Monomers of the NhaA Na+/H+ Antiporter of Escherichia coli Are Fully Functional yet Dimers Are Beneficial under Extreme Stress Conditions at Alkaline pH in the Presence of Na+ or Li+
2007; Elsevier BV; Volume: 282; Issue: 37 Linguagem: Inglês
10.1074/jbc.m704469200
ISSN1083-351X
AutoresAbraham Rimon, Tzvi Tzubery, Etana Padan,
Tópico(s)Drug Transport and Resistance Mechanisms
ResumoNhaA, the Na+/H+ antiporter of Escherichia coli, exists in the native membrane as a homodimer of which two monomers have been suggested to be attached by a β-hairpin at the periplasmic side of the membrane. Constructing a mutant deleted of the β-hairpin, NhaA/Δ(Pro45-Asn58), revealed that in contrast to the dimeric mobility of native NhaA, the mutant has the mobility of a monomer in a blue native gel. Intermolecular cross-linking that monitors dimers showed that the mutant exists only as monomers in the native membrane, proteoliposomes, and when purified in β-dodecyl maltoside micelles. Furthermore, pull-down experiments revealed that, whereas as expected for a dimer, hemagglutinin-tagged wild-type NhaA co-purified with His-tagged NhaA on a Ni2+-NTA affinity column, a similar version of the mutant did not. Remarkably, under routine stress conditions (0.1 m LiCl, pH 7 or 0.6 m NaCl, pH 8.3), the monomeric form of NhaA is fully functional. It conferred salt resistance to NhaA- and NhaB-deleted cells, and whether in isolated membrane vesicles or reconstituted into proteoliposomes exhibited Na+/H+ antiporter activity and pH regulation very similar to wild-type dimers. Remarkably, under extreme stress conditions (0.1 m LiCl or 0.7 m NaCl at pH 8.5), the dimeric native NhaA was much more efficient than the monomeric mutant in conferring extreme stress resistance. NhaA, the Na+/H+ antiporter of Escherichia coli, exists in the native membrane as a homodimer of which two monomers have been suggested to be attached by a β-hairpin at the periplasmic side of the membrane. Constructing a mutant deleted of the β-hairpin, NhaA/Δ(Pro45-Asn58), revealed that in contrast to the dimeric mobility of native NhaA, the mutant has the mobility of a monomer in a blue native gel. Intermolecular cross-linking that monitors dimers showed that the mutant exists only as monomers in the native membrane, proteoliposomes, and when purified in β-dodecyl maltoside micelles. Furthermore, pull-down experiments revealed that, whereas as expected for a dimer, hemagglutinin-tagged wild-type NhaA co-purified with His-tagged NhaA on a Ni2+-NTA affinity column, a similar version of the mutant did not. Remarkably, under routine stress conditions (0.1 m LiCl, pH 7 or 0.6 m NaCl, pH 8.3), the monomeric form of NhaA is fully functional. It conferred salt resistance to NhaA- and NhaB-deleted cells, and whether in isolated membrane vesicles or reconstituted into proteoliposomes exhibited Na+/H+ antiporter activity and pH regulation very similar to wild-type dimers. Remarkably, under extreme stress conditions (0.1 m LiCl or 0.7 m NaCl at pH 8.5), the dimeric native NhaA was much more efficient than the monomeric mutant in conferring extreme stress resistance. Homeostasis of Na+ and H+ is crucial for survival of all living cells. Sodium/proton antiporters have a major role in maintaining and regulating the cytosolic pH and Na+ concentration in prokaryotes (1Padan E. Tzubery T. Herz K. Kozachkov L. Rimon A. Galili L. Biochim. Biophys. Acta. 2004; 1658: 2-13Crossref PubMed Scopus (122) Google Scholar, 2Padan E. Venturi M. Gerchman Y. Dover N. Biochim. Biophys. Acta. 2001; 1505: 144-157Crossref PubMed Scopus (295) Google Scholar), plants (3Yamaguchi T. Blumwald E. Trends Plant Sci. 2005; 10: 615-620Abstract Full Text Full Text PDF PubMed Scopus (750) Google Scholar), and animals (4Orlowski J. Grinstein S. Pflugers Arch. 2004; 447: 549-565Crossref PubMed Scopus (563) Google Scholar, 5Putney L.K. Denker S.P. Barber D.L. Annu. Rev. Pharmacol. Toxicol. 