The Pit-1β Domain Dictates Active Repression and Alteration of Histone Acetylation of the Proximal Prolactin Promoter
2000; Elsevier BV; Volume: 275; Issue: 40 Linguagem: Inglês
10.1074/jbc.m006048200
ISSN1083-351X
AutoresScott E. Diamond, Arthur Gutierrez‐Hartmann,
Tópico(s)Protein Degradation and Inhibitors
ResumoA critical problem in current molecular biology is to gain a detailed understanding of the molecular mechanisms by which related transcription factor isoforms with identical DNA sequence specificity mediate distinct transcription responses. Pit-1 and Pit-1β constitute such a pair of transcription factor isoforms. Pit-1 enhances the Ras signaling pathway to the prolactin promoter, and Pit-1β represses basal prolactin promoter activity as well as Ras signaling to the prolactin promoter in pituitary cells. We have previously demonstrated that the β-domain amino acid sequence dictates the transcriptional properties of Pit-1β. Here, we show that five hydrophobic β-domain residues are required for Pit-1 isoform-specific repression of Ras signaling, and we demonstrate that sodium butyrate and trichostatin A, pharmacological inhibitors of histone deacetylation, as well as viral Ski protein, a dominant-negative inhibitor of recruitment of N-CoR/mSin3 histone deacetylase complexes, specifically reverse β isoform-specific repression of Ras signaling. Moreover, we directly demonstrate, with a chromatin immunoprecipitation assay, that the Pit-1β isoform alters the histone acetylation state of the proximal prolactin promoter. This differential analysis of Pit-1/Pit-1β isoform function provides significant insights into the structural determinants that govern how different transcription factors with identical DNA sequence specificity can display opposite effects on target gene activity. A critical problem in current molecular biology is to gain a detailed understanding of the molecular mechanisms by which related transcription factor isoforms with identical DNA sequence specificity mediate distinct transcription responses. Pit-1 and Pit-1β constitute such a pair of transcription factor isoforms. Pit-1 enhances the Ras signaling pathway to the prolactin promoter, and Pit-1β represses basal prolactin promoter activity as well as Ras signaling to the prolactin promoter in pituitary cells. We have previously demonstrated that the β-domain amino acid sequence dictates the transcriptional properties of Pit-1β. Here, we show that five hydrophobic β-domain residues are required for Pit-1 isoform-specific repression of Ras signaling, and we demonstrate that sodium butyrate and trichostatin A, pharmacological inhibitors of histone deacetylation, as well as viral Ski protein, a dominant-negative inhibitor of recruitment of N-CoR/mSin3 histone deacetylase complexes, specifically reverse β isoform-specific repression of Ras signaling. Moreover, we directly demonstrate, with a chromatin immunoprecipitation assay, that the Pit-1β isoform alters the histone acetylation state of the proximal prolactin promoter. This differential analysis of Pit-1/Pit-1β isoform function provides significant insights into the structural determinants that govern how different transcription factors with identical DNA sequence specificity can display opposite effects on target gene activity. transactivation domain prolactin rat PRL histone deacetylase complex Rous sarcoma virus hemagglutinin polymerase chain reaction cytomegalovirus Ets-binding sites polyacrylamide gel electrophoresis chromatin immunoprecipitation epitope-scanning alanine-scanning Most transcription factors are members of extended families defined by conserved structural motifs, typically in the DNA-binding domain, yet differing