The parental plamids for the construction of the tetracycline-inducible cassette, pUHD10-3 and pUHD172-1, were developed by Gossen et al. (34Gossen M. Freundlieb S. Bender G. Müler G. Hillen W. Bujard H. Science. 1995; 268: 1766-1769Crossref PubMed Scopus (2051) Google Scholar). pTet-X was obtained by polymerase chain reaction using TAATACGACTCACTATAGGG as a 5′-primer and GCTCAGAATTCTTAGCTAGCGTAATCTGGAACATCGTATGGGTATTCGGCAGAGGTGAAAAAGTTG as a 3′-primer with pcDNA-X as a template. The underlined sequences denote the EcoRI site introduced for the facilitation of subcloning and the sequence encoding the hemagglutinin tag, respectively. After HindIII/EcoRI digestion, the polymerase chain reaction product obtained was inserted into pcDNA1 (Invitrogen), yielding the plasmid pcDNA-HBx-HA. Subsequently, a KpnI/XbaI fragment from pcDNA-HBx-HA was subcloned into pUC18, yielding the plasmid pUC18-HBx-HA, followed by the transfer of an EcoRI fragment into the pUHD10-3 plasmid. NIH3T3 cells were plated in DMEM containing 10% calf serum at a density of 3 × 105cells/35-mm plate. Sixteen h later, the cells were transfected using the lipofection technique with 1 μg of each of the indicated expression plasmids along with 0.4 μg of pSV2neo. A total amount of transfected DNA was kept constant using the pUC19 plasmid DNA as a carrier. At 48 h post-transfection, the cells were split at a 2:1 ratio and cultured in the presence of 400 μg/ml G418. After the indicated days in selective medium, the cells were fixed in a PBS solution containing 0.2% glutaraldehyde and 0.5% formaldehyde for 10 min on ice and stained with 0.2% crystal violet for 10 min at room temperature, and the number of foci was counted. The experiments were performed in duplicate and at least twice. Chang liver cells were obtained from American Type Culture Collection (passage 259), and all experiments were performed using cells of <15 passages from the original stock. Chang liver cells were cultured in DMEM containing 10% calf serum and cotransfected with pTet-X and pUHD172-1 using the lipofection technique. At 48 h post-transfection, cells were split at a 10:1 ratio and cultured in the presence of 400 μg/ml G418. After 21 days in selective medium, individual G418-resistant colonies were isolated. For the detection of HBx protein, polyclonal rabbit antiserum was raised against a synthetic peptide corresponding to residues 144–154 of HBx that was previously shown to be immunogenic (35Morianity A.M. Alexander H. Lerner R.A. Science. 1985; 227: 429-433Crossref PubMed Scopus (123) Google Scholar). The sequence of the peptide was SPAPCNFFTSA, and the peptide was conjugated to keyhole limpet hemocyanin for immunization. The polyclonal anti-p53 antiserum was raised against glutathione S-transferase-p53 protein purified from Escherichia coli and has been described (7Lee H. Lee Y.-H. Huh Y.-S. Moon H. Yun Y. J. Biol. Chem. 1995; 270: 31405-31412Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar). For p21 wafI/cipI, a monoclonal antibody (Upstate Biotechnology, Inc.) was employed. Western blot analysis was performed using the enhanced chemiluminescence system (Amersham Corp.) based on the manufacturer's protocol. Cells (3 × 104) were plated in DMEM containing 10% calf serum in 35-mm dishes. Twenty-four h later, 0, 2, or 5 μg/ml doxycycline was added to each dish containing DMEM supplemented with 1% calf serum. After an additional incubation for 72 h, the cells were harvested and washed once with PBS. The cell pellets were resuspended in 0.1 ml of lysis buffer (10 mm Tris-HCl, pH 7.5, 1 mmEDTA, and 0.2% Triton X-100), vortexed, and incubated for 20 min on ice. After centrifugation at 12,000 rpm for 10 min, DNA was precipitated from the supernatants by the addition of 0.1 volume of 5.0m NaCl and 0.5 volume of isopropyl alcohol. Following storage at −20 °C, the samples were centrifuged at 12,000 rpm for 10 min. The resulting pellets were resuspended in 50 μl of Tris/EDTA buffer containing proteinase K (300 μg/ml) and RNase A (100 μg/ml) and incubated for 30 min at 50 °C. The samples were electrophoresed