Portal de Periódicos da CAPES

mTORC1 Signaling Can Regulate Growth Factor Activation of p44/42 Mitogen-activated Protein Kinases through Protein Phosphatase 2A

2007; Elsevier BV; Volume: 283; Issue: 5 Linguagem: Inglês

10.1074/jbc.m706173200

1083-351X

Franklin C. Harwood, Lili Shu, Peter J. Houghton,

Polyamine Metabolism and Applications

The mTORC1 complex (mammalian target of rapamycin (mTOR)-raptor) is modulated by mitogen-activated protein (p44/42 MAP) kinases (p44/42) through phosphorylation and inactivation of the tuberous sclerosis complex. However, a role for mTORC1 signaling in modulating activation of p44/42 has not been reported. We show that in two cancer cell lines regulation of the p44/42 MAPKs is mTORC1-dependent. In Rh1 cells rapamycin inhibited insulin-like growth factor-I (IGF-I)-stimulated phosphorylation of Thr202 but not Tyr204 and suppressed activation of p44/42 kinase activity. Down-regulation of raptor, which inhibits mTORC1 signaling, had a similar effect to rapamycin in blocking IGF-I-stimulated Tyr204 phosphorylation. Rapamycin did not block maximal phosphorylation of Tyr204 but retarded the rate of dephosphorylation of Tyr204 following IGF-I stimulation. IGF-I stimulation of MEK1 phosphorylation (Ser217/221) was not inhibited by rapamycin. Higher concentrations of rapamycin (≥100 ng/ml) were required to inhibit epidermal growth factor (EGF)-induced phosphorylation of p44/42 (Thr202). Rapamycin-induced inhibition of p44/42 (Thr202) phosphorylation by IGF-I was reversed by low concentrations of okadaic acid, suggesting involvement of protein phosphatase 2A (PP2A). Both IGF-I and EGF caused dissociation of PP2A catalytic subunit (PP2Ac) from p42. Whereas low concentrations of rapamycin (1 ng/ml) inhibited dissociation of PP2Ac after IGF-I stimulation, it required higher concentrations (≥100 ng/ml) to block EGF-induced dissociation, consistent with the ability for rapamycin to attenuate growth factor-induced activation of p44/42. The effect of rapamycin on IGF-I or insulin activation of p44/42 was recapitulated by amino acid deprivation. Rapamycin effects altering the kinetics of p44/42 phosphorylation were completely abrogated in Rh1mTORrr cells that express a rapamycin-resistant mTOR, whereas the effects of amino acid deprivation were similar in Rh1 and Rh1mTORrr cells. These results indicate complex regulation of p44/42 by phosphatases downstream of mTORC1. This suggests a model in which mTORC1 modulates the phosphorylation of Thr202 on p44/42 MAPKs through direct or indirect regulation of PP2Ac. The mTORC1 complex (mammalian target of rapamycin (mTOR)-raptor) is modulated by mitogen-activated protein (p44/42 MAP) kinases (p44/42) through phosphorylation and inactivation of the tuberous sclerosis complex. However, a role for mTORC1 signaling in modulating activation of p44/42 has not been reported. We show that in two cancer cell lines regulation of the p44/42 MAPKs is mTORC1-dependent. In Rh1 cells rapamycin inhibited insulin-like growth factor-I (IGF-I)-stimulated phosphorylation of Thr202 but not Tyr204 and suppressed activation of p44/42 kinase activity. Down-regulation of raptor, which inhibits mTORC1 signaling, had a similar effect to rapamycin in blocking IGF-I-stimulated Tyr204 phosphorylation. Rapamycin did not block maximal phosphorylation of Tyr204 but retarded the rate of dephosphorylation of Tyr204 following IGF-I stimulation. IGF-I stimulation of MEK1 phosphorylation (Ser217/221) was not inhibited by rapamycin. Higher concentrations of rapamycin (≥100 ng/ml) were required to inhibit epidermal growth factor (EGF)-induced phosphorylation of p44/42 (Thr202). Rapamycin-induced inhibition of p44/42 (Thr202) phosphorylation by IGF-I was reversed by low concentrations of okadaic acid, suggesting