in other domains, especially the transactivation domain (TAD).1 A number of transcription factors are expressed as a set of proteins derived from a single gene via alternative promoter usage or splicing events that result in virtually identical transcription factor isoforms that, nonetheless, can mediate distinct responses (e.g. PR-Aversus PR-B; TRβ1 versus TRβ2; Oct 2.1versus Oct 2.5; Ets-1 versus Ets-1ΔVII; and Pit-1 versus Pit-1β) (1Kastner P. Krust A. Turcotte B. Stropp U. Tora L. Gronemeyer H. Chambon P. EMBO J. 1990; 9: 1603-1614Crossref PubMed Scopus (1309) Google Scholar, 2Hodin R.A. Lazar M.A. Wintman B.I. Darling D.S. Koenig R.J. Larsen P.R. Moore D.D. Chin W.W. Science. 1989; 244: 76-79Crossref PubMed Scopus (409) Google Scholar, 3Wirth T. Priess A. Annweiler A. Zwilling S. Oeler B. Nucleic Acids Res. 1991; 19: 43-51Crossref PubMed Scopus (116) Google Scholar, 4Koizumi S. Fisher R.J. Fujiwara S. Jorcyk C. Bhat N.K. Seth A. Papas T.S. Oncogene. 1990; 5: 675-681PubMed Google Scholar, 5Theill L.E. Hattori K. Domenico D. Castrillo J.L. Karin M. EMBO J. 1992; 11: 2261-2269Crossref PubMed Scopus (116) Google Scholar, 6Konzak K.E. Moore D.D. Mol. Endocrinol. 1992; 6: 241-247Crossref PubMed Scopus (72) Google Scholar). The molecular mechanisms, by which related transcription factor isoforms with identical DNA sequence specificity mediate distinct transcription responses, remain an area of active investigation. Pit-1 is a pituitary-specific POU homeodomain transcription factor that governs both anterior pituitary cell identity and hormone gene expression (reviewed in Ref. 7Pickett C.A. Gutierrez-Hartmann A. Wierman M.E. Diseases of the Pituitary: Diagnosis and Treatment. 3. Humana Press Inc., Totowa, NJ1997: 1-31Google Scholar). Pit-1 occurs in vertebrates, including humans, as two principal splice isoforms (Fig. 1). The β isoform arises from an alternative splice-acceptor sequence at the end of the first intron resulting in a 26-amino acid insertion, the β-domain, at position 48 in the TAD, between the first and second exons, TAD1 and TAD2 (Fig. 1) (5Theill L.E. Hattori K. Domenico D. Castrillo J.L. Karin M. EMBO J. 1992; 11: 2261-2269Crossref PubMed Scopus (116) Google Scholar, 6Konzak K.E. Moore D.D. Mol. Endocrinol. 1992; 6: 241-247Crossref PubMed Scopus (72) Google Scholar). The β isoform differs from Pit-1 only in the TAD and displays identical DNA sequence specificity with respect to the prolactin (PRL) promoter (5Theill L.E. Hattori K. Domenico D. Castrillo J.L. Karin M. EMBO J. 1992; 11: 2261-2269Crossref PubMed Scopus (116) Google Scholar) but has dramatically different transcriptional properties than Pit-1, and these differences are dictated by the unique amino acid sequence of the β-domain TAD insertion (8Diamond S.E. Gutierrez-Hartmann A. J. Biol. Chem. 1996; 271: 28925-28932Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar). The β-domain insertion causes Pit-1β to act as a pituitary-specific repressor of both of basal transcription of the rat (r) PRL and of Ras signaling to the rPRL promoter gene (reviewed in Ref. 8Diamond S.E. Gutierrez-Hartmann A. J. Biol. Chem. 1996; 271: 28925-28932Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar). Additionally, the β-domain blocks functional interaction with Ets-1 (9Bradford A.P. Conrad K.E. Wasylyk C. Wasylyk B. Gutierrez-Hartmann A. Mol. Cell. Biol. 1995; 15: 2849-2857Crossref PubMed Scopus (109) Google Scholar) and functional interaction with the thyroid hormone and retinoic acid receptors (10Sanchez-Pacheco A. Pena P. Palomino T. Guell A. Castrillo J.L. Aranda A. FEBS Lett. 1998; 422: 103-107Crossref PubMed Scopus (18) Google Scholar) in nonpituitary cells. Nevertheless, this same 26-amino acid insertion endows Pit-1β with even greater potency with regard to mediation of protein kinase A signaling to the rPRL promoter (8Diamond S.E. Gutierrez-Hartmann A. J. Biol. Chem. 1996; 271: 28925-28932Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar, 11Diamond S.E. Chiono M. Gutierrez-Hartmann A. Mol. Endocrinol. 