through a 1.5% agarose gel in 0.5 × Tris borate/EDTA buffer. Chang liver and HBx-expressing stable Chang liver cells (3 × 102) were plated in DMEM containing 10% calf serum in a 7-mm chamber slide. Twenty-four h later, 0, 2, 5, or 7 μg/ml doxycycline was added to each chamber containing DMEM supplemented with 1% calf serum. After an additional incubation for 48 h, cells were washed with PBS, fixed in 0.5% formaldehyde for 10 min on ice, and permeated by 100% methanol treatment at room temperature. Subsequently, the slides were stained with 2 μg/ml Hoechst 33258 in PBS at 37 °C for 1 h, washed with PBS, and visualized under a fluorescent UV microscope. Chang liver or HepG2 cells were maintained in DMEM supplemented with 10% calf serum or 10% fetal bovine serum, respectively. For induction of p53 and p21, the cells were treated with the chemotherapeutic agent doxorubicin at a concentration of 0.4 or 1.0 μg/ml. After the indicated times, the cells were harvested and subjected to Western analysis. To investigate the transforming potential of HBx, the HBx expression plasmid pcDNA-X was transfected into NIH3T3 cells alone or together with the Ha-ras expression plasmid pEJ (TableI, part A). No foci were observed upon expression of HBx alone, whereas the expected focus formation was detected upon expression of Ha-ras. Unexpectedly, the coexpression of HBx and Ha-ras resulted in the abrogation of Ha-ras-induced focus formation, suggesting that HBx somehow interfered with the transforming potential of Ha-ras. The observed effect was specific for wild-type HBx, as two deletion mutants of HBx (Xdel-1 and Xdel-2) were not able to disrupt focus formation (Table I, part B). As a control, we cotransfected the adenovirus E1a 13 S expression plasmid (pMT13S) along with pEJ. E1a and Ha-rasacted cooperatively as expected, and an increased number of foci were observed, confirming that the abrogation of the Ha-ras-induced foci by HBx is a specific nature of HBx.Table IFocus formation assay after transfection of NIH3T3 cells with hbx ± Ha-ras expression plasmidsTransfected genesNumber of foci9 days1-aDays after selection with G418.12 days16 days19 daysA. neo0014 hbx + neo0013 Ha-ras + neo442030 hbx + Ha-ras +neo0037 E1a + Ha-ras + neo9304751Transfected genesNumber of foci11 days14 daysB. neo00 Ha-ras + neo1925 hbx + Ha-ras +neo13 Xdel1 + Ha-ras + neo713 Xdel2 + Ha-ras +neo19211-a Days after selection with G418. Open table in a new tab Next, we examined whether the disruption of focus formation by HBx was restricted to the Ha-ras case or could be extended to other oncogenes. We cotransfected pcDNA-X along with five different expression plasmids, pMC29, pFBJ/R, pcDNAv-src, pMT13S, and pEJ, each encoding v-myc, v-fos, v-src, E1a, and Ha-ras, respectively (Fig. 1). Each of these oncogenes induced a fair number of foci, and the coexpression of HBx resulted in the abrogation of focus formation by all five tested oncogenes (Fig. 1 and TableII). Therefore, the ability of HBx to mediate disruption of focus formation seems to be a general property of HBx regardless of the type of partner oncogenes tested.Table IIFocus formation assay after transfection of NIH3T3 cells with hbx plus five different oncogenes including Ha-ras, v-fos, v-src, v-myc, and E1aTransfected gene selectionNumber of foci11 days2-aDays after selection with G418.13 daysneo00v-fos +neo1632hbx + v-fos +neo04v-src +neo712hbx + v-src +neo02Ha-ras +neo2636hbx + Ha-ras +neo01E1a + neo918hbx + E1a + neo14v-myc + neo48hbx + v-myc + neo02E1a + Ha-ras+ neo36632-a Days after selection with G418. Open table in a new tab Insomuch as many viral transactivators were reported to induce apoptosis depending on the environment (20Lowe S.W. Ruley H.E. Genes Dev. 1993; 7: 535-545Crossref PubMed Scopus (613) Google Scholar, 22Yamada T. Yamaoka S. Goto T. Nakai M. Tsujimoto Y. Hatanaka M. J. Virol. 1994; 68: 3374-3379Crossref PubMed Google Scholar, 23Li C.J. Friedman D.J. Wang C. Metelew V. Pardel A.B. Science. 