Formation of Insoluble Oligomers Correlates with ST6Gal I Stable Localization in the Golgi
2000; Elsevier BV; Volume: 275; Issue: 18 Linguagem: Inglês
10.1074/jbc.275.18.13819
ISSN1083-351X
AutoresChun Chen, Jiyan Ma, Ana Lazic, Marija Backović, Karen Colley,
Tópico(s)Photoreceptor and optogenetics research
ResumoThe ST6Gal I is a sialyltransferase that functions in the late Golgi to modify the N-linked oligosaccharides of glycoproteins. The ST6Gal I is expressed as two isoforms with a single amino acid difference in their catalytic domains. The STcys isoform is stably retained in the cell and is predominantly found in the Golgi, whereas the STtyr isoform is only transiently localized in the Golgi and is cleaved and secreted from a post-Golgi compartment. These two ST6Gal I isoforms were used to explore the role of the bilayer thickness mechanism and oligomerization in Golgi localization. Analysis of STcys and STtyr proteins with longer transmembrane regions suggested that the bilayer thickness mechanism is not the predominant mechanism used for ST6Gal I Golgi localization. In contrast, the formation and quantity of Triton X-100-insoluble oligomers was correlated with the stable or transient localization of the ST6Gal I isoforms in the Golgi. Nearly 100% of the STcys and only 13% of the STtyr were found as Triton-insoluble oligomers when Golgi membranes of COS-1 cells expressing these proteins were solubilized at pH 6.3, the pH of the late Golgi. In contrast, both proteins were found in the soluble fraction when these membranes were solubilized at pH 8.0. Analysis of other mutants suggested that a conformational change in the catalytic domain rather than increased disulfide bond-based cross-linking is the basis for the increased ability of STcys protein to form oligomers and the stable localization of STcys protein in the Golgi. The ST6Gal I is a sialyltransferase that functions in the late Golgi to modify the N-linked oligosaccharides of glycoproteins. The ST6Gal I is expressed as two isoforms with a single amino acid difference in their catalytic domains. The STcys isoform is stably retained in the cell and is predominantly found in the Golgi, whereas the STtyr isoform is only transiently localized in the Golgi and is cleaved and secreted from a post-Golgi compartment. These two ST6Gal I isoforms were used to explore the role of the bilayer thickness mechanism and oligomerization in Golgi localization. Analysis of STcys and STtyr proteins with longer transmembrane regions suggested that the bilayer thickness mechanism is not the predominant mechanism used for ST6Gal I Golgi localization. In contrast, the formation and quantity of Triton X-100-insoluble oligomers was correlated with the stable or transient localization of the ST6Gal I isoforms in the Golgi. Nearly 100% of the STcys and only 13% of the STtyr were found as Triton-insoluble oligomers when Golgi membranes of COS-1 cells expressing these proteins were solubilized at pH 6.3, the pH of the late Golgi. In contrast, both proteins were found in the soluble fraction when these membranes were solubilized at pH 8.0. Analysis of other mutants suggested that a conformational change in the catalytic domain rather than increased disulfide bond-based cross-linking is the basis for the increased ability of STcys protein to form oligomers and the stable localization of STcys protein in the Golgi. ST6Gal I or α2,6-sialyltransferase endoplasmic reticulum Dulbecco's modified Eagle's medium phosphate-buffered saline The ST6Gal I, or β-galactoside α2,6-sialyltransferase (ST),1 is a glycosyltransferase that has been localized to the trans cisternae of the Golgi and the trans Golgi network (1.Roth J. Taatjes D.J. Lucoq J.M. Weinstein J. Paulson J.C. Cell. 1985; 43: 287-295Abstract Full Text PDF PubMed Scopus (329) Google Scholar). Within these compartments it encounters the sugar nucleotide donor, CMP-NeuAc, and functions to add terminal sialic acid residues to the N-linked oligosaccharides of glycoproteins. The ST6Gal I is expressed as two isoforms that have a single amino acid difference at position 123 in the catalytic domain (2.Ma J. Qian R. Rausa III, F.M. Colley K.J. J. Biol. Chem. 1997; 272: 672-679Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). This