Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Expression and Localization of the Mouse Homologue of the Yeast V-ATPase 21-kDa Subunit c′′ (Vma16p)

2001; Elsevier BV; Volume: 276; Issue: 36 Linguagem: Inglês

10.1074/jbc.m104682200

ISSN

1083-351X

Autores

Tsuyoshi Nishi, Shoko Kawasaki-Nishi, Michael Forgac,

Tópico(s)

Photosynthetic Processes and Mechanisms

Resumo

We have identified a cDNA encoding the mouse homologue of the yeast V-ATPase 21-kDa subunit c′′ (Vma16p). The encoded protein contains 205 amino acid residues with five putative membrane spanning segments and shows 48% identity and 64% similarity to the yeast protein. Despite this homology, however, the mouse cDNA does not complement the phenotype of a yeast strain in which the VMA16 gene has been disrupted. Northern blot analysis demonstrated that the 21-kDa subunit is expressed in most tissues examined and showed an expression pattern almost identical to that of the 16-kDa proteolipid subunit (subunit c). The presence of multiple mRNA species suggests the existence of alternatively spliced forms of the 21-kDa subunit which, from Southern blot analysis, are derived from a single gene. Promoter analysis using the luciferase reporter gene revealed that a region 186 bases upstream of the initiation site is sufficient to show a low level of transcriptional activity but that transcription is significantly enhanced by inclusion of the region −186 to −706. The 21-kDa protein was Myc-tagged and the 16-kDa protein was HA-tagged and the tagged proteins were co-expressed in COS-1 cells in order to study their intracellular localization by immunofluorescence microscopy. Both proteins showed significant punctate and perinuclear staining and were predominantly co-localized throughout the cell, consistent with their presence in the same V0 complexes. Selective permeabilization of cells with digitonin (to permeabilize the plasma membrane) or Triton X-100 (to permeabilize both intracellular and plasma membranes) followed by immunofluorescence microscopy revealed that the carboxyl terminus of the 21-kDa subunit is exposed on the cytoplasmic side of the membrane whereas the carboxyl terminus of the 16-kDa subunit is located on the lumenal side of the membrane. We have identified a cDNA encoding the mouse homologue of the yeast V-ATPase 21-kDa subunit c′′ (Vma16p). The encoded protein contains 205 amino acid residues with five putative membrane spanning segments and shows 48% identity and 64% similarity to the yeast protein. Despite this homology, however, the mouse cDNA does not complement the phenotype of a yeast strain in which the VMA16 gene has been disrupted. Northern blot analysis demonstrated that the 21-kDa subunit is expressed in most tissues examined and showed an expression pattern almost identical to that of the 16-kDa proteolipid subunit (subunit c). The presence of multiple mRNA species suggests the existence of alternatively spliced forms of the 21-kDa subunit which, from Southern blot analysis, are derived from a single gene. Promoter analysis using the luciferase reporter gene revealed that a region 186 bases upstream of the initiation site is sufficient to show a low level of transcriptional activity but that transcription is significantly enhanced by inclusion of the region −186 to −706. The 21-kDa protein was Myc-tagged and the 16-kDa protein was HA-tagged and the tagged proteins were co-expressed in COS-1 cells in order to study their intracellular localization by immunofluorescence microscopy. Both proteins showed significant punctate and perinuclear staining and were predominantly co-localized throughout the cell, consistent with their presence in the same V0 complexes. Selective permeabilization of cells with digitonin (to permeabilize the plasma membrane) or Triton X-100 (to permeabilize both intracellular and plasma membranes) followed by immunofluorescence microscopy revealed that the carboxyl terminus of the 21-kDa subunit is exposed on the cytoplasmic side of the membrane whereas the carboxyl terminus of the 16-kDa subunit is located on the lumenal side of the membrane. vacuolar