1999; 13: 228-238Crossref PubMed Scopus (25) Google Scholar).Figure 3The epitope-scanning Pit-1β proteins retain variable transcription function. A, the various pRSV HA Pit-1 constructs were introduced into GH4 cells by electroporation. In order to achieve equal levels of protein expression for the various HA Pit-1 constructs, varying amounts of each pRSV Pit-1 DNA were introduced, with pRSV levels held constant by the addition of pRSV β-globin. After 24 h cells were harvested and analyzed by SDS-PAGE and Western blot (see “Experimental Procedures”). Lanes were loaded as follows: No pRSV HA Pit-1 (lane 1); 10 μg of pRSV HA Pit-1 (lane 2); 25 μg of pRSV HA Pit-1β (lane 3); 20 μg of pRSV HA Pit-1-ES1 (lane 4); 20 μg of pRSV HA Pit-1-ES2 (lane 5); 10 μg of pRSV HA Pit-1-ES3 (lane 6); 10 μg of pRSV HA Pit-1-ES4 (lane 7); 20 μg of pRSV HA Pit-1-ES5 (lane 8); and 30 μg of pRSV HA Pit-1-ES6 (lane 9). B, mutant and wild-type pRSV Pit-1 constructs were introduced into HeLa nonpituitary cells by electroporation with 3 μg of pA3 PRL luc-425. pRSV HA Pit-1 plasmid DNA amounts were adjusted for equal protein expression. Total pRSV plasmid amount was maintained constant with pRSV β-globin DNA. After 24 h, cells were harvested and total light units measured (see “Experimental Procedures”).View Large Image Figure ViewerDownload Hi-res image Download (PPT)Figure 1Structural organization of Pit-1 isoforms and constructs. Top, Pit-1 with its TAD, POU-specific, and POU homeodomains and their amino acid end points. PBand HDB represent POU-specific and POU-homeodomain basic domains; α1–4 and α1–3 represent their α-helices;Hinge represents the region between the TAD and the bipartite DNA-binding domain; FL represents the 15-amino acid flexible linker between the POU-specific and POU-homeodomains.Middle, Pit-1β with the 26-amino acid β-domain insertion in its TAD. Bottom, the location of the ΔTAD mutation is shown, a deletion of amino acids 2–80.View Large Image Figure ViewerDownload Hi-res image Download (PPT) In this article, we focus on identifying key β-domain residues that are responsible for the β isoform-specific repression of Ras signaling to the rPRL promoter, as well as identifying a mechanism for this repression. We have utilized an epitope-scanning approach to replace sequentially 6 amino acid blocks of the β-domain in order to identify a limited subset of functionally important residues. Replacement of each of these residues with alanine identified five hydrophobic residues that are required for the β-domain to act as a transcriptional repressor of Ras signaling to the rPRL promoter. Moreover, we demonstrate that the β-domain does not simply disrupt TAD structure but functions as an active repression domain, which modifies the acetylation state of the proximal PRL promoter in a manner dependent upon an N-CoR/mSin3-containing histone deacetylase complex (HDAC). Thus, analysis of the Pit-1/Pit-1β isoform pair provides significant insight into the structural determinants of transcription activation versus repression mediated by two nearly identical transcription factor isoforms. Monolayer cultures of HeLa human cervical carcinoma cells and GH4T2 rat pituitary tumor cells (12Conrad K.E. Gutierrez-Hartmann A. Oncogene. 