single amino acid difference (Tyr → Cys) is the result of a single nucleotide change (A → G), which is likely the result of an RNA editing event (2.Ma J. Qian R. Rausa III, F.M. Colley K.J. J. Biol. Chem. 1997; 272: 672-679Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). The STtyr isoform is found in the Golgi, at low levels on the cell surface and is cleaved and secreted from COS-1 and HeLa cells with a half time of 3–6 h. In striking contrast, the STcys isoform is found in the Golgi in moderately expressing cells and is never observed at the cell surface or cleaved and secreted into the media of COS-1 or HeLa cells (2.Ma J. Qian R. Rausa III, F.M. Colley K.J. J. Biol. Chem. 1997; 272: 672-679Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). Several pieces of evidence suggest that the difference observed in STtyr and STcys processing relate to differences in the localization and trafficking of these proteins in the cell. First, decreasing the temperature of cells to 20 °C prevents the cleavage and secretion of the STtyr from COS-1 cells, suggesting that this isoform is only transiently localized in the Golgi and moves beyond the trans Golgi network into a post-Golgi compartment where cleavage occurs (2.Ma J. Qian R. Rausa III, F.M. Colley K.J. J. Biol. Chem. 1997; 272: 672-679Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). The presence of low levels of the STtyr protein at the cell surface also supports the idea that the STtyr is only transiently localized in the Golgi. In addition, it is unlikely that the presence of the Cys at position 123 eliminates cleavage per se because the major cleavage site is found in the stem region between Lys40 and Glu41 and because both isoforms are cleaved and secreted from Chinese hamster ovary cells (2.Ma J. Qian R. Rausa III, F.M. Colley K.J. J. Biol. Chem. 1997; 272: 672-679Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar, 3.Kitazume-Kawaguchi S. Dohmae N. Takio K. Tsuji S. Colley K.J. Glycobiology. 1999; 9: 1397-1406Crossref PubMed Scopus (32) Google Scholar). This latter observation also suggests that the ST6Gal I isoforms and/or the proteases responsible for cleavage are localized differently in different cell types. What is the basis for the differences in ST6Gal I isoform localization and processing? Two hypotheses have been formulated to explain the localization of proteins in the Golgi. The bilayer thickness hypothesis first stated by Bretscher and Munro (4.Bretscher M.S. Munro S. Science. 1993; 261: 1280-1281Crossref PubMed Scopus (753) Google Scholar) and supported by the results of Munro (5.Munro S. EMBO J. 1991; 12: 3577-3588Crossref Scopus (231) Google Scholar, 6.Munro S. EMBO J. 1995; 14: 4695-4704Crossref PubMed Scopus (345) Google Scholar) and Masibay et al. (7.Masibay A.S. Balaji P.J. Boeggeman E.E. Quasba P.K. J. Biol. Chem. 1993; 268: 9908-9916Abstract Full Text PDF PubMed Google Scholar) is based on three observations. First, on average, Golgi proteins have shorter transmembrane regions than plasma membrane proteins (7.Masibay A.S. Balaji P.J. Boeggeman E.E. Quasba P.K. J. Biol. Chem. 1993; 268: 9908-9916Abstract Full Text PDF PubMed Google Scholar, 8.Munro S. Biochem. Soc. Trans. 1995; 23: 527-530Crossref PubMed Scopus (61) Google Scholar). Second, there is a gradient of cholesterol in membranes from the endoplasmic reticulum (ER) to the plasma membrane with the highest levels found in the plasma membrane (9.Orci L. Montesano R. Meda P. Malaisse-Lagae F. Brown D. Perrelet A. Vassalli P. Proc. Natl. Acad. Sci. U. S. A. 1981; 78: 293-297Crossref PubMed Scopus (204) Google Scholar). Third, in vitro liposome studies have demonstrated that increasing the levels of cholesterol in a membrane increases its width (10.Nezil F.A. Bloom M. Biophys. J. 1992; 61: 1176-1183Abstract Full Text PDF PubMed Scopus (300) Google Scholar). From these observations, Bretscher and Munro (4.Bretscher M.S. Munro S. Science. 