involvement of protein phosphatase 2A (PP2A). Both IGF-I and EGF caused dissociation of PP2A catalytic subunit (PP2Ac) from p42. Whereas low concentrations of rapamycin (1 ng/ml) inhibited dissociation of PP2Ac after IGF-I stimulation, it required higher concentrations (≥100 ng/ml) to block EGF-induced dissociation, consistent with the ability for rapamycin to attenuate growth factor-induced activation of p44/42. The effect of rapamycin on IGF-I or insulin activation of p44/42 was recapitulated by amino acid deprivation. Rapamycin effects altering the kinetics of p44/42 phosphorylation were completely abrogated in Rh1mTORrr cells that express a rapamycin-resistant mTOR, whereas the effects of amino acid deprivation were similar in Rh1 and Rh1mTORrr cells. These results indicate complex regulation of p44/42 by phosphatases downstream of mTORC1. This suggests a model in which mTORC1 modulates the phosphorylation of Thr202 on p44/42 MAPKs through direct or indirect regulation of PP2Ac. Evidence increasingly implicates the Ser/Thr kinase mammalian target of rapamycin (mTOR) 2The abbreviations used are: mTORmammalian target of rapamycinmTOrrrapamycin-resistant mTORTSCtuberous sclerosis complexPKprotein kinaseMAPKmitogen-activated protein kinasePP2Aprotein phosphatase 2APP2AcPP2A catalytic subunitMEKMAPK/ERK kinaseBSAbovine serum albuminshRNAshort hairpin RNAIGF-Iinsulin-like growth factor IEGFepidermal growth factor. as a central controller of cell growth, proliferation, and survival. mTOR exists in two complexes that have different cellular functions in yeast and mammalian cells (reviewed in Ref. 1Bhaskar P.T. Hay N. Dev. Cell. 2007; 12: 487-502Abstract Full Text Full Text PDF PubMed Scopus (675) Google Scholar). The mTORC1 complex comprises mTOR, raptor, mLST8, PRAS40, and controls initiation of translation of ribosomal proteins and several proteins that regulate cell cycle. Activation of ribosomal S6K1 after mitogen stimulation is dependent on mTORC1 (2Chung J. Kuo C.J. Crabtree G.R. Blenis J. Cell. 1992; 69: 1227-1236Abstract Full Text PDF PubMed Scopus (1026) Google Scholar). Cap-dependent translation is facilitated by mTORC1's phosphorylation and inactivation of 4E-BP1, the suppressor of eukaryotic initiation factor 4E (3Brunn G.J. Hudson C.C. Sekulic A. Williams J.M. Hosoi H. Houghton P.J. Lawrence Jr., J.C. Abraham R.T. Science. 1997; 277: 99-101Crossref PubMed Scopus (809) Google Scholar, 4Jefferies H.B. Reinhard C. Kozma S.C. Thomas G. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 4441-4445Crossref PubMed Scopus (559) Google Scholar). The emerging picture places mTORC1 in a central role in which it senses mitogenic stimuli and amino acid (5Iiboshi Y. Papst P.J. Kawasome H. Hosoi H. Abraham R.T. Houghton P.J. Terada N. J. Biol. Chem. 1999; 274: 1092-1099Abstract Full Text Full Text PDF PubMed Scopus (185) Google Scholar) nutrient (6Hardwick J.S. Kuruvilla F.G. Tong J.K. Shamji A.F. Schreiber S.L. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 14866-14870Crossref PubMed Scopus (466) Google Scholar) conditions or AMP levels (7Inoki K. Zhu T. Guan K.L. Cell. 2003; 115: 577-590Abstract Full Text Full Text PDF PubMed Scopus (3013) Google Scholar, 8Inoki K. Ouyang H. Li Y. Guan K.L. Microbiol. Mol. Biol. Rev. 2005; 69: 79-100Crossref PubMed Scopus (284) Google Scholar) and coordinates many cellular processes related to growth and proliferation. Rapamycin, a macrocyclic lactone antibiotic, is a potent and highly selective inhibitor of mTORC1 (9Bjornsti M.A. Houghton P.J. Nat. Rev. Cancer. 