MDM2: A Novel Mineralocorticoid-Responsive Gene Involved in Aldosterone-Induced Human Vascular Structural Remodeling
2006; Elsevier BV; Volume: 169; Issue: 2 Linguagem: Inglês
10.2353/ajpath.2006.051351
ISSN1525-2191
AutoresYasuhiro Nakamura, S. Suzuki, Takashi Suzuki, Katsuhiko Ono, Ikumi Miura, Fumitoshi Satoh, Takuya Moriya, Haruo Saito, Shogo Yamada, Sadayoshi Ito, Hironobu Sasano,
Tópico(s)Cardiovascular, Neuropeptides, and Oxidative Stress Research
ResumoAldosterone has been demonstrated to play an important role in the pathogenesis of various cardiovascular diseases. Vascular structural remodeling, including vascular smooth muscle cell (VSMC) proliferation, has been also reported in small resistance arteries of patients with primary aldosteronism. Therefore, in this study, we examined whether genes involved in the regulation of the cell cycle were induced by aldosterone alone in cultured human VSMCs and in human small resistance arteries. Results of these studies eventually demonstrated that MDM2, one of the genes involved in anti-apoptosis and cell growth, was markedly increased in mineralocorticoid receptor (MR)-positive VSMCs by aldosterone in all microarray, reverse transcriptase-polymerase chain reaction, immunoblotting, and immunofluorescence analyses. In addition, an analysis using small interfering RNA demonstrated that this gene product was involved in cell proliferation of VSMCs induced by aldosterone. Eplerenone, a specific MR antagonist, inhibited this gene induction by aldosterone in VSMCs. MDM2 protein was also more abundant in VSMCs of small resistance arteries in patients with primary aldosteronism compared with a control population. MDM2 is therefore considered one of the mineralocorticoid-responsive genes that regulates cell proliferation of VSMCs induced by MR-mediated aldosterone stimulation, possibly playing an important role in aldosterone-induced vascular structural remodeling. Aldosterone has been demonstrated to play an important role in the pathogenesis of various cardiovascular diseases. Vascular structural remodeling, including vascular smooth muscle cell (VSMC) proliferation, has been also reported in small resistance arteries of patients with primary aldosteronism. Therefore, in this study, we examined whether genes involved in the regulation of the cell cycle were induced by aldosterone alone in cultured human VSMCs and in human small resistance arteries. Results of these studies eventually demonstrated that MDM2, one of the genes involved in anti-apoptosis and cell growth, was markedly increased in mineralocorticoid receptor (MR)-positive VSMCs by aldosterone in all microarray, reverse transcriptase-polymerase chain reaction, immunoblotting, and immunofluorescence analyses. In addition, an analysis using small interfering RNA demonstrated that this gene product was involved in cell proliferation of VSMCs induced by aldosterone. Eplerenone, a specific MR antagonist, inhibited this gene induction by aldosterone in VSMCs. MDM2 protein was also more abundant in VSMCs of small resistance arteries in patients with primary aldosteronism compared with a control population. MDM2 is therefore considered one of the mineralocorticoid-responsive genes that regulates cell proliferation of VSMCs induced by MR-mediated aldosterone stimulation, possibly playing an important role in aldosterone-induced vascular structural remodeling. Aldosterone is a steroid hormone synthesized in the zona glomerulosa of human adrenal cortex as a result of stimulation by angiotensin II and others.1Jaffe IZ Mendelsohn ME Angiotensin II and aldosterone regulate gene transcription via functional mineralocortocoid receptors in human coronary artery smooth muscle cells.Circ Res. 2005; 96: 643-650Crossref PubMed Scopus (286) Google Scholar, 2Tsai MJ O'Malley BW Molecular mechanisms of action of steroid/thyroid receptor superfamily members.Annu Rev Biochem. 