1993; 261: 1280-1281Crossref PubMed Scopus (753) Google Scholar) proposed that Golgi membrane proteins, with their shorter transmembrane regions, are not able to partition into transport vesicles moving to the plasma membrane and are therefore essentially retained in the Golgi. The oligomerization/kin recognition hypothesis has several origins. First, Machamer (11.Machamer C.E. Trends Cell Biol. 1991; 1: 141-144Abstract Full Text PDF PubMed Scopus (84) Google Scholar) proposed that proteins form oligomers in the specific microenvironments of the Golgi cisternae and that the insolubility or size of these oligomers prevents them from entering transport vesicles and trafficking to the plasma membrane. Nilsson and co-workers (12.Nilsson T. Slusarewicz P. Hoe M.H. Warren G. FEBS Lett. 1993; 330: 1-4Crossref PubMed Scopus (197) Google Scholar) later expanded on this idea with their kin recognition hypothesis in which they suggested that resident Golgi proteins form very large hetero-oligomers with proteins in the same cisternae and that the size of these oligomers prevents their partitioning into transport vesicles destined for the next compartment. Work done by Nilsson et al. (13.Nilsson T. Hoe M.H. Slusarewicz P. Rabouille C. Watson R. Hunte F. Watzele G. Berger E.G. Warren G. EMBO J. 1994; 13: 562-574Crossref PubMed Scopus (233) Google Scholar, 14.Nilsson T. Rabouille C. Hui N. Watson R. Warren G. J. Cell Sci. 1996; 109: 1975-1989Crossref PubMed Google Scholar) demonstrated that such hetero-oligomers were formed by the α-mannosidase II andN-acetylglucosaminyltransferase I of the medial Golgi and that their formation correlated with the localization of these two glycosyltransferases in this compartment. Similar hetero-oligomers were not observed for the β1,4-galactosyltransferase or ST6Gal I (6.Munro S. EMBO J. 1995; 14: 4695-4704Crossref PubMed Scopus (345) Google Scholar). In this manuscript we demonstrate that the ability of the STtyr and STcys isoforms of the ST6Gal I to form insoluble oligomers correlates with the extent of their localization in the Golgi. In contrast, the length of the transmembrane region does not seem to impact Golgi localization or trafficking and processing of either isoform. We also investigate the effects of other ST6Gal I mutants and assess the potential role of STcys disulfide bond formation in Golgi localization. We conclude that the differences in the conformation of the lumenal domains of the two isoform rather than the ability of the STcys to form additional disulfide bonds leads to the increased ability of the STcys to form oligomers. Tissue culture media and reagents, including Dulbecco's modified Eagle's medium (DMEM), and Lipofectin were purchased from Life Technologies, Inc. Fetal bovine serum was obtained from Atlanta Biologicals (Norcross, GA). Sequenase enzyme was obtained from U.S. Biochemical Corp. Fluorescein isothiocyanate-conjugated goat anti-rabbit IgG was purchased from EY laboratories (San Mateo, CA). Horseradish peroxidase-conjugated goat anti-rabbit IgG was purchased from Jackson Immunoresearch Laboratories, Inc. (West Grove, PA). BCIP/NBT Color Development Substrate for detection of alkaline phosphatase-conjugated antibodies was purchased from Promega (Madison, WI). FTO2B rat hepatoma cells were obtained from Dr. Carolyn Bruzdzinski (University of Illinois at Chicago, Chicago, IL). Protein A-Sepharose Fast Flow and α-35S-dATP were purchased from Amersham Pharmacia Biotech. Columns for DNA purification were obtained from Qiagen Inc. (Chatsworth, CA). Protein molecular weight standards were purchased from Bio-Rad. 35S-Express protein labeling mix was purchased from NEN Life Science Products. QuickChangeTM site-directed mutagenesis kit was purchased from Stratagene (La Jolla, CA). SuperSignal West Pico chemiluminescence reagent, biotinyl N-hydroxylsuccinimide ester, and streptavidin-agarose were purchased from Pierce. All other chemicals, including alkaline phosphatase-conjugated goat anti-rabbit IgG, were purchased from Sigma. The SA23 and SA29 chimeras of STcys were constructed as described previously (15.Dahdal R.Y. Colley K.J. J. Biol. Chem. 1993; 268: 26310-26319Abstract Full Text PDF PubMed Google Scholar). The SA23 and SA29 chimeras of STtyr were constructed by replacing an internalBglII fragment (nucleotides 323–930) of STcys SA23 and SA29 mutants with the identical fragment from the STtyr cDNA. In these chimeric proteins, the transmembrane (or signal anchor) region of ST6Gal I (FSLFILVFLLFAVICVW) was replaced with sequences from the influenza neuraminidase