2004; 4: 335-348Crossref PubMed Scopus (1201) Google Scholar). mammalian target of rapamycin rapamycin-resistant mTOR tuberous sclerosis complex protein kinase mitogen-activated protein kinase protein phosphatase 2A PP2A catalytic subunit MAPK/ERK kinase bovine serum albumin short hairpin RNA insulin-like growth factor I epidermal growth factor. The mTORC2 complex (mTOR, rictor, mSIN1, and mLST8) is thought to control actin cytoskeleton organization and protein kinase C (reviewed in Refs. 9Bjornsti M.A. Houghton P.J. Nat. Rev. Cancer. 2004; 4: 335-348Crossref PubMed Scopus (1201) Google Scholar, 10Jacinto E. Hall M.N. Nat. Rev. Mol. Cell Biol. 2003; 4: 117-126Crossref PubMed Scopus (513) Google Scholar, 11Schmelzle T. Hall M.N. Cell. 2000; 103: 253-262Abstract Full Text Full Text PDF PubMed Scopus (1729) Google Scholar, 12Wullschleger S. Loewith R. Hall M.N. Cell. 2006; 124: 471-484Abstract Full Text Full Text PDF PubMed Scopus (4696) Google Scholar). The mTORC2 complex also phosphorylates Akt(Ser473), required for full activation (13Sarbassov D.D. Ali S.M. Kim D.H. Guertin D.A. Latek R.R. Erdjument-Bromage H. Tempst P. Sabatini D.M. Curr. Biol. 2004; 14: 1296-1302Abstract Full Text Full Text PDF PubMed Scopus (2157) Google Scholar) and negative regulation of FOXO1A (14Guertin D.A. Sabatini D.M. Cancer Cell. 2007; 12: 9-22Abstract Full Text Full Text PDF PubMed Scopus (2418) Google Scholar). Activation of mTORC1 by insulin and insulin-like growth factors occurs through activation of phosphatidylinositol 3-kinase and Akt. Akt negatively regulates the tuberous sclerosis complex (TSC) composed of harmartin and tuberin that acts as a GTPase-activating protein to maintain Rheb in the GDP (inactive) form (15Inoki K. Li Y. Xu T. Guan K.L. Genes Dev. 2003; 17: 1829-1834Crossref PubMed Scopus (1424) Google Scholar). Exactly how Rheb activates mTOR is unknown. The activity of TSC is regulated by hypoxia, increases in AMP that activate AMP-PK, a positive regulator of TSC activity, and by MAPKs p44/42 that phosphorylate and inactivate TSC, thus promoting mTORC1 activation (16Tee A.R. Fingar D.C. Manning B.D. Kwiatkowski D.J. Cantley L.C. Blenis J. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 13571-13576Crossref PubMed Scopus (697) Google Scholar, 17Tee A.R. Manning B.D. Roux P.P. Cantley L.C. Blenis J. Curr. Biol. 2003; 13: 1259-1268Abstract Full Text Full Text PDF PubMed Scopus (947) Google Scholar, 18Tee A.R. Anjum R. Blenis J. J. Biol. Chem. 2003; 278: 37288-37296Abstract Full Text Full Text PDF PubMed Scopus (180) Google Scholar, 19Tee A.R. Blenis J. Semin Cell Dev. Biol. 2005; 16: 29-37Crossref PubMed Scopus (267) Google Scholar, 20Brugarolas J. Lei K. Hurley R.L. Manning B.D. Reiling J.H. Hafen E. Witters L.A. Ellisen L.W. Kaelin Jr., W.G. Genes Dev. 2004; 18: 2893-2904Crossref PubMed Scopus (1070) Google Scholar). Akt also phosphorylates and inactivates PRAS40, another negative regulator of mTOR (21Vander Haar E. Lee S.I. Bandhakavi S. Griffin T.J. Kim D.H. Nat. Cell Biol. 2007; 9: 316-323Crossref PubMed Scopus (931) Google Scholar). To date, there is no clear evidence of the exact mechanism by which mTORC1 controls growth-related cellular processes. In vitro, mTORC1 phosphorylates at least two residues (Thr37 and Thr46) of 4E-BP1 (3Brunn G.J. Hudson C.C. Sekulic A. Williams J.M. Hosoi H. Houghton P.J. Lawrence Jr., J.C. Abraham R.T. Science. 1997; 277: 99-101Crossref PubMed Scopus (809) Google Scholar, 22Hara K. Yonezawa K. Kozlowski M.T. Sugimoto T. Andrabi K. Weng Q.P. Kasuga M. Nishimoto I. Avruch J. J. Biol. Chem. 1997; 272: 26457-26463Abstract Full Text Full Text PDF PubMed Scopus (409) Google Scholar, 23Gingras A.C. Gygi S.P. Raught B. Polakiewicz R.D. Abraham R.T. Hoekstra M.F. Aebersold R. Sonenberg N. Genes Dev. 1999; 13: 1422-1437Crossref PubMed Scopus (1007) Google Scholar). Direct phosphorylation of S6K1 has also been reported (24Burnett P.E. Barrow R.K. Cohen N.A. Snyder S.H. Sabatini D.M. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 1432-1437Crossref PubMed Scopus (940) Google Scholar). However, an alternative mechanism has been proposed in which mTOR kinase activity represses the activity of a Ser/Thr phosphatase (protein phosphatase 2A; PP2A) physically associated with S6K1 (25Peterson R.T. Desai B.N. Hardwick J.S. Schreiber S.L. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 4438-4442Crossref PubMed Scopus (429) Google Scholar). This proposal is based on the prevention of rapamycin-induced dephosphorylation of 4E-BP1 by calyculin A and its slight reversal of inhibition of S6K1 activity. Nutrient starvation or rapamycin treatment of Saccharomyces cerevisiae causes PP2A homologues Pph21p and Pph22p and another phosphatase, Sic4p, to dissociate from Tap42p, resulting in G1 arrest (26Di Como C.J. Arndt K.T. Genes Dev. 1996; 10: 1904-1916Crossref PubMed Scopus (440) Google Scholar). However, Tap42 can both inhibit and activate protein phosphatases demonstrating the complex events underlying TOR regulation of transcription (27Duvel K. Santhanam A. Garrett S. Schneper L. Broach J.R. Mol. Cell. 2003; 11: 1467-1478Abstract Full Text Full Text PDF PubMed Scopus (139) Google Scholar). In mammalian cells, α4, the homolog of Tap42p, has been shown to bind the catalytic subunit of PP2A, resulting in enhanced phosphatase activity and an altered substrate specificity (28Murata K. Wu J. Brautigan D.L. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 10624-10629Crossref PubMed Scopus (195) Google Scholar). Some studies using mammalian cells have also shown rapamycin-induced dissociation of PP2A from α4 (28Murata K. Wu J. Brautigan D.L. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 10624-10629Crossref PubMed Scopus (195) Google Scholar, 29Inui S. Sanjo H. Maeda K. Yamamoto H. Miyamoto E. Sakaguchi N. Blood. 1998; 92: 539-546Crossref PubMed Google Scholar). Although the relationship between G1 arrest and rapamycin-induced release of PP2A from α 4 is unknown, such a relationship could imply that mTORC1 exerts pleiotropic effects on many cellular processes involving PP2A (or other protein phosphatases). For example, Type-2A phosphatase activity has been implicated in regulation of transcription, translation, replication, cell growth, metabolism, and survival (30Honkanen R.E. Golden T. Curr. Med. Chem. 2002; 9: 2055-2075Crossref PubMed Scopus (230) Google Scholar, 31Goldberg Y. Biochem. Pharmacol. 1999; 57: 321-328Crossref PubMed Scopus (130) Google Scholar, 32Kloeker S. Reed R. McConnell J.L. Chang D. Tran K. Westphal R.S. Law B.K. Colbran R.J. Kamoun M. Campbell K.S. Wadzinski B.E. Protein Expr. Purif. 2003; 31: 19-33Crossref PubMed Scopus (59) Google Scholar). An alternative interpretation is that α4 differentially regulates Type-2A protein phosphatases (33Prickett T.D. Brautigan D.L. J. Biol. Chem. 2004; 279: 38912-38920Abstract Full Text Full Text PDF PubMed Scopus (33) Google Scholar). Mitogens, such as insulin, rapidly inactivate PP2A (34Begum N. Ragolia L. J. Biol. Chem. 1996; 271: 31166-31171Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar), activate MAPKs, and also activate mTORC1, thus inducing both protein synthesis and transcriptional activation. mTORC1 signaling also appears to positively regulate PP5 activity (35Huang S. Shu L. Easton J. Harwood F.C. Germain G.S. Ichijo H. Houghton P.J. J. Biol. Chem. 2004; 279: 36490-36496Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar). Although previously it had been shown that in NIH3T3 cells rapamycin does not inhibit activation of MAPKs (2Chung J. Kuo C.J. Crabtree G.R. Blenis J. Cell. 1992; 69: 1227-1236Abstract Full Text PDF PubMed Scopus (1026) Google Scholar), there are anecdotal reports that rapamycin can influence activation of MAPK pathways (36Molhoek K.R. Brautigan D.L. Slingluff Jr., C.L. J. Transl. Med. 2005; 3: 39Crossref PubMed Scopus (99) Google Scholar). We were interested in the possible role of mTORC1 in coordinating both translational initiation and MAPK activation after stimulation by growth factors reported to be mitogenic in sarcoma cells (37Remmelink M. Decaestecker C. Darro F. Goldschmidt D. Gebhart M. Pasteels J.L. Kiss R. Salmon I. J. Cancer Res. Clin. Oncol. 