1994; 63: 451-486Crossref PubMed Scopus (2692) Google Scholar Aldosterone has been demonstrated to bind to the mineralocorticoid receptor (MR) and to increase systemic blood pressure by regulating systemic electrolytes and volume balance in kidney, subsequently resulting in various human cardiovascular diseases.1Jaffe IZ Mendelsohn ME Angiotensin II and aldosterone regulate gene transcription via functional mineralocortocoid receptors in human coronary artery smooth muscle cells.Circ Res. 2005; 96: 643-650Crossref PubMed Scopus (286) Google Scholar However, aldosterone has also been demonstrated to directly exert its effects on cardiovascular systems via MR.1Jaffe IZ Mendelsohn ME Angiotensin II and aldosterone regulate gene transcription via functional mineralocortocoid receptors in human coronary artery smooth muscle cells.Circ Res. 2005; 96: 643-650Crossref PubMed Scopus (286) Google Scholar, 3Pitt B Remme W Zannad F Neaton J Martinez F Roniker B Bittman R Hurley S Kleiman J Gatlin M Eplerenone, a selective aldosterone blocker, in patients with left ventricular dysfunction after myocardial infarction.N Engl J Med. 2003; 348: 1309-1321Crossref PubMed Scopus (4087) Google Scholar For instance, aldosterone has been reported to induce expression of some genes involved in vascular fibrosis, calcification, and inflammation, which are all considered important in pathology of vascular injuries.1Jaffe IZ Mendelsohn ME Angiotensin II and aldosterone regulate gene transcription via functional mineralocortocoid receptors in human coronary artery smooth muscle cells.Circ Res. 2005; 96: 643-650Crossref PubMed Scopus (286) Google Scholar Aldosterone also induce mitogenesis of vascular smooth muscle cells (VSMCs), resulting in vascular structural remodeling under the presence of angiotensin II.4Xiao F Puddefoot JR Barker S Vinson GP Mechanism for aldosterone potentiation of angiotensin II-stimulated rat arterial smooth muscle cell proliferation.Hypertension. 2004; 44: 340-345Crossref PubMed Scopus (80) Google Scholar, 5Min LJ Mogi M Li JM Iwanami J Iwai M Horiuchi M Aldosterone and angiotensin II synergistically induce mitogenic response in vascular smooth muscle cells.Circ Res. 2005; 97: 434-442Crossref PubMed Scopus (144) Google Scholar However, aldosterone itself without the presence of angiotensin II is also considered to cause cardiovascular injuries.6Takeda Y Role of cardiovascular aldosterone in hypertension.Curr Med Chem Cardiovasc Hematol Agents. 2005; 3: 261-266Crossref PubMed Scopus (15) Google Scholar Vascular structural remodeling in small resistance arteries has been reported in patients with primary aldosteronism, where serum aldosterone levels were elevated but serum angiotensin II level is markedly down-regulated.7Rizzoni D Porteri E Castellano M Bettoni G Muiesan ML Muiesan P Giulini SM Agabiti-Rosei E Vascular hypertrophy and remodeling in secondary hypertension.Hypertension. 1996; 28: 785-790Crossref PubMed Scopus (199) Google Scholar In addition, aldosterone itself has been also demonstrated to stimulate proliferation of VSMCs.8Ishizawa K Izawa Y Ito H Miki C Miyata K Fujita Y Kanematsu Y Tsuchiya K Tamaki T Nishiyama A Yoshizumi M Aldosterone stimulates vascular smooth muscle cell proliferation via big mito-gen-activated protein kinase 1 activation.Hypertension. 