transmembrane region (IFTIGSICMVVGIISLILQIGNF in the SA23 chimera or IFTIGSICMVVGIISLILQIGNIISIWIS in the SA29 chimera). To construct the STser, STphe, STtyr C129S, and STtyr N158Q mutants, we used the QuickChangeTM site-directed mutagenesis kit (Stratagene) and the STtyr-pSVL plasmid as a template. The following oligonucleotides were used in the construction of the STtyr mutants: STphe, TATAAAGTATCCAAGGGACCGG and CCGGTCCCTTGAAGGATACTTTATA; STser, TATAAAGTATCCTCAAAGGGACCGG and CCGGTCCCTTTGAGGATACTTTATA; STtyr C139S, GCACTGCGTTCCCACCTTCGAGACC and GGTCTCGAAGGTGGGAACG- CAGTGC; and STtyr N158Q, GATTTTCCCTTCCAGACGACTGAGTGGG and CCCACTCAGTCGTCTGG- AAGGGAAAATC. COS-1 cells maintained in DMEM, 10% fetal bovine serum were plated on 100-mm tissue culture dishes or on 12-mm coverslips and grown in a 37 °C, 5% CO2 incubator until 50–70% confluent. Cells were transfected using the Lipofectin and Opti-MEM I with 55 μm β-mercaptoethanol according to the Life Technologies, Inc. instructions and as described previously (15.Dahdal R.Y. Colley K.J. J. Biol. Chem. 1993; 268: 26310-26319Abstract Full Text PDF PubMed Google Scholar). Expression of transfected proteins was typically allowed to continue for 16 h. COS-1 cells expressing wild type STtyr or STcys or the SA23, SA29, STser, STphe, STtyr C139S or STtyr N158Q mutants were processed for immunofluorescence microscopy as described previously (2.Ma J. Qian R. Rausa III, F.M. Colley K.J. J. Biol. Chem. 1997; 272: 672-679Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar, 15.Dahdal R.Y. Colley K.J. J. Biol. Chem. 1993; 268: 26310-26319Abstract Full Text PDF PubMed Google Scholar, 16.Colley K.J. Lee E.U. Paulson J.C. J. Biol. Chem. 1992; 267: 7784-7793Abstract Full Text PDF PubMed Google Scholar). Following the fixation (−20 °C methanol for internal staining or 3% paraformaldehyde for surface staining) and blocking steps, cells were incubated for 45 min with a 1:100 dilution of a rabbit affinity purified antibody raised against a soluble form of the rat liver ST6Gal I (2.Ma J. Qian R. Rausa III, F.M. Colley K.J. J. Biol. Chem. 1997; 272: 672-679Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar) in blocking buffer (5% normal goat serum in phosphate-buffered saline (PBS)). Following PBS washes, a goat anti-rabbit secondary antibody conjugated to fluorescein isothiocyanate and diluted 1:100 in blocking buffer was incubated with the cells. Washing and mounting was performed as described previously (2.Ma J. Qian R. Rausa III, F.M. Colley K.J. J. Biol. Chem. 1997; 272: 672-679Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). Immunofluorescence staining was visualized and photographed using a Nikon Axiophot microscope equipped with epifluorescence illumination and a 60× oil immersion Plan Apochromat objective. Metabolic labeling of cells and immunoprecipitation of expressed proteins were performed as described previously using 35S-Express protein labeling mix (100 μCi/ml) and methionine- and cysteine-free DMEM (2.Ma J. Qian R. Rausa III, F.M. Colley K.J. J. Biol. Chem. 1997; 272: 672-679Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). Cells were chased for various times in 4 ml of DMEM, 10% fetal bovine serum and lysed in immunoprecipitation buffer (50 mm Tris-HCl, pH 7.5, 150 mm NaCl, 5 mm EDTA, 0.5% Nonidet P-40, 0.1% SDS). Proteins were immunoprecipitated and processed for SDS-polyacrylamide gel electrophoresis on 10% gels as described previously (2.Ma J. Qian R. Rausa III, F.M. Colley K.J. J. Biol. Chem. 1997; 272: 672-679Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). Separated, radiolabeled proteins were visualized by fluorography and exposure to x-ray film. Prestained protein molecular markers (Bio-Rad) used in this study are 203 kDa, myosin; 115–118 kDa, β-galactosidase; 79–86 kDa, bovine serum albumin; 48.7–51.6 kDa, ovalbumin; 33–35 kDa, carbonic anhydrase; 28–29 kDa, soybean trypsin inhibitor; 21 kDa, lysozyme; and 8 kDa, aprotinin. The pH-dependent insolubility assay is based on the protocol of Schweizer et al. (17.Schweizer A. Rohrer J. Hauri H.-P. Kornfeld S. J. Cell Biol. 1994; 126: 25-39Crossref PubMed Scopus (52) Google Scholar). -Golgi membranes were prepared from rat liver according to the method of Fleischer and Kervina (18.Fleischer S. Kervina M. Methods Enzymol. 