1992; 7: 1279-1286PubMed Google Scholar) were maintained in Dulbecco's modified Eagle's medium, 15% horse serum, 2.5% fetal bovine serum, and 50 μg/ml penicillin and streptomycin at 37 °C in 5% CO2. The medium was changed 16–18 h before each transfection. Cells used for transfections were harvested at approximately 60–80% confluence using 0.05% trypsin and 0.5 mm EDTA. The rat PRL promoter luciferase expression vector, pA3 PRL luc, contains the firefly luciferase coding region under the control of a 498-bp fragment (−425 to +73) of the rPRL promoter downstream of three polyadenylation termination sites in pA3 luc (12Conrad K.E. Gutierrez-Hartmann A. Oncogene. 1992; 7: 1279-1286PubMed Google Scholar). Plasmid pSV Ras contains the T24 bladder carcinoma Harvey Ras valine 12 mutant oncogene (RasVal-12) under control of the SV40 early promoter. Plasmids pRSV HA Pit-1 and pRSV HA Pit-1β express N-terminally hemagglutinin (HA)-tagged Pit-1 and Pit-1β under the control of the RSV promoter (8Diamond S.E. Gutierrez-Hartmann A. J. Biol. Chem. 1996; 271: 28925-28932Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar), and plasmids pCGN2-Pit-1 and pCGN2 Pit-1ΔTAD express N-terminally HA-tagged Pit-1 and Pit-1 deleted for its TAD (amino acids 1–80) under the control of the CMV promoter, and they were the generous gift of Dr. David F. Gordon (University of Colorado Health Sciences Center, Denver, CO). Plasmid pAPR EtsZ encodes the DNA-binding domain (amino acids 334–466) of human c-ETS-2 fused to LacZ under the control of the actin promoter (13Langer S.J. Bortner D.M. Roussel M.F. Sherr C.J. Ostrowski M.C. Mol. Cell. Biol. 1992; 12: 5355-5362Crossref PubMed Scopus (136) Google Scholar). Plasmid pRSVt3 v-Ski contains the avian Sloan-Kettering virusski oncogene under the control of the RSV promoter (14Tokitou F. Nomura T. Khan M.M. Kaul S.C. Wadhwa R. Yasukawa T. Kohno I. Ishii S. J. Biol. Chem. 1999; 274: 4485-4488Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar) and was the generous gift of Dr. Edward Stavnezer (Case Western Reserve University, Cleveland, OH). Plasmid DNAs were prepared by Qiagen (Qiagen Inc., Chatsworth, CA) columns and quantified by fluorimetry. The vectors pRSV HA Pit-1-ES1, pRSV HA Pit-1-ES2, pRSV HA Pit-1-ES3, pRSV HA Pit-1-ES4, pRSV HA Pit-1-ES5, and pRSV HA Pit-1-ES6, which encode HA-tagged Pit-1βs with different epitope-scanning mutations of the 26-amino acid β-domain, as well as the vectors pRSV HA Pit-1-AS1, pRSV HA Pit-1-AS2, pRSV HA Pit-1-AS3, pRSV HA Pit-1-AS4, pRSV HA Pit-1-AS5, pRSV HA Pit-1-AS6, pRSV HA Pit-1-AS7, pRSV HA Pit-1-AS8, and pRSV HA Pit-1-AS9, which encode HA-tagged Pit-1βs with different alanine-scanning mutations of the 26 amino acid β-domain, were constructed as follows. All mutant β-domain constructs were constructed by nested PCR mutagenesis of the Pit-1 transactivation domain as described previously (8Diamond S.E. Gutierrez-Hartmann A. J. Biol. Chem. 1996; 271: 28925-28932Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar, 11Diamond S.E. Chiono M. Gutierrez-Hartmann A. Mol. Endocrinol. 1999; 13: 228-238Crossref PubMed Scopus (25) Google Scholar). The pRSV HA Pit-1 plasmid was used as a substrate for PCR mutagenesis in which the 26-amino acid β-domain was substituted with six different epitope-scanning sequences (see Table I) or nine different alanine-scanning sequences (Table II), and an HA epitope tag was retained at the N terminus of all of the Pit-1 constructs. Common 5′- and 3′-deoxyoligonucleotides were utilized, as well as mutation-specific mutagenic deoxyoligonucleotides that encode the nucleotide substitutions in the β-domain. Amplified DNA was initially subcloned into pCR 2.1 (Invitrogen). The commercially synthesized deoxyoligonucleotides (Life Technologies, Inc.) contained the following sequences: 5′-TAD, AAA