2005; 46: 1046-1052Crossref PubMed Scopus (78) Google Scholar Therefore, aldosterone may directly induce some MR-responsive gene associated with regulation of the cell cycle in VSMCs, although inflammatory reaction and fibrosis are also very important features for aldosterone-induced vascular injuries and alterations.1Jaffe IZ Mendelsohn ME Angiotensin II and aldosterone regulate gene transcription via functional mineralocortocoid receptors in human coronary artery smooth muscle cells.Circ Res. 2005; 96: 643-650Crossref PubMed Scopus (286) Google Scholar Jaffe and Mendelsohn recently reported that some MR-mediated genes were associated with vascular injuries in VSMCs using microarray analysis.1Jaffe IZ Mendelsohn ME Angiotensin II and aldosterone regulate gene transcription via functional mineralocortocoid receptors in human coronary artery smooth muscle cells.Circ Res. 2005; 96: 643-650Crossref PubMed Scopus (286) Google Scholar Therefore, in this study, we first screened aldosterone-responsive genes involved in regulation of the cell cycle using microarray and quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) analyses as a confirmation of the findings in the cell line derived from MR-positive human VSMCs. We then used immunoblotting and immunoflourescence analysis to further evaluate the expression level of protein of the mineralocorticoid-responsive gene to further confirm the results of microarray analysis above. Eplerenone, a specific MR blocker, has been demonstrated to protect extrarenal tissues from various aldosterone-induced damage.1Jaffe IZ Mendelsohn ME Angiotensin II and aldosterone regulate gene transcription via functional mineralocortocoid receptors in human coronary artery smooth muscle cells.Circ Res. 2005; 96: 643-650Crossref PubMed Scopus (286) Google Scholar, 3Pitt B Remme W Zannad F Neaton J Martinez F Roniker B Bittman R Hurley S Kleiman J Gatlin M Eplerenone, a selective aldosterone blocker, in patients with left ventricular dysfunction after myocardial infarction.N Engl J Med. 2003; 348: 1309-1321Crossref PubMed Scopus (4087) Google Scholar, 9Hu X Li S McMahon EG Lala DS Rudolph AE Molecular mechanisms of mineralocorticoid receptor antagonism by eplerenone.Mini Rev Med Chem. 2005; 5: 709-718Crossref PubMed Scopus (31) Google Scholar Thus, in this study we also examined whether eplerenone may also inhibit an induction of this aldosterone-induced gene product in cultured human VSMCs. We then studied whether the gene product was involved in VSMC proliferation using small interfering RNA (siRNA) of the gene transfection. It then becomes important to examine relative abundance of the gene products in VSMCs of human cardiovascular system in correlation to serum aldosterone levels. So finally, we examined relative abundance of a gene product in VSMCs of human small resistance arteries obtained from patients of hypertension with primary aldosteronism and/or nonfunctioning adrenocortical tumors and normal or normotensive subjects using immunohistochemistry. A cultured human VSMC cell line, ie, HASMC (derived from human abdominal aorta) was commercially obtained from Kurabo Corp. (Osaka, Japan). Characteristics of this cell line have been reported by Iseki et al.10Iseki A Kambe F Okumura K Niwata S Yamamoto R Hayakawa T Seo H Pyrrolidine dithiocarbamate inhibits TNF-alpha-dependent activation of NF-kappaB by increasing intracellular copper level in human aortic smooth muscle cells.Biochem Biophys Res Commun. 2000; 276: 88-92Crossref PubMed Scopus (55) Google Scholar It was cultured in a 75-cm2 flask with F12-K medium containing 5% fetal bovine serum (FBS) at 37°C in a 5% CO2 atmosphere. We examined whether these cells expressed both MR and 11β-hydroxysteroid dehydrogenases (11β-HSD) type 2 using RT-PCR, immunoblotting, and immunocytochemistry, as reported previously.1Jaffe IZ Mendelsohn ME Angiotensin II and aldosterone regulate gene transcription via functional mineralocortocoid receptors in human coronary artery smooth muscle cells.Circ Res. 2005; 96: 643-650Crossref PubMed Scopus (286) Google Scholar, 11Nakamura Y Igarashi K Suzuki T Kanno J Inoue T Tazawa C Saruta M Ando T Moriyama N Furukawa T Ono M Moriya T Ito K Saito H Ishibashi T Takahashi S Yamada S Sasano H E4F1, a novel estrogen-responsive gene in possible atheroprotection, revealed by microarray analysis.Am J Pathol. 