2002; 42: 527-552Crossref PubMed Scopus (434) Google Scholar, 6Wakabayashi S. Hisamitsu T. Pang T. Shigekawa M. J. Biol. Chem. 2003; 278: 43580-43585Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar, 7Slepkov E.R. Rainey J.K. Sykes B.D. Fliegel L. Biochem. J. 2007; 401: 623-633Crossref PubMed Scopus (198) Google Scholar). The main Na+/H+ antiporter in the cytoplasmic membrane of Escherichia coli, NhaA, the family prototype, is widely spread in enterobacteria and has orthologs throughout the biological kingdom including humans (2Padan E. Venturi M. Gerchman Y. Dover N. Biochim. Biophys. Acta. 2001; 1505: 144-157Crossref PubMed Scopus (295) Google Scholar, 8Brett C.L. Donowitz M. Rao R. Am. J. Physiol. Cell Physiol. 2005; 288: C223-C239Crossref PubMed Scopus (457) Google Scholar). NhaA is a 42-kDa integral membrane protein. It enables E. coli to survive at alkaline pH in the presence of Na+ using the respiration-dependent proton gradient to maintain a constant intracellular pH of 7.5 and extrude Na+ from the cytoplasm (reviewed in Ref. 9Padan E. Bibi E. Masahiro I. Krulwich T.A. Biochim. Biophys. Acta. 2005; 1717: 67-88Crossref PubMed Scopus (581) Google Scholar). It is an electrogenic antiporter with a stoichiometry of 2H+/Na+ (10Taglicht D. Padan E. Schuldiner S. J. Biol. Chem. 1993; 268: 5382-5387Abstract Full Text PDF PubMed Google Scholar). Similar to many other both prokaryotic (9Padan E. Bibi E. Masahiro I. Krulwich T.A. Biochim. Biophys. Acta. 2005; 1717: 67-88Crossref PubMed Scopus (581) Google Scholar) and eukaryotic (4Orlowski J. Grinstein S. Pflugers Arch. 2004; 447: 549-565Crossref PubMed Scopus (563) Google Scholar, 5Putney L.K. Denker S.P. Barber D.L. Annu. Rev. Pharmacol. Toxicol. 2002; 42: 527-552Crossref PubMed Scopus (434) Google Scholar, 6Wakabayashi S. Hisamitsu T. Pang T. Shigekawa M. J. Biol. Chem. 2003; 278: 43580-43585Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar) Na+/H+ antiporters, NhaA is strongly dependent on pH. Its rate of activity changes over three orders of magnitude between pH 7.0 and 8.5 (1Padan E. Tzubery T. Herz K. Kozachkov L. Rimon A. Galili L. Biochim. Biophys. Acta. 2004; 1658: 2-13Crossref PubMed Scopus (122) Google Scholar, 9Padan E. Bibi E. Masahiro I. Krulwich T.A. Biochim. Biophys. Acta. 2005; 1717: 67-88Crossref PubMed Scopus (581) Google Scholar, 11Taglicht D. Padan E. Schuldiner S. J. Biol. Chem. 1991; 266: 11289-11294Abstract Full Text PDF PubMed Google Scholar). This pH activation, underpinning the mechanism of pH homeostasis, is accompanied by conformational changes (12Venturi M. Rimon A. Gerchman Y. Hunte C. Padan E. Michel H. J. Biol. Chem. 2000; 275: 4734-4742Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar, 13Gerchman Y. Rimon A. Padan E. J. Biol. Chem. 1999; 274: 24617-24624Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar, 14Tzubery T. Rimon A. Padan E. J. Biol. Chem. 2004; 279: 3265-3272Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar). The recently determined three-dimensional crystal structure of the acid pH down-regulated NhaA (15Hunte C. Screpanti M. Venturi M. Rimon A. Padan E. Michel H. Nature. 