1995; 268: 429-431Crossref PubMed Scopus (549) Google Scholar), we tested whether the observed inhibition of focus formation by HBx was mediated through the induction of apoptosis. For this purpose, we employed the Bcl-2 protein with an established anti-apoptotic property (22Yamada T. Yamaoka S. Goto T. Nakai M. Tsujimoto Y. Hatanaka M. J. Virol. 1994; 68: 3374-3379Crossref PubMed Google Scholar, 24Rao L. Debbas M. Sabbatini P. Hockenbery D. Korsmeyer S. White E. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 7742-7746Crossref PubMed Scopus (659) Google Scholar). When Bcl-2 was coexpressed with HBx and Ha-ras, we observed the partial rescue of focus formation (TableIII). Specifically, 13 days after selection with G418 (400 μg/ml), the coexpression of Bcl-2 with HBx plus Ha-ras resulted in the rescue of 12 foci, compared with 22 foci when Ha-ras was expressed alone. Therefore, more than half of the foci were rescued upon coexpression of Bcl-2. These results suggest that the HBx-induced abrogation of focus formation is probably mediated through the induction of apoptosis.Table IIIEffect of Bcl-2 (anti-apoptotic protein) on the HBx-mediated inhibition of focus formationTransfected genesNumber of foci11 days3-aDays after selection with G418.13 daysneo00Ha-ras +neo1822bcl-2 +neo11hbx + Ha-ras +neo23hbx + Ha-ras +bcl-2 + neo512E1a + Ha-ras + neo21323-a Days after selection with G418. Open table in a new tab Next, to confirm the possibility that HBx possesses an ability to induce apoptosis, we established cell lines expressing HBx in a tetracycline-inducible manner. For this purpose, we constructed an HBx expression plasmid named pTet-X employing the system developed by Gossen et al. (34Gossen M. Freundlieb S. Bender G. Müler G. Hillen W. Bujard H. Science. 1995; 268: 1766-1769Crossref PubMed Scopus (2051) Google Scholar) (Fig.2 A). In pTet-X, the expression of HBx was under the control of the tetracycline-inducible promoter, and HBx was tagged with hemagglutinin at the carboxyl terminus. pTet-X was transfected into Chang liver cells along with pUHD172-1, which encodes a mutated tetracycline repressor and a G418-resistant marker (34Gossen M. Freundlieb S. Bender G. Müler G. Hillen W. Bujard H. Science. 1995; 268: 1766-1769Crossref PubMed Scopus (2051) Google Scholar). After selection of the G418-resistant colonies, the inducible expression of HBx was confirmed by Western analysis using the antiserum raised against the synthetic peptide corresponding to amino acids 144–154 of HBx. As shown in Fig. 2 B, the treatment of two established cell lines (CLX1 and CLX2) with 5 μg/ml doxycycline resulted in the induction of HBx bands in Western analysis. Therefore, these two cell lines were routinely employed for the rest of the apoptosis experiments. Of note is the fact that the expression level of HBx in these cell lines decreased rapidly, and after passage 15, HBx expression was barely detectable by Western analysis (data not shown). This observation suggests that even with the tetracycline-inducible promoter, a leaky low level of HBx expression is sustained, which imparts enough toxicity to select out the HBx-expressing cells in a long-term culture. Therefore, the subsequently described apoptosis assays were performed with CLX1 and CLX2 cells of <10 passages. To test whether HBx really induces apoptosis, DNA fragmentation and nuclear condensation were assayed upon HBx expression. To assay for DNA fragmentation, the parental Chang liver cells and two HBx-expressing stable clones were employed. In DMEM supplemented with 1% calf serum, 0, 2, or 5 μg/ml doxycycline was added to induce HBx expression. Seventy-two h later, DNA was extracted from the harvested cells and run on an agarose gel (Fig. 3). No sign of DNA fragmentation was observed with control Chang liver cells, whereas typical DNA ladders were detected with CLX1 and CLX2 when 2 and 5 μg/ml doxycycline were added to the medium. The amount of fragmented DNA increased in a doxycycline dose-dependent manner. Next, the effects of HBx on nuclear condensation were assayed. Forty-eight h after doxycycline treatment, the cells were fixed and stained with Hoechst 33258 (Fig. 4). Again, no signs