2004; 165: 2019-2031Abstract Full Text Full Text PDF PubMed Scopus (10) Google Scholar Primers and antibodies used in this study are summarized in Table 1.12Arcuri F Sestini S Ricci C Runci Y Carducci A Paulesu L Cintorino M Progestin regulation of 11beta-hydroxysteroid dehydrogenase expression in T-47D human breast cancer cells.J Steroid Biochem Mol Biol. 2000; 72: 239-247Crossref PubMed Scopus (11) Google Scholar, 13Lombes M Alfaidy N Eugene E Lessana A Farman N Bonvalet JP Prerequisite for cardiac aldosterone action: mineralocorticoid receptor and 11 beta-hydroxysteroid dehydrogenase in the human heart.Circulation. 1995; 92: 175-182Crossref PubMed Scopus (288) Google Scholar, 14Krozowski Z MaGuire JA Stein-Oakley AN Dowling J Smith RE Andrews RK Immunohistochemical localization of the 11 beta-hydroxysteroid dehydrogenase type II enzyme in human kidney and placenta.J Clin Endocrinol Metab. 1995; 80: 2203-2209Crossref PubMed Google ScholarTable 1Primers and Antibodies Used in This StudyGenePrimer for PCRReferenceAntibodyReferenceMRForward: CAGTCTCCAGTCCCAATAATGTH10E4C9F (Alexis Corp.)Lombes et al13Lombes M Alfaidy N Eugene E Lessana A Farman N Bonvalet JP Prerequisite for cardiac aldosterone action: mineralocorticoid receptor and 11 beta-hydroxysteroid dehydrogenase in the human heart.Circulation. 1995; 92: 175-182Crossref PubMed Scopus (288) Google ScholarReverse: GCAGTGTAGCTGAAGGCATTGT11β-HSD type 2Forward: ACGCAGGCCACAATGAAGTAGHUH23Krozowski et al14Krozowski Z MaGuire JA Stein-Oakley AN Dowling J Smith RE Andrews RK Immunohistochemical localization of the 11 beta-hydroxysteroid dehydrogenase type II enzyme in human kidney and placenta.J Clin Endocrinol Metab. 1995; 80: 2203-2209Crossref PubMed Google ScholarReverse: GCAGCCAGGCTGGATGATGATGArcuri et al12Arcuri F Sestini S Ricci C Runci Y Carducci A Paulesu L Cintorino M Progestin regulation of 11beta-hydroxysteroid dehydrogenase expression in T-47D human breast cancer cells.J Steroid Biochem Mol Biol. 2000; 72: 239-247Crossref PubMed Scopus (11) Google ScholarMDM2 (TG)Forward: TGTAAGTGAACATTCAGGTGsc-965 (Santa Cruz)Tan et al19Tan Z Qu W Tu W Liu W Baudry M Schreiber SS p53 accumulation due to down-regulation of ubiquitin: relevance for neuronal apoptosis.Cell Death Differ. 2000; 7: 675-681Crossref PubMed Scopus (23) Google ScholarReverse: TTCCAATAGTCAGCTAAGGAOhtani et al16Ohtani S Kagawa S Tango Y Umeoka T Tokunaga N Tsunemitsu Y Roth JA Taya Y Tanaka N Fujiwara T Quantitative analysis of p53-targeted gene expression and visualization of p53 transcriptional activity following intratumoral administration of adenoviral p53 in vivo.Mol Cancer Ther. 2004; 3: 93-100PubMed Google ScholarBIRC5Forward: TCCGGTTGCGCTTTCCTReverse: TCTTCTTATTGTTGGTTTCCTTTGCWilliams et al17Williams NS Gaynor RB Scoggin S Verma U Gokaslan T Simmang C Fleming J Tavana D Frenkel E Becerra C Identification and validation of genes involved in the pathogenesis of colorectal cancer using cDNA microarrays and RNA interference.Clin Cancer Res. 2003; 9: 931-946PubMed Google ScholarRPL13AForward: CCTGGAGGAGAAGAGGAAAAGReverse: TTGAGGACCTCTGTGTATTTGAPDHForward: TGAACGGGAAGCTCACTGGReverse: TCCACCACCCTGTTGCTGTAIt was determined that the target gene (TG) in this study was MDM2 by microarray and real-time PCR analyses. The reason for this determination is described in detail in Results. Open table in a new tab It was determined that the target gene (TG) in this study was MDM2 by microarray and real-time PCR analyses. The reason for this determination is described in detail in Results. HASMC