1998; 124: 155-164Crossref PubMed Scopus (10) Google Scholar, 38El-Badry O.M. Minniti C. Kohn E.C. Houghton P.J. Daughaday W.H. Helman L.J. Cell Growth & Differ. 1990; 1: 325-331PubMed Google Scholar, 39Toretsky J.A. Steinberg S.M. Thakar M. Counts D. Pironis B. Parente C. Eskenazi A. Helman L. Wexler L.H. Cancer. 2001; 92: 2941-2947Crossref PubMed Scopus (55) Google Scholar, 40Thimmaiah K.N. Easton J. Huang S. Veverka K.A. Germain G.S. Harwood F.C. Houghton P.J. Cancer Res. 2003; 63: 364-374PubMed Google Scholar). Reagents—Rapamycin was obtained from the NCI, National Institutes of Health drug repository (Frederick, MD). PD 98059 and okadaic acid were purchased from Calbiochem (Cambridge, MA). Each compound was dissolved in Me2SO before being added to culture medium (final concentration 0.1%). Polyclonal anti-p44/42 MAPK (Thr202/Tyr204), rpS6, phospho-rpS6 (Ser235/236), phospho-p70S6K1 (Thr389), Akt, phospho-Akt (Ser308 and Ser473), phospho-MEK1/2 (Ser217/221), and MEK1/2 were from Cell Signaling Technology (Beverly, MA). Rabbit polyclonal anti-p42, or mouse monoclonal anti-p44/42 MAPK (Tyr204), were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Cell Lines and Growth Conditions—Culture conditions in serum-containing and serum-free, antibiotic-free media have been described for the human cell lines previously (40Thimmaiah K.N. Easton J. Huang S. Veverka K.A. Germain G.S. Harwood F.C. Houghton P.J. Cancer Res. 2003; 63: 364-374PubMed Google Scholar, 41Hosoi H. Dilling M.B. Liu L.N. Danks M.K. Shikata T. Sekulic A. Abraham R.T. Lawrence Jr., J.C. Houghton P.J. Mol. Pharmacol. 1998; 54: 815-824Crossref PubMed Scopus (165) Google Scholar). Immunoprecipitation—Equivalent numbers of cells (5 × 106) were briefly washed with ice-cold phosphate-buffered saline and lysed in 1 ml of buffer containing 20 mm Tris-HCl (pH 7.5), 150 mm NaCl, 1 mm EDTA, 1 mm EGTA, 2.5 mm sodium pyrophosphate, 1 mm β-glycerolphosphate, 1 mm sodium orthovanadate, 1% Triton X-100, 1 mm phenylmethylsulfonyl fluoride (Cell Signaling Technology), and 1 tablet of protease inhibitor mixture (Roche Complete™ Mini). Cells were frozen (liquid N2 for 5 min) and thawed three times (37 °C for 5 min each) and centrifuged at 14,000 rpm for 10 min at 4 °C, and supernatants were transferred to a fresh tube. Lysates were pre-cleared by adding 2.0 μg of the appropriate control IgG corresponding to the host species of the primary antibody, together with 20 μl of Protein A/G-agarose conjugate and rotated at 4 °C for 1 h. Samples were centrifuged 5 min at 600 × g, and supernatants were transferred to a fresh tube prior to addition of 2 μg of rabbit polyclonal p42 antibody (Santa Cruz Biotechnology). Lysates were rotated overnight at 4 °C, then 20 μl of Protein A/G Plus Beads (Santa Cruz Biotechnology) was added and the mixture was rotated at 4 °C for 4 h. Immunoprecipitates were collected by centrifugation (5 min at 600 × g) and washed four times in ice-cold phosphate-buffered saline. After the final wash the pellet was resuspended in 40 μl of 2× electrophoresis buffer. In Vitro Kinase Assay—Equivalent numbers of cells (2 × 106) were briefly washed with ice-cold phosphate-buffered saline and lysed as described above. A nonradioactive p44/42 MAP Kinase Assay Kit (Cell Signaling Technology) was used according to the manufacturer's instructions. Essentially active phospho-p44/42 (pThr202/pTyr204) was