2005; 534: 1197-1202Crossref Scopus (539) Google Scholar) reveals a novel fold, providing insights into the relationship between the structure and function of NhaA. A cytoplasmic funnel opens to the cytoplasm and ends in the middle of the membrane at the putative cation binding site. A cluster of negatively charged amino acids at the cytoplasmic orifice of the funnel have been assigned a role in the pH sensor, transmitting pH signals to regulate the activity of the antiporter. Many transporters and channels exist in the native membrane as oligomers. In most cases, the functional/structural role of the oligomeric state is still an unknown (16Veenhoff L.M. Heuberger E.H. Poolman B. Trends Biochem. Sci. 2002; 27: 242-249Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar). Several experimental approaches have strongly suggested that NhaA is a dimer in the native membrane; genetic complementation (17Gerchman Y. Rimon A. Venturi M. Padan E. Biochemistry. 2001; 40: 3403-3412Crossref PubMed Scopus (79) Google Scholar), biochemical pull-down experiments (17Gerchman Y. Rimon A. Venturi M. Padan E. Biochemistry. 2001; 40: 3403-3412Crossref PubMed Scopus (79) Google Scholar), intermolecular cross-linking (17Gerchman Y. Rimon A. Venturi M. Padan E. Biochemistry. 2001; 40: 3403-3412Crossref PubMed Scopus (79) Google Scholar), ESR 2The abbreviations used are:ESRelectron spin resonanceHAhemagglutininTMStransmembrane segmentDDMβ-dodecyl-d-maltosideBTPBis-Tris propaneBMH1,6-bis-(maleimido) hexaneo-PDMN,N′-ophenylenedimaleimidep-PDMN,N′-p-phenylenedimaleimideMTS-2-MTS1,2-ethanediyl bismethanethiosulfonateDMFdimethylformamideCL-NhaAHis-tagged Cys-less NhaAmAbmonoclonal antibodyNTAnitrilotriacetic acid studies (18Hilger D. Jung H. Padan E. Wegener C. Vogel K.P. Steinhoff H.J. Jeschke G. Biophys. J. 2005; 89: 1328-1338Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar, 19Hilger D. Polyhach Y. Padan E. Jung H. Jeschke G. Biophys. J. 2007; (In press)PubMed Google Scholar), and cryo-electron microscopy of two-dimensional crystals (20Williams K.A. Geldmacher-Kaufer U. Padan E. Schuldiner S. Kuhlbrandt W. EMBO J. 1999; 18: 3558-3563Crossref PubMed Scopus (112) Google Scholar, 21Williams K.A. Nature. 2000; 403: 112-115Crossref PubMed Scopus (204) Google Scholar). electron spin resonance hemagglutinin transmembrane segment β-dodecyl-d-maltoside Bis-Tris propane 1,6-bis-(maleimido) hexane N,N′-ophenylenedimaleimide N,N′-p-phenylenedimaleimide 1,2-ethanediyl bismethanethiosulfonate dimethylformamide His-tagged Cys-less NhaA monoclonal antibody nitrilotriacetic acid The dimeric state has been suggested to affect the pH response of NhaA. Intermolecular cross-linking between two NhaA monomers at the dimer interface changes the pH profile of the antiporter (17Gerchman Y. Rimon A. Venturi M. Padan E. Biochemistry. 2001; 40: 3403-3412Crossref PubMed Scopus (79) Google Scholar). Nevertheless, the question of whether the dimeric state of NhaA is essential for its structure and/or function in Na+/H+ exchange and/or pH regulation has remained elusive. In the present work, we constructed a deletion mutant of NhaA that encodes monomeric NhaA. This mutant allowed, for the first time, a comparison between the functionality of monomeric and dimeric NhaA. The crystal structure of NhaA revealed a β-hairpin at the periplasmic face of the molecule (15Hunte C. Screpanti M. Venturi M. Rimon A. Padan E. Michel H. Nature. 2005; 534: 1197-1202Crossref Scopus (539) Google Scholar). A recent comparison of the x-ray structure of NhaA monomers to NhaA dimers observed in two-dimensional crystals (22Screpanti E. Padan E. Rimon A. Michel H. Hunte C. J. Mol. Biol. 2006; 362: 192-202Crossref PubMed Scopus (36) Google Scholar) 3M. Appel and W. Kuhlbrandt, Max Planck Institute of Biophysics, Frankfurt/M, personal communication. predicted that the main contact between the monomers is built by two β-hairpins forming a 4-stranded β-sheet. In line with this prediction, strong intermolecular cross-linking in the native membrane was identified between two Cys replacements Ser52, each localized in one β-hairpin (17Gerchman Y. Rimon A. Venturi M. Padan E. Biochemistry. 