was cultured until a subconfluent state was obtained. The medium was then replaced with FBS-free and phenol red-free medium (modified Eagle's medium) (Sigma, St. Louis, MO) to arrest cell proliferation. After 24 hours, the medium was replaced again with phenol red-free and FBS-free medium in the presence of aldosterone (10 nmol/L) or vehicle (0.1% ethanol). After incubation for 8 hours, the cells were subsequently subjected to total RNA extraction for microarray analysis. Total RNA was prepared as previously described.11Nakamura Y Igarashi K Suzuki T Kanno J Inoue T Tazawa C Saruta M Ando T Moriyama N Furukawa T Ono M Moriya T Ito K Saito H Ishibashi T Takahashi S Yamada S Sasano H E4F1, a novel estrogen-responsive gene in possible atheroprotection, revealed by microarray analysis.Am J Pathol. 2004; 165: 2019-2031Abstract Full Text Full Text PDF PubMed Scopus (10) Google Scholar Microarray analysis was performed using a Human 1A Oligo Microarray (Agilent Technologies, Palo Alto, CA) with in situ synthesized 60-mer oligonucleotides representing 17,086 unique human genes. The procedures were described in detail in a previous report.15Nielsen TO Hsu FD Jensen K Cheang M Karaca G Hu Z Hernandez-Boussard T Livasy C Cowan D Dressler L Akslen LA Ragaz J Gown AM Gilks CB van de Rijn M Perou CM Immunohistochemical and clinical characterization of the basal-like subtype of invasive breast carcinoma.Clin Cancer Res. 2004; 10: 5367-5374Crossref PubMed Scopus (2116) Google Scholar In this study, the ratios represented the values up- or down-regulated by 10 nmol/L aldosterone treatment compared with control values. We independently repeated the same experiment twice, and the differences were calculated to further confirm aldosterone-related changes in gene expression obtained from microarray analysis. The ratios of genes increased by more than 2.0-fold by both replicates of 10 nmol/L aldosterone treatment were considered up-regulated via MR when compared with control values. When analyzing possible functions of these detected genes, we used the homepage of HUGO Human Gene Nomenclature Committee (http://www.gene.ucl.ac.uk/nomenclature/) for further examination. These results of microarray analyses were also confirmed by replicated quantitative RT/real-time PCR study. In this study, we regarded a gene that was also significantly up-regulated in RT/real-time PCR study as the target gene (TG) among the genes associated with mitogenesis and cell proliferation that were found to be significantly induced by aldosterone treatment in microarray analysis. Further RT/real-time PCR study was performed in the TG as follows. The VSMCs were further treated with aldosterone (100 pmol/L, 10 nmol/L), aldosterone (10 nmol/L) with eplerenone (100 nmol/L; Pfizer Inc., New York, NY), or vehicle. In addition, two additional flasks were treated with aldosterone (10 nmol/L) after pretreatment with inhibitors of RNA transcription, actinomycin D (ACD; 100 nmol/L; Sigma), or protein translation (Sigma), cycloheximide (CHX; 100 nmol/L; ICN Biomedicals Inc., Irvine, CA). After incubation for 8 hours, the cells were subsequently subjected to total RNA extraction for RT/real-time PCR analysis for target products mRNA expression. The detailed procedure of RT/real-time PCR analysis was previously described.11Nakamura Y Igarashi K Suzuki T Kanno J Inoue T Tazawa C Saruta M Ando T Moriyama N Furukawa T Ono M Moriya T Ito K Saito H Ishibashi T Takahashi S Yamada S Sasano H E4F1, a novel estrogen-responsive gene in possible atheroprotection, revealed by microarray analysis.Am J Pathol. 