AAG CAA GCT TCC ATG GGG TAC CCA TAC GAT GTT CCG GAT TAC GCT AGT TGC AAC CTT TC; 3′-TAD, GTT TGT CTG GGT GTA TC; 5′-ES-1, GTG TGC AAA CAT TTA GGA GTT TGG ATC AAT ATA TAG CGA TAG GTG TCT GTG GAC ATC ACG TTG; 3′-ES-1,CTA AAT GTT TGC ACA CAT ATT TCT CGA TGA CAA CGA TGG GAA ATA CAG CGA CAG GAC TTC ATT 5′-ES-2, GTG TGC AAA CAT TTA GGT ATA TAG CGA TAG GTG TCA ATA GAC GGG ACT GTG GAC ATC ACG TTG; 3′-ES-2, CTA AAT GTT TGC ACA CAT ATT TCT CGA TGA CAA CGA TGG GAA ATA CAG CGA CAG GAC TTC ATT; 5′-ES-3, GTG TGT ATA TAG CGA TAG GTG TCG ATC AAA GAC AAA ATA GAC GGG ACT GTG GAC ATC ACG TTG; 3′ES-3, ATC GCT ATA TAC ACA CAT ATT TCT CGA TGA CAA CGA TGG GAA ATA CAG CGA CAG GAC TTC ATT; 5′-ES-4, CGA TAG GTG TCT TTA GGA GTT TGG ATC AAA GAC AAA ATA GAC GGG ACT GTG GAC ATC ACG TTG; 3′-ES-4, CTA AAG ACA CCT ATC GCT ATA TAT CGA TGA CAA CGA TGG GAA ATA CAG CGA CAG GAC TTC ATT; 5′-ES-5, GTG TGC AAA CAT TTA GGA GTT TGG ATC AAA GAC AAA ATA GAC GGG ACT GTG GAC ATC ACG TTG; 3′-ES-5, CTA AAT GTT TGC ACA CAG ACA CCT ATC GCT ATA TAA TGG GAA ATA CAG CGA CAG GAC TTC ATT; 5′-ES-6, GTG TGC AAA CAT TTA GGA GTT TGG ATC AAA GAC AAA ATA GAC GGG ACT GTG GAC ATC ACG TTG; 3′-ES-6, CTA AAT GTT TGC ACA CAT ATT TCT CGA TGG ACA CCT ATC GCT ATA TAG CGA CAG GAC TTC ATT; 5′-AS-1, GTG TGC AAA CAT TTA GGA GTT TGG ATC GCG GAC AAA ATA GAC GGG ACT GTG GAC ATC ACG TTG; 3′-AS-1, CTA AAT GTT TGC ACA CAT ATT TCT CGA TGA CAA CGA TGG GAA ATA CAG CGA CAG GAC TTC ATT; 5′-AS-2, GTG TGC AAA CAT TTA GGA GTT TGC GCG AGA GAC AAA ATA GAC GGG ACT GTG GAC ATC ACG TTG; 3′-AS-2, CTA AAT GTT TGC ACA CAT ATT TCT CGA TGA CAA CGA TGG GAA ATA CAG CGA CAG GAC TTC ATT; 5′-AS-3, GTC GCG AGA CAT TTA GGA GTT TGG ATC AAA GAC AAA ATA GAC GGG ACT GTG GAC ATC ACG TTG; 3′-AS-3, CTA AAT GTC TCG CGA CAT ATT TCT CGA TGA CAA CGA TGG GAA ATA CAG CGA CAG GAC TTC ATT; 5′-AS-4, GCG TGC AAA CAT TTA GGA GTT TGG ATC AAA GAC AAA ATA GAC GGG ACT GTG GAC ATC ACG TTG; 3′-AS-4, CTA AAT GTT TGC ACG CGT ATT TCT CGA TGA CAA CGA TGG GAA ATA CAG CGA CAG GAC TTC ATT; 5′-AS-5, GTG TGC AAA CAT TTA GGA GTT TGG ATC AAA GAC AAA ATA GAC GGG ACT GTG GAC ATC ACG TTG; 3′-AS-5, CTA AAT GTT TGC ACA CCG CGT TCT CGA TGA CAA CGA TGG GAA ATA CAG CGA CAG GAC TTC ATT; 5′-AS-6, GTG TGC AAA CAT TTA GGA GTT TGG ATC AAA GAC AAA ATA GAC GGG ACT GTG GAC ATC ACG TTG; 3′-AS-6, CTA AAT GTT TGC ACA CAT ACG CCT CGA TGA CAA CGA TGG GAA ATA CAG CGA CAG GAC TTC ATT; 5′-AS-7, GTG TGC AAA CAT TTA GGA GTT TGG ATC AAA GAC AAA ATA GAC GGG ACT GTG GAC ATC ACG TTG; 3′-AS-7, CTA AAT GTT TGC ACA CAT ATT TGC CGA TGA CAA CGA TGG GAA ATA CAG CGA CAG GAC TTC ATT; 5′-AS-8, GTG TGC AAA CAT TTA GGA GTT TGG ATC AAA GAC AAA ATA GAC GGG ACT GTG GAC ATC ACG TTG; 3′-AS-8, CTA AAT GTT TGC ACA CAT ATT TGT CCG CGA CAA CGA TGG GAA ATA CAG CGA CAG GAC TTC ATT; 5′-AS-9, GTG TGC AAA CAT TTA GGA GTT TGG ATC AAA GAC AAA ATA GAC GGG ACT GTG GAC ATC ACG TTG; 3′-AS-9 CTA AAT GTT TGC ACA CAT ATT TCT CGA TGA CCG CGA TGG GAA ATA CAG CGA CAG GAC TTC ATT.Table IEpitope-scanning β-domainsConstructAmino acid sequence of β-domainPit-1βVPSILSLIQTPKCLHTYFSMTTMGNTES1DTYRYI LIQTPKCLHTYFSMTTMGNTES2VPSI DTYRYI PKCLHTYFSMTTMGNTES3VPSILSLI DTYRYI HTYFSMTTMGNTES4VPSILSLIQTPK DTYRYI SMTTMGNTES5VPSILSLIQTPKCLHT DTYRYI MGNTES6VPSILSLIQTPKCLHTYFSM DTYRYI Open table in a new tab Table IIAlanine-scanning β-domainsConstructAmino acid sequence of β-domainPit-1βVPSILS LI QTPKCL HTYFSM T T MGNTAS1VPSILS A IQTPKCLHTYFSMTTMGNTAS2VPSILSL A QTPKCLHTYFSMTTMGNTAS3VPSILSLIQTPKCL A TYFSMTTMGNTAS4VPSILSLIQTPKCLH A YFSMTTMGNTAS5VPSILSLIQTPKCLHT A FSMTTMGNTAS6VPSILSLIQTPKCLHTY A SMTTMGNTAS7VPSILSLIQTPKCLHTYF A MTTMGNTAS8VPSILSLIQTPKCLHTYFS A TTMGNTAS9VPSILSLIQTPKCLHTYFSMT A MGNT Open table in a new tab The presence of each introduced mutation and integrity of its