2001; 40: 3403-3412Crossref PubMed Scopus (79) Google Scholar). ESR studies fully supported these results (18Hilger D. Jung H. Padan E. Wegener C. Vogel K.P. Steinhoff H.J. Jeschke G. Biophys. J. 2005; 89: 1328-1338Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar) and yielded a structural model of the native NhaA dimer (19Hilger D. Polyhach Y. Padan E. Jung H. Jeschke G. Biophys. J. 2007; (In press)PubMed Google Scholar). We therefore constructed the NhaA mutant, NhaA/Δ(Pro45-Asn58), deleted of the β-hairpin. We found that the NhaA/Δ(Pro45-Asn58) protein exists exclusively in a monomeric form both in the native membrane, proteoliposomes, and in DDM micelles. Most importantly, even under routine stress conditions (0.1 m LiCl or 0.6 m NaCl at pH 7 and 0.6 m NaCl at pH 8.3), the monomeric mutant conferred growth resistance and exhibited pH-regulated Na+/H+ antiport activity very similar to the wild-type dimeric NhaA. Strikingly, under extreme stress conditions (pH 8.5 in the presence of 0.7 m NaCl or 0.1 m LiCl), monomeric NhaA/(Δ(Pro45-Asn58) is much less efficient than wild-type dimeric NhaA in conferring growth resistance. Bacterial Strains and Culture Conditions—EP432 is an E. coli K-12 derivative, which is melBLid, ΔnhaA1::kan, ΔnhaB1::cat, ΔlacZY, thr1 (23Pinner E. Kotler Y. Padan E. Schuldiner S. J. Biol. Chem. 1993; 268: 1729-1734Abstract Full Text PDF PubMed Google Scholar). TA16 is nhaA+nhaB+lacIQ (TA15lacIQ) and otherwise isogenic to EP432 (11Taglicht D. Padan E. Schuldiner S. J. Biol. Chem. 1991; 266: 11289-11294Abstract Full Text PDF PubMed Google Scholar). Cells were grown in either L broth (LB) or modified (24Padan E. Maisler N. Taglicht D. Karpel R. Schuldiner S. J. Biol. Chem. 1989; 264: 20297-20302Abstract Full Text PDF PubMed Google Scholar) L broth (LBK). Where indicated, the medium was buffered with 60 mm BTP. Cells were also grown in minimal medium A without sodium citrate (25Davies B. Mingioli E. J. Bacteriol. 1950; 60: 17-28Crossref PubMed Google Scholar) with 0.5% glycerol, 0.01% MgS04·7H20 and thiamine (2.5 μg/ml). For plates, 1.5% agar was used. Antibiotics were 100 μg/ml ampicillin and/or 50 μg/ml kanamycin and/or 12.5 μg/ml tetracyclin. The resistance to Li+ on agar (0.1 m LiCl, pH 7) and Na+ (0.6 m NaCl at pH 7 or pH 8.3) was routinely tested as previously described (24Padan E. Maisler N. Taglicht D. Karpel R. Schuldiner S. J. Biol. Chem. 1989; 264: 20297-20302Abstract Full Text PDF PubMed Google Scholar). When indicated, more extreme stress conditions (0.1 m LiCl or 0.7 m NaCl at pH 8.5) were used for growth on agar or in liquid culture. Plasmids—pAXH (previously called pYG10), a pET20b (Novagen) derivative (26Olami Y. Rimon A. Gerchman Y. Rothman A. Padan E. J. Biol. Chem. 1997; 272: 1761-1768Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar), encodes His-tagged NhaA (if not otherwise stated, henceforth denoted NhaA). pCL-AXH, a pAXH derivative, encodes Cys-less NhaA (CL-NhaA (26Olami Y. Rimon A. Gerchman Y. Rothman A. Padan E. J. Biol. Chem. 1997; 272: 1761-1768Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar)). pAXH2 and pCL-AXH2, derivatives of pAXH and pCL-AXH, respectively, lack a BglII site at position 3382 of the plasmid (27Galili L. Rothman A. Kozachkov L. Rimon A. Padan E. Biochemistry. 2002; 41: 609-617Crossref PubMed Scopus (68) Google Scholar). pAXH3 and pCL-AXH3, derivatives of pAXH2 and pCL-AXH2, respectively, contain the BstXI silent site at position 248 of nhaA (28Kozachkov L. Herz K. Padan E. Biochemistry. 2007; 46: 2419-2430Crossref PubMed Scopus (43) Google Scholar). The compatible plasmids, p100HA (a pBR322 derivative) and p184AXH (a pACYC184 derivative) encode differentially tagged NhaA at the C-terminal end; the former with the hemagglutinin epitope (NhaA-(HA)), the latter with a His tag (NhaA-(His)6 (17Gerchman Y. Rimon A. Venturi M. Padan E. Biochemistry. 