immunoprecipitated using an immobilized monoclonal antibody, and an in vitro kinase assay was performed using Elk-1 protein as substrate. Kinase activity is determined by Western blotting and probing for phospho-Elk-1 (Ser383). Western Blot Analysis—Conditions used for immunoblotting were similar to those reported previously (40Thimmaiah K.N. Easton J. Huang S. Veverka K.A. Germain G.S. Harwood F.C. Houghton P.J. Cancer Res. 2003; 63: 364-374PubMed Google Scholar) with minor modifications. Cultured cells were briefly washed with cold phosphate-buffered saline lysed on ice in SDS sample buffer containing 62.5 mm Tris-HCl (pH 6.8), 2% w/v SDS, 10% glycerol, 50 mm dithiothreitol, and 0.1% w/v bromphenol blue. Lysates were sonicated for 2 s on ice and heated for 5 min at 95 °C before centrifugation at 14,000 rpm for 10 min at 4 °C. Samples from equivalent numbers of cells were separated on a 12% SDS-PAGE and transferred to polyvinylidene difluoride membranes (Immobilon PVDF, Millipore, Bedford, MA). Membranes were incubated with rabbit polyclonal anti-p44/42 MAPK (Thr202/ Tyr204, Cell Signaling Technology), rabbit polyclonal anti-p42, or mouse monoclonal anti-p44/42 MAPK (Tyr204, Santa Cruz Biotechnology, Inc), p70S6K, and pS6 followed by incubation with goat anti-rabbit or anti-mouse IgG conjugated to horseradish peroxidase. Immunoreactive bands were visualized by using Pierce SuperSignal® chemiluminescence substrate (Pierce) on Kodak Biomax™ MR film (Eastman Kodak, Rochester, NY). Quantitation of Immunoreactive Bands—Quantitation of band intensities was achieved following scanning of films using a CanoScan LiDE 35 scanner coupled to a Macintosh G5 computer using NIH Image Software. Signal Intensity (optical density) was calculated by converting gray scale values by comparison with a calibrated photographic gray scale card (Kodak). Reactivity of Antibodies for p44/42 Phospho-peptides—To test the specificity of the anti-p44/42 MAPK (Thr202/Tyr204, Cell Signaling Technology), rabbit polyclonal anti-p42, or mouse monoclonal anti-p44/42 MAPK (Tyr204) antibodies, we prepared the following BSA-conjugated peptides with no sites phosphorylated, single phosphorylation (Tyr204), or dual phosphorylation (Thr202/Tyr204): BSA-Gly-Gly-ADPEHDHTGFLTEYVATRWYRAPEIM, ADPEHDHTGFLTEpYVATRWYRAPEIM, and ADPEHDHTGFLpTEpYVATRWYRAPEIM. Down-regulation of Raptor—To detect whether down-regulation of raptor has the same effects as rapamycin, we used lentivirus encoding raptor shRNA PT972 (America Pharma Source, LLC, Gaithersburg, MD). Rh1 cells (0.3 × 106) were seeded in 35-mm dishes. On the second day, cells were infected with lentivirus (0.6 × 106 viral particles) encoding mismatched control shRNA, raptor shRNA, or left untreated. After 24 h cells were washed twice and placed in serum-free medium. After 48 h cells were stimulated for 10 min with IGF-I, and cell lysates were obtained. Human raptor shRNA (accession number: KIAA1303) were as follows: sense, 5′-GATCCAGGCTAGTCTGTTTCGAAATTTCTTCCTGTCAAAATTTCGAAACAGACTAGCCTTTTTG; antisense, 5′-AATTCCAAAAA GGCTAGTCTGTTTCGAAATTTTGACAGGAAGAAATTTCGAAACAGACTAGCCTG; Control shRNA: sense, 5′-GATCCAGTCCTAAGGTTAAGTCGCCCTCGTTCTAGCGAGGGCGACTTAAACTGAGGTTTTTGG; antisense, 5′-AATTCCAAAAACCTCAGTTTAAGTCGCCCTCGCTAGAACGAGGGCGACTTAACCTTAGGACTG. Kinetics for p44/42 Phosphorylation Is Growth Factor-dependent—Although it is well established that mTORC1 regulates cap-dependent translation and transcription of specific genes, whether it integrates these activities with growth factor-induced activation of the p44/42 pathway is unclear. To investigate if mTOR regulated growth factor activation of these MAPKs, we initially used Rh1 human Ewing sarcoma cells (43Smith M.A. Morton C.L. Phelps D. Girtman K. Neale G. Houghton P.J. Pediatr Blood Cancer. 