2004; 165: 2019-2031Abstract Full Text Full Text PDF PubMed Scopus (10) Google Scholar The mRNA levels for target product in each VSMC are summarized as a ratio of RPL13A and evaluated as a ratio (percentage) compared with that of each control cDNA. The information of primers used in this study is summarized in Table 1.16Ohtani S Kagawa S Tango Y Umeoka T Tokunaga N Tsunemitsu Y Roth JA Taya Y Tanaka N Fujiwara T Quantitative analysis of p53-targeted gene expression and visualization of p53 transcriptional activity following intratumoral administration of adenoviral p53 in vivo.Mol Cancer Ther. 2004; 3: 93-100PubMed Google Scholar, 17Williams NS Gaynor RB Scoggin S Verma U Gokaslan T Simmang C Fleming J Tavana D Frenkel E Becerra C Identification and validation of genes involved in the pathogenesis of colorectal cancer using cDNA microarrays and RNA interference.Clin Cancer Res. 2003; 9: 931-946PubMed Google Scholar We independently triplicated the same experiments for confirmation. HASMC was cultured in the phenol red-free medium containing 5% FBS in the presence of aldosterone (10 nmol/L) with and/or without eplerenone (100 nmol/L) or in the presence of vehicle (0.1% ethanol). After incubation for 48 hours, the cells were subsequently subjected to nuclear extraction for immunoblotting analysis. An immunoblotting analysis was performed using 60 μg of each protein. The detailed procedure was previously reported.11Nakamura Y Igarashi K Suzuki T Kanno J Inoue T Tazawa C Saruta M Ando T Moriyama N Furukawa T Ono M Moriya T Ito K Saito H Ishibashi T Takahashi S Yamada S Sasano H E4F1, a novel estrogen-responsive gene in possible atheroprotection, revealed by microarray analysis.Am J Pathol. 2004; 165: 2019-2031Abstract Full Text Full Text PDF PubMed Scopus (10) Google Scholar, 18Dilla T Velasco JA Medina DL Gonzalez-Palacios JF Santisteban P The MDM2 oncoprotein promotes apoptosis in p53-deficient human medullary thyroid carcinoma cells.Endocrinology. 2000; 141: 420-429PubMed Google Scholar In brief, protein samples were electrophoretically transferred to a polyvinylidene difluoride membrane, immunoblotted with antibodies against TG product, and visualized using chemiluminescence techniques.19Tan Z Qu W Tu W Liu W Baudry M Schreiber SS p53 accumulation due to down-regulation of ubiquitin: relevance for neuronal apoptosis.Cell Death Differ. 2000; 7: 675-681Crossref PubMed Scopus (23) Google Scholar The relative amounts of TG protein levels for each band were standardized to the relative OD units as reported previously.11Nakamura Y Igarashi K Suzuki T Kanno J Inoue T Tazawa C Saruta M Ando T Moriyama N Furukawa T Ono M Moriya T Ito K Saito H Ishibashi T Takahashi S Yamada S Sasano H E4F1, a novel estrogen-responsive gene in possible atheroprotection, revealed by microarray analysis.Am J Pathol. 2004; 165: 2019-2031Abstract Full Text Full Text PDF PubMed Scopus (10) Google Scholar In addition, the relative amount of TG protein was evaluated as a ratio compared with control (percentage).18Dilla T Velasco JA Medina DL Gonzalez-Palacios JF Santisteban P The MDM2 oncoprotein promotes apoptosis in p53-deficient human medullary thyroid carcinoma cells.Endocrinology. 2000; 141: 420-429PubMed Google Scholar We also independently triplicated the same experiments to confirm the findings. HASMC was cultured in the phenol red-free medium containing 5% FBS in the presence of aldosterone (10 nmol/L) with and/or without eplerenone (100 nmol/L) or in the presence of vehicle (0.1% ethanol). After incubation for 48 hours, the cells were subsequently fixed, stained, and visualized using TG antibody (Table 1), fluorescein isothiocyanate-conjugated secondary antibody, 4,6-diamidino-2-phenylindole for nuclear staining, and conventional fluorescence microscopy according to the manufacturer's instructions. We also independently triplicated the same experiments for confirmation. siRNAs against TG were commercially obtained from Qiagen (Valencia, CA) and