2001; 40: 3403-3412Crossref PubMed Scopus (79) Google Scholar). Plasmids encoding mutation in NhaA are designated by the name of the plasmid followed by the mutation. Construction of Mutants—Site-directed mutagenesis was conducted following a polymerase chain reaction-based protocol (29Ho S.N. Hunt H.D. Horton R.M. Pullen J.K. Pease L.R. Gene (Amst.). 1989; 77: 51-59Crossref PubMed Scopus (6881) Google Scholar). For the Cys replacement mutant, CL-NhaA/S246C, the plasmid pCL-AXH3/S246C was constructed using pCL-AXH3 as a template. To generate the deletion mutant NhaA/Δ(Pro45-Asn58), plasmid pAXH3/Δ(Pro45-Asn58) was constructed using pAXH3 as a template, and the DNA sequence encoding amino acid residues Pro45-Asn58 of nhaA was deleted. The mutagenic primers contained mutagenic bases (designated in bold) that introduced a unique restriction site (XhoI) into the mutated DNA as a silent mutation: CGACTTTCTCGAGACGATGCTGTTATGGATAAATGACGC and GCGTCATTTATCCATAACAGCATCGTCTCGAGAAAGTCG. The end primers were: GTTGTGAGGGTAAACAACTGGCGG and CAACTCAGCTTCCTTTCGGG. The mutations were verified by DNA sequencing of the entire gene, through the ligation junction with the vector plasmid. To generate the deletion mutant in a Cys-less background (NhaA-CL/Δ(Pro45-Asn58)), the BglII-MluI fragment of pCL-AXH3 (682 bp) was ligated with the BglII-MluI fragment (4042 bp) of pAXH3/Δ(Pro45-Asn58). To generate the mutant NhaA-CL/Δ(Pro45-Asn58)/S246C, the BglII-MluI fragment of pCL-AXH3/Δ(Pro45-Asn58) (4042 bp) was ligated with the BglII-MluI fragment of pCL-AXH3/S246C (682 bp). To construct the (His)6 or HA-tagged versions of NhaA/Δ(Pro45-Asn58) mutant (plasmids p184AXH/Δ(Pro45-Asn58) and p100HA/Δ(Pro45-Asn58), respectively), an EcoRI-MunI fragment (576 bp) of p184AXH was replaced with the EcoRI-MunI fragment (534 bp) of pAXH3/Δ(Pro45-Asn58) or the Van91I-MunI fragment (468 bp) of p100HA was replaced with the Van91I-MunI fragment (426 bp) of p AXH3/Δ(Pro45-Asn58), respectively. Plasmids expressing the wild type and the NhaA/Δ(Pro45-Asn58) variants from the native promoter of nhaA were pGMAR100 (30Rimon A. Gerchman Y. Kariv Z. Padan E. J. Biol. Chem. 1998; 273: 26470-26476Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar) and pGMAR100/Δ(Pro45-Asn58), respectively. Overexpression and Affinity Purification of His-tagged Antiporters by Ni2+-NTA Chromatography—To overexpress the plasmids encoding the His-tagged antiporters, TA16 transformed with the respective plasmids was used as described (26Olami Y. Rimon A. Gerchman Y. Rothman A. Padan E. J. Biol. Chem. 1997; 272: 1761-1768Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar). Miniscale purification was performed basically as described (26Olami Y. Rimon A. Gerchman Y. Rothman A. Padan E. J. Biol. Chem. 1997; 272: 1761-1768Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar, 31Venturi M. Padan E. Hunte C. Von Jagow G. Schagger H. A Practical Guide to Membrane Protein Purification. Academic Press, Amsterdam, The Netherlands2002: 179-190Google Scholar). Membranes (0.5–2 mg of membrane protein/ml) were extracted with 1% DDM, and the His-tagged NhaA was affinity-purified on a Ni2+-NTA agarose column (Qiagen, Hilde, Germany) and, if not otherwise stated, eluted by acid elution (25 mm potassium citrate, pH 4, 100 mm KCl, 5 mm MgCl2, and if not otherwise stated 0.03% DDM) and stored as described (22Screpanti E. Padan E. Rimon A. Michel H. Hunte C. J. Mol. Biol. 2006; 362: 192-202Crossref PubMed Scopus (36) Google Scholar, 31Venturi M. Padan E. Hunte C. Von Jagow G. Schagger H. A Practical Guide to Membrane Protein Purification. Academic Press, Amsterdam, The Netherlands2002: 179-190Google