2007; (in press)Google Scholar). In serum-free culture these cells are sensitive to rapamycin (44Dilling M.B. Dias P. Shapiro D.N. Germain G.S. Johnson R.K. Houghton P.J. Cancer Res. 1994; 54: 903-907PubMed Google Scholar), a highly specific inhibitor of mTOR in the mTORC1 complex. Full activation of p44/42 (insulin-stimulated MAP2 kinase (ERK1) and MAPK 2 (ERK2)) requires phosphorylation of both Thr202 and Tyr204 (45Anderson N.G. Maller J.L. Tonks N.K. Sturgill T.W. Nature. 1990; 343: 651-653Crossref PubMed Scopus (796) Google Scholar) mediated by a single kinase, MEK1. As shown in Fig. 1A when serum-starved Rh1 cells were stimulated with growth factors, the p44/42 kinases were rapidly activated, as shown by assays with an antibody that recognizes simultaneously phosphorylated Thr202 and Tyr204. Phosphorylation was maximal after 5 min of stimulation with IGF-I and after 15 min of stimulation with platelet-derived growth factor, after which phosphorylation declined. Maximal phosphorylation occurred after 5 min of stimulation with epidermal growth factor (EGF) and was maintained for at least 60 min. Phosphorylation of p44/42 in Rh1 Cells Is mTOR-dependent—We next determined whether phosphorylation of p44/42 was dependent on mTORC1 signaling (Fig. 1B). The cells were grown overnight in serum-free conditions, exposed to various concentrations of rapamycin for 2 h, then stimulated for 5 min with growth factors. Although each growth factor stimulated p44/42 phosphorylation in cells that had not been treated with rapamycin, exposure to 10 ng/ml rapamycin significantly decreased activation by platelet-derived growth factor and essentially abrogated activation by IGF-I. Activation by EGF was less sensitive to rapamycin inhibition but was markedly attenuated at higher concentrations (0.1–1 μg/ml). To determine whether this inhibitory effect resulted specifically from rapamycin inhibition of mTORC1 signaling, we used Rh1 cells that express an mTOR mutant with an amino acid substitution (Ser2035→ Ile). This mutant has reduced binding affinity for the rapamycin-FKBP12 (FK506-binding protein) complex (3Brunn G.J. Hudson C.C. Sekulic A. Williams J.M. Hosoi H. Houghton P.J. Lawrence Jr., J.C. Abraham R.T. Science. 1997; 277: 99-101Crossref PubMed Scopus (809) Google Scholar). The mutant mTOR is thus rapamycin-resistant (designated mTORrr), hence retains mTORC1 signaling in the presence of rapamycin that inhibits endogenous mTOR in the mTORC1 complex. Rh1 and Rh1mTORrr cells were grown in serum-free medium and stimulated with IGF-I for 5 min. Rapamycin suppressed phosphorylation of p44/42 (Thr202/Tyr204) in Rh1 cells but had no inhibitory effect in Rh1mTORrr cells (Fig. 1C). Thus, the effect of rapamycin on p44/42 phosphorylation appears to be mediated specifically through inhibition of mTORC1. IGF-I-induced phosphorylation of Akt (Thr308 and Ser473), a protein kinase proximal to mTORC1 in the IGF-I signaling pathway (47Sekulic A. Hudson C.C. Homme J.L. Yin P. Otterness D.M. Karnitz L.M. Abraham R.T. Cancer Res. 2000; 60: 3504-3513PubMed Google Scholar), was similar in both lines; hence, the signaling from the IGF-I receptor to mTORC2, the putative Akt(Ser473) kinase (48Sarbassov D.D. Guertin D.A. Ali S.M. Sabatini D.M. Science. 