TAD region were verified by dideoxy sequencing by the University of Colorado Health Sciences Cancer Center DNA Sequencing Core facility. HA-tagged Pit-1 TAD sequences were then excised from pCR2.1 by digestion with HindIII and PpuMI and ligated to the unique HindIII and PpuMI sites of pRSV-Pit-1 to produce pRSV HA Pit-1-ES1, pRSV HA Pit-1-ES2, pRSV HA Pit-1-ES3, pRSV HA Pit-1-ES4, pRSV HA Pit-1-ES5, and pRSV HA Pit-1-ES6, as well as pRSV HA Pit-1-AS1, pRSV HA Pit-1-AS2, pRSV HA Pit-1-AS3, pRSV HA Pit-1-AS4, pRSV HA Pit-1-AS5, pRSV HA Pit-1-AS6, pRSV HA Pit-1-AS7, pRSV HA Pit-1-AS8, and pRSV HA Pit-1-AS9, DNA was introduced into HeLa or GH4 cells by electroporation as follows. Approximately 2–3 × 106 enzymatically dispersed cells were mixed with plasmid DNA in a sterile gene-pulse chamber and exposed to a controlled electrical field of 500 microfarads at 220 V, as described previously (15Keech C.A. Gutierrez-Hartmann A. Mol. Endocrinol. 1989; 3: 832-839Crossref PubMed Scopus (43) Google Scholar). Cells from individual transfections were then maintained in Dulbecco's modified Eagle's medium, 15% horse serum, 2.5% fetal bovine serum, and 50 μg/ml penicillin and streptomycin at 37 °C. The nonspecific effects of the RSV or CMV promoters upon transcription factor availability was controlled by including amounts of pRSV or CMV β-globin plasmid DNA in all assays to render the total pRSV or CMV DNA concentration constant. Transient transfections were performed in triplicate, in at least three separate experiments. After incubation for 24 h, cells were harvested with phosphate-buffered saline containing 3 mm EDTA, pelleted, and resuspended in 100 mm potassium phosphate buffer, pH 7.8, 1 mmdithiothreitol. Cells were lysed by three cycles of freeze-thawing and by vortexing between thaws. Cell debris was pelleted by centrifugation for 10 min at 10,000 × g at 4 °C, and the supernatant was used for subsequent assays. Luciferase activity in the supernatant was assayed as described previously (12Conrad K.E. Gutierrez-Hartmann A. Oncogene. 1992; 7: 1279-1286PubMed Google Scholar). Samples were measured in duplicate using a Monolight 2010 Luminometer (Analytical Luminescence Laboratories, San Diego, CA). Relative light units for each transfection were calculated by normalizing for total protein. Protein assays were performed according to the method of Bradford (16Bradford M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (211906) Google Scholar) using commercially available reagents (Bio-Rad). Results are expressed as the fold activation of the rPRL promoter ± S.E. for at least three experiments, each in triplicate. Transient transfections were performed as above. Cells were harvested with phosphate-buffered saline containing 3 mm EDTA, pelleted, and resuspended in a triethanolamine/SDS solubilization buffer (55 mm triethanolamine, 111 mm NaCl, 2.2 mm EDTA, and 0.44% SDS) (17Ottaviano Y. Gerace L. J. Biol. Chem. 1985; 260: 624-632Abstract Full Text PDF PubMed Google Scholar). Lysed extracts were passed through a 25-gauge needle seven times. The protein content of each extract was assayed according to the method of Lowry et al.