Scholar). When indicated, the protein was precipitated in 10% trichloroacetic acid for 0.5 h at 4 °C, centrifuged (21,000 × g,30 min, 4 °C), resuspended in sampling buffer, and loaded on the gel. Detection and Quantifying of NhaA and Its Mutated Proteins in the Membrane—NhaA and its mutated derivatives were quantified by Western analysis using an anti-NhaA monoclonal antibody (mAb1F6) (32Padan E. Venturi M. Michel H. Hunte C. FEBS Lett. 1998; 441: 53-58Crossref PubMed Scopus (41) Google Scholar) or anti-hemagglutinin mAb (Babco, Berkeley, CA), as indicated. The total membrane protein was determined according to Ref. 33Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (220887) Google Scholar. The expression level of His-tagged NhaA mutants was determined by resolving the Ni2+-NTA affinity-purified proteins on SDS-PAGE, staining the gels by Coomassie Blue and quantifying the band densities (Image Gauge, Fuji). SDS-PAGE was as described (26Olami Y. Rimon A. Gerchman Y. Rothman A. Padan E. J. Biol. Chem. 1997; 272: 1761-1768Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar, 34Schagger M.M. Von Jagow G. Anal. Biochem. 1987; 166: 368-379Crossref PubMed Scopus (10572) Google Scholar). In cases where the protein was labeled with fluorescein-5-maleimide (Molecular Probes), the extent of the fluorescence labeling was estimated from photographed gels under UV light (260 nm) as described (35Rimon A. Tzubery T. Galili L. Padan E. Biochemistry. 2002; 41: 14897-14905Crossref PubMed Scopus (26) Google Scholar). The standard deviation was between 5 and 10%. Blue Native-PAGE—Blue native gel electrophoresis was carried out as previously described (36Schagger H. Hunte C. Von Jagow G. Schagger H. Blue Native Electrophoresis. 2nd Ed. Academic Press, Amsterdam2003: 105-130Google Scholar). The main gel and the overlay were made of 10 or 4% polyacrylamide, respectively in 0.015% DDM. The sample buffer contained 50 mm NaCl, 1 mm EDTA, 50 mm imidazole/HCl (pH 7), 0.015% DDM, and 10% glycerol. The cathode buffer contained Coomassie Blue 0.02% (G250, Merck), and 0.015% DDM was added to both the anode and cathode buffers. The electrophoresis was conducted at 15 mA for 1 h. The gel was stained by Coomassie Blue or silver-stained, dried, and the band densities were determined as above. Site-directed Intermolecular Cross-linking—Site-directed intermolecular cross-linking was conducted in situ on membrane vesicles or on NhaA proteoliposomes or on purified protein in detergent solution. Membranes were isolated from TA16 cells expressing the various NhaA mutants. They were resuspended (0.3 mg of protein) in a buffer (0.5 ml) containing 100 mm potassium phosphate, 5 mm MgSO4 (pH 7.4), and one of the freshly prepared homo-bifunctional cross-linkers: 2 mm BMH (Pierce), 1 mm o-PDM, (Sigma), or 2 mm MTS-2-MTS (Toronto Research Chemicals). The stock solutions of the cross-linkers were prepared in DMF at 200 mm, so that the amount of DMF in the reaction mixture did not exceed 1%, a concentration that did not affect the antiporter activity. The suspension was incubated at 26 °C with gentle rotation for 60 min. The reaction with BMH or o-PDM was terminated by the addition of 10 mm β-mercaptoethanol, and the reaction with MTS-2-MTS was terminated by dilution (15-fold) and centrifugation (Beckman, TLA 100.4, 265,000 × g for 20 min at 4 °C). Following extraction of the membranes with 1% DDM and centrifugation, the supernatants were added to 50 μlofNi2+-NTA-agarose beads, and the protein was affinity-purified, resolved on SDS-PAGE (nonreducing conditions in the case of treatment with MTS-2-MTS). The gel was stained by Coomassie Blue, dried, and the band densities were determined as above. When intermolecular cross-linking takes place, a band, corresponding in mobility to that of the NhaA dimer, appears in SDS-PAGE (17Gerchman Y. Rimon A. Venturi M. Padan E. Biochemistry. 