2005; 307: 1098-1101Crossref PubMed Scopus (5257) Google Scholar), in these clones appears to be intact. Thus, the initial mitogen induced phosphorylation of p44/42 appears to be dependent on mTORC1. We next determined whether the effect of rapamycin was sustained. Serum-starved Rh1 and Rh1mTORrr cells were stimulated with IGF-I, and p44/42 phosphorylation was measured over 60 min. As shown in Fig. 1D, IGF-I caused a rapid, but transient increase in p44/42 phosphorylation that was maximal at 5 min, but decreased thereafter. Rapamycin inhibited phosphorylation of p44/42 at both 5 and 15 min during the peak period of stimulation, but at subsequent time points there was no difference between control and rapamycin-treated Rh1 cells. In contrast, rapamycin had no effect on IGF-I-induced phosphorylation of p44/42 in Rh1mTORrr cells. Thus, inhibition of mTOR by rapamycin abrogates the initial robust stimulation of phosphorylation of p44/42 by IGF-I. In contrast, rapamycin did not inhibit IGF-I-stimulated phosphorylation of Tyr204 but did retard the rate of dephosphorylation in Rh1 cells. Rapamycin had no effect in Rh1mTORrr cells (Fig. 1E), again supporting the contention that effects on p44/42 phosphorylation are mTORC1-dependent. Thus, signaling through mTORC1 has contrasting effects on the kinetics of phosphorylation and dephosphorylation of p44/42 at Thr202 and Tyr204. To further test the role of mTORC1 signaling in regulating p44/42 phosphorylation, we used lentivirus delivery of shRNA to down-regulate raptor. Down-regulation of raptor was confirmed by Western blot analysis and inhibited IGF-I-stimulated phosphorylation of S6 (data not shown). As shown in Fig. 1F, down-regulation of raptor had an essentially identical effect to treatment with rapamycin, inhibiting IGF-I-stimulated dual phosphorylation of p44/42 (Thr202/Tyr204). However, down-regulation of raptor also inhibited IGF-I-stimulated phosphorylation of Tyr204. In contrast, the control shRNA had no effect on IGF-I-stimulated phosphorylation of p44/42 at either residue. Rapamycin Inhibits IGF-I Stimulation of Phosphorylation of Thr202, but Not Tyr204 Phosphorylation of p44/42—We decided to focus on how signaling through mTORC1 inhibited the initial IGF-I-induced phosphorylation of Thr202. As discussed above, the mechanism by which mTORC1 regulates downstream targets remains controversial. mTORC1 demonstrates in vitro kinase activity, but it has been proposed that activation of S6K1 in vivo is through suppression of protein phosphatase 2A (25Peterson R.T. Desai B.N. Hardwick J.S. Schreiber S.L. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 4438-4442Crossref PubMed Scopus (429) Google Scholar). Although there is no evidence to associate mTOR physically with p44/42, a role for protein phosphatase 2A in regulating p44/42 activation has been proposed. It thus seemed possible that the effect of rapamycin on p44/42(Thr202) phosphorylation was a consequence of protein phosphatase activation that either directly affected p44/42 or affected an upstream kinase. As little as 15 min of exposure to rapamycin almost completely eliminated IGF-I-induced dual Thr202 and Tyr204 phosphorylation of p44/42. In contrast, rapamycin treatment did not inhibit Tyr204 phosphorylation after 5-min stimulation with IGF-I (Fig. 2, A and B). Phosphorylation of Thr202 and Tyr204 is mediated by a single kinase, MEK1 (49Zhou B. Wang Z.X. Zhao Y. Brautigan D.L. Zhang Z.Y. J. Biol. Chem. 2002; 277: 31818-31825Abstract Full Text Full Text PDF PubMed Scopus (180) Google Scholar). Because Tyr204 phosphorylation was stimulated by IGF-I in the presence of rapamycin it suggested that the effect of rapamycin is directed at p44/42 rather than against MEK1 or other upstream kinases. To test this, we examined the effect of rapamycin on IGF-I-induced phosphorylation of MEK1 (Ser217/221) in the activation loop of subdomain VIII. As shown in Fig. 2A, MEK1 was equally phosphorylated in the absence or presence of rapamycin. We also used the MEK1 inhibitor PD098059. As shown in Fig. 2C, IGF-I-stimulated phosphorylation of p44/42 was inhibited in a concentration-dependent manner by the MEK1 inhibitor. Importantly, inhibition was detected by both the antibody that recognizes dual Thr202/Tyr204 phosphorylation and the antibody that