transfected to HASMC. HASMC was then seeded in a 6-well plate at an initial concentration of 100,000 cells/well with F-12K medium containing 5% FBS and cultured until a subconfluent status was achieved. The medium was then replaced with phenol red-free and FBS-free medium to arrest the cell proliferation. After 24 hours, transfections of siRNA for endogenous gene targeting (0, 10, or 100 nmol/L) were performed with RNAiFect transfection reagent (Qiagen), respectively. After transfection, the cells were incubated in phenol red-free medium containing 5% FBS with aldosterone (10 nmol/L) with and/or without eplerenone (100 nmol/L) or in vehicle (0.1% ethanol). We measured the number of cells in each sample as described above after incubation for 48 and 72 hours, respectively, according to a previous report.19Tan Z Qu W Tu W Liu W Baudry M Schreiber SS p53 accumulation due to down-regulation of ubiquitin: relevance for neuronal apoptosis.Cell Death Differ. 2000; 7: 675-681Crossref PubMed Scopus (23) Google Scholar We also examined the number of cells treated by aldosterone (10 nmol/L) with and/or without eplerenone (100 nmol/L), respectively. To evaluate efficiency of transfection to the cells, we examined relative TG mRNAs levels in these cells at 24 hours after transfection of the specific siRNAs. As a positive control, transfections of siRNA for glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 0, 10, or 100 nmol/L; Amersham Biosciences, Piscataway, NJ) were also performed, and relative GAPDH mRNAs were evaluated in the cells. The mRNA levels in each VSMC are summarized as a ratio of RPL13A and were normalized as the ratio at no treatment (0 nmol/L), respectively. Thirty-six cases of adrenocortical tumors (24 primary aldosteronism associated with hypertension and 12 nonfunctioning adenomas associated with no clinical hormonal abnormalities, including normal aldosterone level but with hypertension) were retrieved from surgical pathology files of Tohoku University Hospital. In addition, 12 specimens of histopathologically normal adrenal glands were obtained from autopsy files of individuals without histories of hypertension (from Tohoku University Hospital, Sendai, Japan). These specimens were fixed in 10% formalin for 24 to 48 hours at room temperature and embedded in paraffin wax. The research protocols for this study were approved by the ethics committee at Tohoku University School of Medicine (2004-355). Immunohistochemical analysis was performed using the specific antibody against TG protein (Table 1) by streptavidin-biotin amplification method using a Histofine kit (Nichirei, Tokyo, Japan), as previously described in detail.11Nakamura Y Igarashi K Suzuki T Kanno J Inoue T Tazawa C Saruta M Ando T Moriyama N Furukawa T Ono M Moriya T Ito K Saito H Ishibashi T Takahashi S Yamada S Sasano H E4F1, a novel estrogen-responsive gene in possible atheroprotection, revealed by microarray analysis.Am J Pathol. 2004; 165: 2019-2031Abstract Full Text Full Text PDF PubMed Scopus (10) Google Scholar, 19Tan Z Qu W Tu W Liu W Baudry M Schreiber SS p53 accumulation due to down-regulation of ubiquitin: relevance for neuronal apoptosis.Cell Death Differ. 2000; 7: 675-681Crossref PubMed Scopus (23) Google Scholar, 20Nakamura Y Suzuki T Miki Y Tazawa C Senzaki K Moriya T Saito H Ishibashi T Takahashi S Yamada S Sasano H Estrogen receptors in atherosclerotic human aorta: inhibition of human vascular smooth muscle cell proliferation by estrogens.Mol Cell Endocrinol. 