of nuclear condensation were observed with control Chang liver cells at any concentration of doxycycline, whereas with CLX1, nuclear condensation was evident at 2 μg/ml doxycycline. The same result was observed with CLX2 (data not shown). From these results, we conclude that HBx possesses the ability to induce apoptosis.Figure 4Nuclear condensation and fragmentation are observed upon induction of HBx in stable Chang liver cells.Control Chang liver cells (left panels) and HBx-expressing stable cells (CLX1) (right panels) were incubated in DMEM supplemented with 1% calf serum in the presence of 0, 2, 5, or 7 μg/ml doxycycline. Forty-eight h later, the cells were stained with Hoechst 33258. Nuclear condensation and fragmentation are evident with CLX1 cells treated with 2, 5, or 7 μg/ml doxycycline. Dox, doxycycline. The numbers represent the concentration of doxycycline in μg/ml.View Large Image Figure ViewerDownload Hi-res image Download (PPT) We studied the p53 status in Chang liver cells insomuch as viral transactivators may induce apoptosis in either a p53-dependent or p53-independent manner. Upon doxorubicin treatment, wild-type p53 is known to accumulate and participate in the cellular response to DNA damage (36Puisieux A. Ji J. Guillot C. Legros Y. Soussi T. Isselbacher K. Ozturk M. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 1342-1346Crossref PubMed Scopus (49) Google Scholar). As a control, the HepG2 cell line was employed since p53 in this cell line was reported as a wild type (36Puisieux A. Ji J. Guillot C. Legros Y. Soussi T. Isselbacher K. Ozturk M. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 1342-1346Crossref PubMed Scopus (49) Google Scholar). As shown in Fig.5 A, the basal p53 level was low, and upon treatment with doxorubicin, p53 began to accumulate and reached the maximal level after 24 h in both cell lines. Accompanying the accumulation of p53, the induction of p21 wafI/cipI was observed upon doxorubicin treatment (Fig.5 B). These results suggest that p53 is a wild type in Chang liver cells. In this report, we have shown that HBx possesses an ability to induce apoptosis using two different criteria. First, HBx disrupted focus formation by other oncogenes in NIH3T3 cells, which is blocked by the anti-apoptotic protein Bcl-2. Second, the induction of HBx in Chang liver cells in the presence of 1% serum resulted in typical apoptosis phenomena such as DNA fragmentation and nuclear condensation. The experimental results reported here differ from the previous ones in two aspects. The first point of discrepancy is observed in the ability of HBx to transform NIH3T3 cells. Previously, Shirakata et al. (8Shirakata Y. Kawada M. Fujiki Y. Sano H. Oda M. Yaginuma K. Kobayashi M. Koike K. Jpn. J. Cancer Res. 1989; 80: 617-621Crossref PubMed Scopus (168) Google Scholar) reported that the expression of HBx led to the stimulation of growth of drug-resistant colonies and tumor formation in nude mice. In our case, even though the assay was different, HBx alone did not induce any focus formation, but rather abrogated focus formation by other oncogenes. The reason for the difference is not clear at this stage. Perhaps, the expression of HBx alone is sufficient for the stimulation of cell growth, but is not a strong enough stimulus for the formation of foci, and the cell cycle perturbation caused by the coexpression of other oncogenes revealed the otherwise latent apoptosis-inducing ability of HBx. At any rate, disruption of focus formation is a unique property of HBx in that the coexpression of E1a with Ha-ras resulted in cooperative focus formation in the same experiment. With regard to the second point of discrepancy, in contrast to our finding, Wang et al. (26Wang X.W. Gibson M.K. Vermeulen W. Yeh H. Forrester K. Stüzbecher H.