(18Lowry O.H. Rosebrough N.J. Farr A.L. Randall R.J. J. Biol. Chem. 1951; 193: 265-275Abstract Full Text PDF PubMed Google Scholar), using commercially available reagents (Bio-Rad). Equal amounts (100 μg) of protein from each extract were separated on 15% SDS-polyacrylamide gels and transferred to Immobilon-P (polyvinylidene difluoride) membrane (Millipore, Bedford, MA). The HA-tagged Pit-1 proteins were detected with a mouse monoclonal anti-HA primary antibody (BAbCO, Richmond, CA), secondary sheep anti-mouse HRP-conjugated antibodies (Santa Cruz Biotechnology Inc., Santa Cruz, CA), and ECL media (Amersham Pharmacia Biotech). Dilutions of 1:1,000 of the primary anti-HA monoclonal antibody and of 1:10,000 of the secondary sheep anti-mouse antibody preparation were used. Chromatin immunoprecipitation (ChIP) assays were performed according to the protocol for the acetyl-histone H4 ChIP Assay Kit (Upstate Biotechnology, Lake Placid, NY), as modified by Lambert and Nordeen (19Lambert J.R. Nordeen S.K. Lieberman B. Methods in Steroid Receptor Molecular Biology. Humana Press Inc., Totowa, NJ2000Google Scholar). Transient transfections were performed as above. Twenty four hours after transfection, 2 × 107 GH4cells were cross-linked by addition of formaldehyde into the medium at a final concentration of 1% and incubated for 15 min at room temperature. Cells were washed with ice-cold phosphate-buffered saline and resuspended in 500 μl of ChIP Lysis buffer (1% SDS, 10 mm EDTA, 50 mm Tris-HCl, pH 8.0, with protease inhibitors). The lysates were sonicated utilizing a Branson Sonifier 450 at power setting 2 with three 10-s pulses at duty cycle 90 and diluted to 3 ml with ChIP dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mm EDTA, 16.7 mm Tris-HCl, pH 8.0, 167 mm NaCl). 1 ml of each sample was precleared by incubating with 80 μl protein A-agarose beads for 30 min at 4 °C with rotation. 5 μl of anti-acetyl histone H4 antibody (Upstate Biotechnology, Lake Placid, NY) was added, and immunoprecipitation was done overnight at 4 °C with rotation. Immune complexes were collected with 60 μl of protein A-agarose and washed once with 1 ml each of the following buffers in sequence: Low Salt Wash Buffer (0.1% SDS, 1% Triton X-100, 2 mm EDTA, 20 mmTris-HCl, pH 8.0, 150 mm NaCl), High Salt Wash Buffer (0.1% SDS, 1% Triton X-100, 2 mm EDTA, 20 mmTris-HCl, pH 8.0, 1500 mm NaCl), LiCl Wash Buffer (250 mm LiCl, 1% Nonidet P-40, 1% sodium deoxycholate, 1 mm EDTA, 10 mm Tris-HCl, pH 8.0); and twice with TE (10 mm Tris-HCl, pH 8.0, 1 mm EDTA). Immune complexes were eluted, and cross-links were reversed by heating at 65 °C and subjected to proteinase K treatment. DNA was recovered by phenol/chloroform extraction followed by ethanol precipitation and was used as a template for PCR (25 cycles) using pA3 −425 PRL Luc promoter-specific commercially synthesized deoxyoligonucleotides (Life Technologies, Inc.) that contain a PRL promoter-specific sequence, GCCTTTCTTTATGTTTTTGGC, and a luciferase-specific sequence, GACTCAAGATGTCAGTCAGC. In addition, internal control PCRs were performed with pSV Ras plasmid-specific commercially synthesized deoxyoligonucleotides (Life Technologies, Inc.) that contain an SV40 promoter-specific sequence, GCATCTCAATTAGTCAGC, and a Ha-Ras-exon-1-specific sequence, ACCAGCTTATATTCCGTC. Control reactions were performed to ensure that all PCR assays took place in the linear range of response to input DNA. PCR products were separated by agarose gel electrophoresis, and bands were imaged and quantified on an Alpha Imager 2000 Gel Documentation System (Alpha Innotech, San Leandro, CA). We have previously demonstrated that the β-domain insertion converts Pit-1 from a co-activator to a repressor of Ras signaling to the rPRL promoter (9Bradford A.P. Conrad K.E. Wasylyk C. Wasylyk B. Gutierrez-Hartmann A. Mol. Cell. Biol. 1995; 15: 2849-2857Crossref PubMed Scopus (109) Google Scholar, 20Conrad K.E. Oberwetter J.M. Vallaincourt R. Johnson G.L. Gutierrez-Hartmann A. Mol. Cell. Biol. 1994; 14: 1553-1565Crossref PubMed Scopus (71) Google Scholar). Moreover, we have shown that the amino acid sequence of the β-domain dictates this repression (8Diamond S.E. Gutierrez-Hartmann A. J. Biol. Chem. 1996; 271: 28925-28932Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar,11Diamond S.E. Chiono M. Gutierrez-Hartmann A. Mol. Endocrinol. 