1974; 31: 6-41Crossref PubMed Scopus (380) Google Scholar) and in the presence of 100 mmiodoacetamide, as described previously (19.Ma J. Colley K.J. J. Biol. Chem. 1996; 271: 7758-7766Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). Rat liver Golgi membranes were centrifuged for 20 min in an Airfuge at 35 psi. The pellet was resuspended in 1 ml of MNT buffers (20 mm MES, 30 mm Tris, 100 mm NaCl, 1.25 mm EDTA, 1 mm EGTA, 100 mm iodoacetamide, 1% Triton X-100) of various pH values containing 10 μg/ml leupeptin and 10 μg/ml aprotinin. Resuspension was achieved by repeated (five times) passage through a 25-gauge needle connected to a 1-ml syringe. After a 40-min solubilization on ice, the lysates were transferred to a Beckman SW65 Ti ultracentrifuge tube, and MNT buffers of the proper pH were used to fill the tubes. Following a 1-h centrifugation at 100,000 × g at 4 °C, the pellets were solubilized in Laemmli sample buffer (20.Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (215642) Google Scholar) by sonication. The proteins in the supernatant were recovered by the method of Wessel and Fluegge (21.Wessel D. Fluegge U.I. Anal. Biochem. 1984; 138: 141-143Crossref PubMed Scopus (3306) Google Scholar). Briefly, four volumes of methanol were added to the supernatant, and the mixture was vortexed and then centrifuged for 10 s at 9000 ×g. One volume (based on the original sample volume) was added, and the sample was vortexed and centrifuged at 9000 ×g for 1 min. The upper phase was carefully removed, and three volumes of methanol (based on the original sample volume) were added. After vortexing and centrifugation at 9000 × gfor 2 min, the supernatant was removed, and the protein pellet was air dried and then solubilized in Laemmli sample buffer. The insoluble and soluble fractions were electrophoresed on a 10% SDS-polyacrylamide gel, and the ST was detected by immunoblotting using an affinity purified rabbit anti-rat ST6Gal I antibody (19.Ma J. Colley K.J. J. Biol. Chem. 1996; 271: 7758-7766Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar), an alkaline phosphatase-conjugated secondary antibody, and the BCIP/NBP development method from Promega as described previously (19.Ma J. Colley K.J. J. Biol. Chem. 1996; 271: 7758-7766Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). FTO2B rat hepatoma cells that express endogenous ST6Gal I were metabolically labeled for 1 h and chased for 6 h. Whole cells were scraped from plates in PBS and pelleted. Cell pellets were resuspended and solubilized in 1 ml of MNT buffer of pH 5.8, 6.3, or 8.0 as described above. Insoluble and soluble fractions were isolated as described above, ST proteins were immunoprecipitated from these fractions, and immunoprecipitates were analyzed by SDS-polyacrylamide gel electrophoresis and fluorography. Radiolabeled cell surface proteins were biotinylated using 1 mg/ml biotinylN-hydroxysuccinimide ester prior to cell collection and membrane lysis, as described previously (15.Dahdal R.Y. Colley K.J. J. Biol. Chem. 1993; 268: 26310-26319Abstract Full Text PDF PubMed Google Scholar). After separation into soluble and insoluble fractions, these proteins were recovered using streptavidin-agarose (15.Dahdal R.Y. Colley K.J. J. Biol. Chem. 1993; 268: 26310-26319Abstract Full Text PDF PubMed Google Scholar) and analyzed by SDS-polyacrylamide gel electrophoresis and fluorography. COS-1 cells were transfected with wild type STtyr or STcys or the STtyr N158Q mutant proteins as described above. The cells were then trypsinized, washed once with PBS, and suspended in 5 volumes of homogenization medium (0.25 msucrose, 10 mm Tris-HCl, pH 7.4, 1 mm magnesium acetate, and 100 mm iodoacetamide). Following homogenization with a mini Dounce homogenizer, a Golgi-enriched fraction was isolated by subjecting the membrane mixtures to equilibrium sucrose density gradient centrifugation according to the method described by Xu and Shields (22.Xu H. Shields D. J. Cell Biol. 1993; 122: 1169-1184Crossref PubMed Scopus (99) Google Scholar). All sucrose gradient solutions contained 100 mm iodoacetamide to prevent aberrant disulfide bond formation during membrane preparation procedures. The Golgi membrane-enriched fraction was collected, washed once with 100 mm iodoacetamide, and pelleted by centrifugation at 39,000 rpm for 1 h. The pellets were resuspended in 2 ml of MNT buffer of either pH 6.3 or pH 8.0. After a 10-min solubilization on ice, one half of the membrane lysate was transferred to a Beckman SW65 Ti ultracentrifuge tube for separation into soluble and pelleted material, whereas the other half of the cell lysate was reserved as the total protein control. Following a 1-h centrifugation at 100,000 ×g at 4 °C, the pellets were solubilized in Laemmli sample buffer (20.Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (215642) Google Scholar) by sonication, and proteins in the supernatant and the total protein control were recovered by methanol precipitation. Briefly, four volumes of methanol were added, and the mixture was incubated at −20 °C overnight and then centrifuged for 15 min at 3000 × g. The supernatant was removed, and the protein pellet was air dried and solubilized in Laemmli sample buffer (20.Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (215642) Google Scholar) by sonication. The insoluble and soluble fractions and the total protein control were electrophoresed on a 10% SDS-polyacrylamide gel, and the ST was detected by immunoblotting using the affinity purified rabbit anti-rat ST6Gal I antibody, horseradish peroxidase-conjugated goat anti-rabbit IgG, and the SuperSignal West Pico chemiluminescence reagent (Pierce). Quantitation of the detected ST bands were done as described previously using the ImageQuant program (23.Chen C. Colley K.J. Glycobiology. 2000; 10 (in press)Google Scholar). COS-1 cells were transfected with wild type STtyr or STcys or the mutant proteins as described above. The cells were trypsinized, washed once with PBS, and suspended in five volumes of homogenization medium (0.25m sucrose, 10 mm Tris-HCl, pH 7.4, 1 mm magnesium acetate, and 100 mmiodoacetamide). Following homogenization with a mini Dounce homogenizer, membrane mixtures were subjected to equilibrium sucrose density gradients for the isolation of a Golgi-enriched fraction according to the method described by Xu and Shields (22.Xu H. Shields D. J. Cell Biol. 1993; 122: 1169-1184Crossref PubMed Scopus (99) Google Scholar) and as described above. To analyze the formation of disulfide bonded dimers and high molecular mass oligomers, the Golgi-enriched membrane fractions from cells expressing these proteins were treated with Laemmli sample buffer (20.Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (215642) Google Scholar) with or without 5% β-mercaptoethanol at 100 °C for 10 min. Samples were electrophoresed on a 10% SDS-polyacrylamide gel and then transferred to nitrocellulose membranes for immunoblotting. ST proteins were detecting by immunoblotting as described above. Work from several laboratories has demonstrated a primary role for the transmembrane domain in the Golgi localization of glycosyltransferases and chimeric proteins made from glycosyltransferase sequences (reviewed in Refs. 11.Machamer C.E. Trends Cell Biol. 1991; 1: 141-144Abstract Full Text PDF PubMed Scopus (84) Google Scholar, 24.Munro S Trends Cell Biol. 1998; 8: 11-15Abstract Full Text PDF PubMed Scopus (224) Google Scholar, and 25.Colley K.J. Glycobiology. 1997; 7: 1-13Crossref PubMed Scopus (288) Google Scholar). Elegant work from the laboratory of Munro (6.Munro S. EMBO J. 1995; 14: 4695-4704Crossref PubMed Scopus (345) Google Scholar) demonstrated that increasing the length of the Golgi-retained chimeric protein's transmembrane domain led to an increase in this protein's cell surface expression, whereas decreasing the length of the transmembrane domain of a plasma membrane protein led to an increase in its Golgi localization. Masibay et al. (7.Masibay A.S. Balaji P.J. Boeggeman E.E. Quasba P.K. J. Biol. Chem. 1993; 268: 9908-9916Abstract Full Text PDF PubMed Google Scholar) observed similar results when the length of the transmembrane domain of the β1,4-galactosyltransferase was altered. In contrast, previous experiments in our laboratory showed that increasing the length of the STcys isoform transmembrane domain from 17 amino acids to 23 (SA23) and 29 (SA29) amino acids by replacing it with all or part of the influenza