-W. Hoeijmakers J.H.J. Harris C.C. Cancer Res. 1995; 55: 6012-6016PubMed Google Scholar) showed that the microinjection of an HBx expression plasmid blocks the apoptosis induced by the overexpression of p53 in primary fibroblasts. Possibly, the discrepancy originated from a different cellular environment in which the apoptosis was assayed since the induction of apoptosis is determined by the combined effects of external stimulus and the physiology of the cell. Recent reports suggest that the normal physiological level of p53 displays an anti-apoptotic activity, whereas a high dose of p53 induces apoptosis (37Lassus P. Ferlin M. Piette J. Hibner U. EMBO J. 1996; 15: 4566-4573Crossref PubMed Scopus (102) Google Scholar, 38Chen X. Ko L.J. Jayaraman L. Prives C. Genes Dev. 1996; 10: 2438-2451Crossref PubMed Scopus (660) Google Scholar). Considering that HBx binds to p53 and blocks the p53 function, HBx may have induced apoptosis by antagonizing the anti-apoptotic function of the normal level of p53 in Chang liver cells as observed in our case, but, on the other hand, HBx may have an ability to block apoptosis when the apoptosis-inducing stimulus is the overexpression of p53, as reported previously (26Wang X.W. Gibson M.K. Vermeulen W. Yeh H. Forrester K. Stüzbecher H.-W. Hoeijmakers J.H.J. Harris C.C. Cancer Res. 1995; 55: 6012-6016PubMed Google Scholar). There are several other known functions of HBx that may also serve as the mechanism of apoptosis. The HBx-mediated activation of the mitogen-activated protein kinase/c-Jun N-terminal kinase pathway (15Benn J. Su F. Doria M. Schneider R.J. J. Virol. 1996; 70: 4978-4985Crossref PubMed Google Scholar) may be responsible since the abnormal regulation of this pathway was shown to lead to apoptosis (39Xia Z. Dickens M. Raingeaud J. Davis R.J. Greenberg M.E. Science. 1995; 270: 1326-1331Crossref PubMed Scopus (5045) Google Scholar). Alternatively, HBx may work through the induction of transforming growth factor β insomuch as HBx induces transforming growth factor β expression, which is a well established apoptosis stimulus for liver cells (40Oberhammer F.A. Pavelka M. Sharma S. Tiefenbacher R. Purchio A.F. Bursch W. Hermann R.S. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 5408-5412Crossref PubMed Scopus (680) Google Scholar), and HBx is colocalized with transforming growth factor β in transgenic liver (41Yoo Y.D. Ueda H. Park K. Flanders K.C. Lee Y.I. Jay G. Kim S.-J. J. Clin Invest. 1996; 97: 388-395Crossref PubMed Scopus (154) Google Scholar). In addition, HBx was shown to bind damaged DNA and to sensitize liver cells to cell death by ultraviolet irradiation (42Capovilla A. Carmona S. Arbuthnot P. Biochem. Biophys. Res. Commun. 1997; 232: 255-260Crossref PubMed Scopus (47) Google Scholar). Further study is required to clarify which of the mechanisms listed above is responsible for HBx-mediated apoptosis. At this stage, the precise role of HBx-mediated apoptosis during natural infection is not clear, but there are reported correlations of apoptosis with hepatitis or HCC. For example, apoptosis in the liver has been observed during hepatitis B viral infection (43Galle P.R. J. Hepatol. (Amst.). 1997; 27: 405-412Abstract Full Text PDF PubMed Scopus (83) Google Scholar, 44Patel T. Gores G.J. Hepatology. 1995; 21: 1725-1741PubMed Google Scholar). Apoptotic bodies and "piecemeal necrosis" are frequently detected in viral hepatitis and are likely to occur from apoptosis of individual infected cells rather than focal lysis of hepatocytes, as they are often observed in the absence of adjacent inflammation and features of necrosis. Furthermore, in hepatocarcinogenesis, preneoplastic and neoplastic cell populations show an increased rate of apoptosis as well as enhanced cell proliferation (45Bursch W. Grasl-Kraupp B. Ellinger A. Torok L. Kienzl H. Mullauer L. Schulte-Hermann R. Biochem. Cell Biol. 1994; 72: 669-675Crossref PubMed Scopus (29) Google Scholar). The possible involvement of HBx in these pathological phenomena needs further investigation. We thank other members of the laboratory, especially Y.-H. Lee, C. K. Kim, and E. M. Hong, for materials and helpful discussions. We also thank Y. Sung, J. Suh, W. Park, H. Ji, J. Shin, and H. Shin for various materials. Thanks are extended to W. Park and T. Kim for kindly introducing us to the transformation assay and histochemistry.