1999; 13: 228-238Crossref PubMed Scopus (25) Google Scholar). One possible mechanism for β-domain-specific repression of Ras signaling would be that β-domain residues disrupt secondary or tertiary structures within the Pit-1 TAD that are important for Ras signaling. A prediction of this hypothesis would be that a particular Pit-1 TAD structure should be necessary for Ras signaling. In order to test this prediction, HA-tagged wild-type Pit-1, Pit-1β, and Pit-1 ΔTAD, which is deleted for amino acids 1–80 (Fig.1), were introduced into GH4pituitary cells by electroporation in the presence of a rPRL promoter-driven luciferase reporter and pSV Ras (Fig.2). As documented previously, co-transfection with wild-type Pit-1 constructs enhanced the Ras response from 3-fold in its absence to 10–13-fold in its presence, and co-transfection of the Pit-1β isoform not only failed to enhance the Ras response but actually reduced it by more than one-third. The deletion of the Pit-1 TAD, on the other hand, did not significantly interfere with enhancement of Ras signaling by Pit-1 but, in fact, enhanced the response to 9-fold. These data thus demonstrate that the TAD itself is not required for Pit-1 mediation of Ras signaling to the rPRL promoter. In order to identify β-domain residues that are functionally important for repression of Ras signaling, we took a two-step approach. In order to identify small regions required for repression, we sequentially altered overlapping 6 amino acid blocks of the β-domain (TableI). Individual residues in functionally important regions identified were then subjected to alanine-scanning mutagenesis (see below). We specifically chose the AU1 epitope (21Lim P. Jensen L. Cowsert Y. Nakai L. Lim X. Sundberg J. J. Infect. Dis. 1990; 162: 1263-1269Crossref PubMed Scopus (72) Google Scholar) to replace 6 amino acid stretches of the β-domain because it did not affect the ability of mutant Pit-1β to function as a transcription factor when part of a β-domain substitution mutant (8Diamond S.E. Gutierrez-Hartmann A. J. Biol. Chem. 1996; 271: 28925-28932Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar). Each mutant β-domain is of the same size and in the same position as the wild-type β-domain and differs from the wild type by at most 6 amino acids. The mutant and wild-type constructs were each N-terminally tagged with an HA epitope (8Diamond S.E. Gutierrez-Hartmann A. J. Biol. Chem. 1996; 271: 28925-28932Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar). Thus, all constructs expressed proteins that contained the same epitope in the same relative position to allow for their detection by Western blot analysis regardless of possible alterations of protein structure by the β-domain substitutions. It has been previously shown that wild-type Pit-1 and Pit-1β constructs express protein at different levels in transient transfection experiments (6Konzak K.E. Moore D.D. Mol. Endocrinol. 1992; 6: 241-247Crossref PubMed Scopus (72) Google Scholar,8Diamond S.E. Gutierrez-Hartmann A. J. Biol. Chem. 1996; 271: 28925-28932Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar). In order to exclude the effect of differences in protein expression level on transcription potency, we carried out a series of transfection experiments to find levels of input DNA that would yield similar levels of protein expression from the wild-type and mutant Pit-1 vectors. In a preliminary experiment, 10 μg of each of the pRSV HA Pit-1 constructs were introduced into HeLa nonpituitary cells and GH4pituitary cells by electroporation. Extracts f
Referência(s)