2001; 40: 3403-3412Crossref PubMed Scopus (79) Google Scholar, 35Rimon A. Tzubery T. Galili L. Padan E. Biochemistry. 2002; 41: 14897-14905Crossref PubMed Scopus (26) Google Scholar). Intermolecular cross-linking was conducted on NhaA-proteoliposomes (30 μl containing 2 μgof protein) practically as described above. For intermolecular cross-linking of the protein in DDM micelles, the affinity-purified protein (from 2 mg of membrane protein), was eluted (2 ml) at pH 4 in the presence of the indicated DDM concentration and dialyzed twice for 1 h in 100ml containing 5 mm MgS04, 100 mm potassium phosphate (pH 7.4), and the indicated DDM concentration. The reaction mixture for cross-linking contained 0.5 ml of the dialyzed protein, the indicated DDM concentrations and the cross-linking proceeded and terminated as above. Then, the proteins precipitated by 10% trichloroacetic acid were resuspended in sampling buffer and resolved on SDS-PAGE. Each of the cross-linking experiments was repeated at least twice with practically identical results. Determination of the Accessibility to the Cross-linking Reagent—When no cross-linking was observed, it was crucial to ascertain that the Cys replacement was accessible to the reagent. For this purpose, following cross-linking in the membranes, the beads with the affinity-purified protein were resuspended in 100 μl of binding buffer (in the presence of the indicated DDM concentrations), containing 0.2 mm fluorescein 5-maleimide (Molecular Probes) and further incubated for 30 min at 25 °C to determine the free Cys (35Rimon A. Tzubery T. Galili L. Padan E. Biochemistry. 2002; 41: 14897-14905Crossref PubMed Scopus (26) Google Scholar). The protein was eluted by incubation for 30 min at 4 °C in 20 μl of SDS-PAGE sampling buffer supplemented with 300 mm imidazole and centrifuged (Eppendorf, 20, 800 × g, 2 min, 4 °C). The affinitypurified protein was separated on SDS-PAGE. For evaluation of the fluorescence labeling, SDS-PAGE gels were photographed under UV light (260 nm) as described (35Rimon A. Tzubery T. Galili L. Padan E. Biochemistry. 2002; 41: 14897-14905Crossref PubMed Scopus (26) Google Scholar). Then, the gels were stained by Coomassie Blue to identify the bands with mobility corresponding to that of NhaA monomer and dimer (17Gerchman Y. Rimon A. Venturi M. Padan E. Biochemistry. 2001; 40: 3403-3412Crossref PubMed Scopus (79) Google Scholar, 35Rimon A. Tzubery T. Galili L. Padan E. Biochemistry. 2002; 41: 14897-14905Crossref PubMed Scopus (26) Google Scholar). The magnitude of fluorescence normalized per protein reflects inversely the accessibility to the cross-linking reagent. When the accessibility of the purified NhaA variant was tested in the presence of the indicated concentrations of DDM, following cross-linking, 0.2 mm fluorescein 5-maleimide was added to the reaction mixture, and incubation continued for 30 min as above. Then, the proteins were trichloroacetic acid-precipitated and processed as above. Isolation of Membrane Vesicles, Assay of Na+(Li+)/H+ Antiport Activity—EP432 cells transformed with the respective plasmids were grown in LBK, and everted membrane vesicles were prepared and used to determine the Na+/H+ or Li+/H+ antiport activity (37Rosen B.P. Methods Enzymol. 1986; 125: 328-386Crossref PubMed Scopus (114) Google Scholar, 38Goldberg E.B. Arbel T. Chen J. Karpel R. Mackie G.A. Schuldiner S. Padan E. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 2615-2619Crossref PubMed Scopus (184) Google Scholar). The assay of antiport activity was based on the measurement of Na+-or Li+-induced changes in ΔpH measured by acridine orange, a fluorescent probe of ΔpH maintained across the membrane. The fluorescence assay was performed with 2.5 ml of reaction mixture containing 50–100 μg of membrane protein, 0.5 μm acridine orange, 150 mm KCl, 50 mm BTP, and 5 mm MgCl2, and the pH was titrated with HCl. After energization (down arrow in Fig. 6A) with either ATP (2 mm) or d-lactate (2 mm), quenching of the fluorescence was allowed to achieve a steady state and then Na+ (10 mm) was added (up arrow in Fig. 6A). A reversal of the fluorescence level (dequenching) indicates that protons are exiting the vesicles in antiport with Na+. As shown previously, the magnitude of dequenching is a good estimate of the antiport activity (39Schuldiner S. Fishkes H. Biochemistry. 1978; 17: 706-711Crossref PubMed Scopus (104) Google Scholar), and the concentration of the ion that gives half-maximal dequenching is a good estimate of the apparent Km of the antiporter (39Schuldiner S. Fishkes H. Biochemistry. 1978; 17: 706-711Crossref PubMed Scopus (104) Google Scholar, 40Tsuboi Y. Inoue H. Nakamura N. Kanazawa H. J. Biol. Chem. 2003; 278: 21467-21473Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar). The concentration range of the cations tested was 0.01–100 mm at the indicated pH values, and the apparent Km values were calculated by linear regression of a Lineweaver-Burk plot. High pressure membranes were prepared as previously described (13Gerchman Y. Rimon A. Padan E. J. Biol. Chem. 1999; 274: 24617-24624Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar). Reconstitution of NhaA into Proteoliposomes and Measurement of ΔpH-driven 22Na Uptake—NhaA proteoliposomes were reconstituted and ΔpH-driven 22Na uptake was determined as previously described (11Taglicht D. Padan E. Schuldiner S. J. Biol. Chem. 1991; 266: 11289-11294Abstract Full Text PDF PubMed Google Scholar, 30Rimon A. Gerchman Y. Kariv Z. Padan E. J. Biol. Chem. 1998; 273: 26470-26476Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). All experiments were repeated at least twice with practically identical results. Construction of the β-Hairpin Deletion Mutant NhaA/ Δ(Pro45-Asn58)—Constructing a monomeric NhaA can be most helpful in allowing a straightforward comparison between NhaA dimers and monomers with respect to functional and structural properties, and deduction thereof of the functional/structural role of the dimeric state. We could apply this approach because of the structural data available for NhaA. The crystal structure of NhaA revealed a β-hairpin formed by amino acid residues from Pro45 to Asn58 in the loop between helices Ia and II at the periplasmic side of the NhaA monomer (Ref. 15Hunte C. Screpanti M. Venturi M. Rimon A. Padan E. Michel H. Nature. 2005; 534: 1197-1202Crossref Scopus (539) Google Scholar and Fig. 1A). Recently (22Screpanti E. Padan E. Rimon A. Michel H. Hunte C. J. Mol. Biol. 2006; 362: 192-202Crossref PubMed Scopus (36) Google Scholar),3 the three-dimensional crystal structure of two NhaA monomers were fitted to the three-dimensional reconstructed map of NhaA dimer obtained by cryoelectron microscopy of two-dimensional crystals (20Williams K.A. Geldmacher-Kaufer U. Padan E. Schuldiner S. Kuhlbrandt W. EMBO J. 1999; 18: 3558-3563Crossref PubMed Scopus (112) Google Scholar). It has been suggested that two β-hairpins form an anti-parallel β-sheet that hold the monomers together in the native dimer at the periplasmic side of the membrane. Furthermore, based on the crystal structure and measuring of distance distribution between spin labels (bound to Cys replacements in NhaA) by a pulsed electron paramagnetic resonance (DEER), a model of the physiological NhaA dimer has been obtained. It revealed that the NhaA dimer interface is formed
Referência(s)