2004; 219: 17-26Crossref PubMed Scopus (58) Google Scholar After a thorough review of immunostained tissue sections, relative immunoreactivity for TG protein in VSMCs of at least 25 resistant small arteries (100 to 300 μm in diameter) adjacent to adrenal tumors or normal glands per case were evaluated by labeling index (LI), a quantitative value that evaluates the numbers of cells positive for TG immunoreactivity in VSMCs.11Nakamura Y Igarashi K Suzuki T Kanno J Inoue T Tazawa C Saruta M Ando T Moriyama N Furukawa T Ono M Moriya T Ito K Saito H Ishibashi T Takahashi S Yamada S Sasano H E4F1, a novel estrogen-responsive gene in possible atheroprotection, revealed by microarray analysis.Am J Pathol. 2004; 165: 2019-2031Abstract Full Text Full Text PDF PubMed Scopus (10) Google Scholar The LIs were independently and blindly evaluated by three of the authors (Y.N., T.S., and H.S.) to obtain immunohistochemical data objectively, and the mean of the three values was used for analysis. Values for all results are shown as mean ± SD. We used one-way analysis of variance followed by the Bonferroni test for comparisons between two different groups. A P value less than 0.05 was considered significant in this study. RT-PCR study confirmed that both MR and 11β-HSD type 2 mRNAs were detected in HASMC (Figure 1A). Negative controls demonstrated no discernible bands (data not shown). MR and 11β-HSD type 2 proteins were also detected in HASMC (Figure 1B). Cellular localization of MR protein in the cells was also studied by immunocytochemical analysis. It was demonstrated that MR protein expression was detectable in both the nucleus and the cytoplasm without ligand stimulation (Figure 1C). After exposure to aldosterone, MR was solely found in the nucleus of the cells (Figure 1D). These findings were similar to results of previous study.1Jaffe IZ Mendelsohn ME Angiotensin II and aldosterone regulate gene transcription via functional mineralocortocoid receptors in human coronary artery smooth muscle cells.Circ Res. 2005; 96: 643-650Crossref PubMed Scopus (286) Google Scholar Table 2 summarized the genes associated with expression ratios of above 2.0 after 8 hours of duplicated 10 nmol/L aldosterone treatment in MR-positive HASMC. These genes were related to mitogenesis/cell growth, inflammation, and transporter of various substances. Among these genes, MDM2 and BIRC5 were known to be involved in cell proliferation and anti-apoptosis.16Ohtani S Kagawa S Tango Y Umeoka T Tokunaga N Tsunemitsu Y Roth JA Taya Y Tanaka N Fujiwara T Quantitative analysis of p53-targeted gene expression and visualization of p53 transcriptional activity following intratumoral administration of adenoviral p53 in vivo.Mol Cancer Ther. 2004; 3: 93-100PubMed Google Scholar, 17Williams NS Gaynor RB Scoggin S Verma U Gokaslan T Simmang C Fleming J Tavana D Frenkel E Becerra C Identification and validation of genes involved in the pathogenesis of colorectal cancer using cDNA microarrays and RNA interference.Clin Cancer Res. 2003; 9: 931-946PubMed Google Scholar, 21Ihling C Haendeler J Menzel G Hess RD Fraedrich G Schaefer HE Zeiher AM Co-expression of p53 and MDM2 in human atherosclerosis: implications for the regulation of cellularity of atherosclerotic lesions.J Pathol. 1998; 185: 303-312Crossref PubMed Scopus (93) Google Scholar In addition, among these two genes, only MDM2 was significantly promoted by aldosterone compared with control in a RT/real-time PCR study (Table 2). Therefore we further examined the features of MDM2 as an aldosterone-responsive gene in HASMC and whether MDM2 was associated with aldosterone-induced promotion of MR-positive VSMC proliferation using further quantitative RT/real-time PCR, immunoblotting analysis, immuno-flourescence analysis, and siRNA transfection assay described above. Results of RT/real-time PCR study demonstrated that aldosterone with CHX also significantly increased MDM2 expression in HASMC compared with controls (P < 0.05) (Figure 2). However, aldosterone with eplerenone and aldosterone with ACD did not in
Referência(s)