neuraminidase transmembrane region did not increase the expression of this protein on the cell surface (15.Dahdal R.Y. Colley K.J. J. Biol. Chem. 1993; 268: 26310-26319Abstract Full Text PDF PubMed Google Scholar). At the time these experiments were performed, we were unaware that the ST6Gal I was expressed as two isoforms and that one of these, the STtyr, is not stably retained in the Golgi but moves to a post-Golgi compartment where it is cleaved and secreted (2.Ma J. Qian R. Rausa III, F.M. Colley K.J. J. Biol. Chem. 1997; 272: 672-679Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). When the two isoforms were identified, we hypothesized that the STtyr, which is transiently retained in the Golgi, is localized to the Golgi by a bilayer thickness mechanism based on the length of the transmembrane domain, whereas the STcys, which is stably retained in the Golgi, is localized by an oligomerization mechanism involving lumenal sequences as well as its transmembrane domain. To test our hypothesis, we have analyzed SA23 and SA29 transmembrane domain chimeras of the STtyr isoform for both increases in the rate of cleavage and secretion and increased cell surface expression (please see "Materials and Methods" for transmembrane sequences of the two chimeric proteins). In addition, we have re-evaluated the same chimeric forms of the STcys isoform for the possibility that they are cleaved and secreted (Fig. 1). STtyr-pSVL and STcys-pSVL and their SA23 and SA29 forms were transiently expressed in COS-1 cells. Expressing cells were metabolically labeled for 1 h and chased for 6 h, and ST proteins were immunoprecipitated and analyzed by SDS-polyacrylamide gel electrophoresis as described under "Materials and Methods." We found that increasing the length of the STtyr transmembrane region did not increase its rate of cleavage and secretion from COS-1 cells (Fig. 1, STtyr: WT, SA23, and SA29). Forty-two percent of both the STtyr and its SA23 chimera were found in the medium after a 6 h chase, while the SA29 STtyr chimera was secreted more slowly, with only 21% of this protein found in the medium after a 6 h chase. In addition, STcys and its SA23 and SA29 chimeras were not cleaved and secreted (Fig.2, STcys: wild type, SA23, and SA29). We previously demonstrated that the level of cell surface staining did not increase when the length of the STcys transmembrane domain was increased in the SA23 or SA29 chimeras (15.Dahdal R.Y. Colley K.J. J. Biol. Chem. 1993; 268: 26310-26319Abstract Full Text PDF PubMed Google Scholar). Expression of the STtyr and its SA23 and SA29 chimeras in COS-1 cells followed by indirect immunofluorescence microscopy showed that there were no differences in the intracellular Golgi or cell surface staining patterns of these three proteins (Fig. 2). We conclude from these data that the length of the transmembrane domain is not the primary determinant of stable Golgi localization and that the bilayer thickness mechanism, if used, is not the major mechanism of Golgi localization for either isoform of the ST6Gal I.Figure 2The cell surface expression of STtyr is not increased by increasing the length of its transmembrane region.COS-1 cells transiently expressing the wild type STtyr isoform or the SA23 or SA29 transmembrane mutants were fixed using 3% paraformaldehyde (Surface) or fixed and permeabilized using −20 °C methanol (Internal), blocked with 5% normal goat serum in PBS and incubated with rabbit anti-rat ST6Gal I antibody for 1 h. After washing, cells were incubated with fluorescein isothiocyanate-conjugated goat anti-rabbit IgG for 1 h and washed, and coverslips were mounted as described under "Experimental Procedures." Cells were visualized and photographed using a Nikon Axiophot microscope equipped with epifluorescence illumination and a 60× oil immersion Plan Apochromat objective. Magnification, ×750.View Large Image Figure ViewerDownload Hi-res image Download (PPT) The observation that a difference in a single amino acid in the catalytic domain of the ST6Gal I alters the trafficking of the protein suggested that the conformation of the STtyr and STcys catalytic domains might be different. This idea and the results of the experiments described above led us to formulate a second
Referência(s)