proton-translocating adenosine triphosphatase F1F0-ATP synthase expression sequence tag reverse transcriptase-polymerase chain reaction rapid amplification of cDNA ends hemagglutinin The vacuolar (H+)-ATPase (or V-ATPase)1 functions as an ATP-dependent proton pump to acidify intracellular compartments in eukaryotic cells. The V-ATPases are present in a variety of intracellular compartments, including clathrin-coated vesicles, endosomes, lysosomes, Golgi-derived vesicles, chromaffin granules, synaptic vesicles, and the central vacuoles of yeast,Neurospora, and plants (1Stevens T.H. Forgac M. Annu. Rev. Cell Dev. Biol. 1997; 13: 779-808Crossref PubMed Scopus (523) Google Scholar, 2Forgac M. J. Biol. Chem. 1999; 274: 12951-12954Abstract Full Text Full Text PDF PubMed Scopus (264) Google Scholar, 3Bowman E.J. Bowman B.J. J. Exp. Biol. 2000; 203: 97-106Crossref PubMed Google Scholar, 4Kane P.M. Parra K.J. J. Exp. Biol. 2000; 203: 81-87Crossref PubMed Google Scholar, 5Graham L.A. Powell B. Stevens T.H. J. Exp. Biol. 2000; 203: 61-70Crossref PubMed Google Scholar, 6Futai M. Oka T. Sun-Wada G.H. Moriyama Y. Kanazawa H. Wada Y. J. Exp. Biol. 2000; 203: 107-116Crossref PubMed Google Scholar, 7Nelson N. Perzov N. Cohen A. Padler V. Nelson H. J. Exp. Biol. 2000; 203: 89-95Crossref PubMed Google Scholar, 8Sze H. Li X. Palmgren M.G. Plant Cell. 1999; 11: 677-690PubMed Google Scholar). Vacuolar acidification plays an important role in many cellular processes, including receptor-mediated endocytosis, intracellular targeting, protein processing and degradation, and coupled transport. In certain mammalian cells, V-ATPases also function in the plasma membrane to transport protons from the cytoplasm to the extracellular environment (9Brown D. Breton S. J. Exp. Biol. 2000; 203: 137-145Crossref PubMed Google Scholar, 10Wieczorek H. Gruber G. Harvey W.R. Huss M. Merzendorfer H. Zeiske W. J. Exp. Biol. 2000; 203: 127-135Crossref PubMed Google Scholar, 11Chatterjee D. Chakraborty M. Leit M. Neff L. Jamsa-Kellokumpu S. Fuchs R. Baron R. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 6257-6261Crossref PubMed Scopus (133) Google Scholar, 12Swallow C.J. Grinstein S. Rotstein O.D. J. Biol. Chem. 1990; 265: 7645-7654Abstract Full Text PDF PubMed Google Scholar, 13Martinez-Zaguilan R. Lynch R. Martinez G. Gillies R. Am. J. Physiol. 1993; 265: C1015-C1029Crossref PubMed Google Scholar). In osteoclasts, plasma membrane V-ATPases play a role in bone resorption (11Chatterjee D. Chakraborty M. Leit M. Neff L. Jamsa-Kellokumpu S. Fuchs R. Baron R. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 6257-6261Crossref PubMed Scopus (133) Google Scholar) whereas in intercalated cells in the kidney they function in renal acidification (9Brown D. Breton S. J. Exp. Biol. 2000; 203: 137-145Crossref PubMed Google Scholar). V-ATPases in the plasma membrane of tumor cells have also been implicated in metastasis (13Martinez-Zaguilan R. Lynch R. Martinez G. Gillies R. Am. J. Physiol. 1993; 265: C1015-C1029Crossref PubMed Google Scholar). The V-ATPases from fungi, plants, and animals are structurally very similar and are composed of two functional domains termed V1 and V0 (1Stevens T.H. Forgac M. Annu. Rev. Cell Dev. Biol. 1997; 13: 779-808Crossref PubMed Scopus (523) Google Scholar, 2Forgac M. J. Biol. Chem. 1999; 274: 12951-12954Abstract Full Text Full Text PDF PubMed Scopus (264) Google Scholar, 3Bowman E.J. Bowman B.J. J. Exp. Biol. 2000; 203: 97-106Crossref PubMed Google Scholar, 4Kane P.M. Parra K.J. J. Exp. Biol. 2000; 203: 81-87Crossref PubMed Google Scholar, 5Graham L.A. Powell B. Stevens T.H. J. Exp. Biol. 2000; 203: 61-70Crossref PubMed Google Scholar, 6Futai M. Oka T. Sun-Wada G.H. Moriyama Y. Kanazawa H. Wada Y. J. Exp. Biol. 2000; 203: 107-116Crossref PubMed Google Scholar, 7Nelson N. Perzov N. Cohen A. Padler V. Nelson H. J. Exp. Biol. 2000; 203: 89-95Crossref PubMed Google Scholar, 8Sze H. Li X. Palmgren M.G. Plant Cell. 1999; 11: 677-690PubMed Google Scholar). The V1 domain is a peripheral complex of molecular mass of 570 kDa composed of eight different subunits of molecular masses 70–14 kDa (subunits A-H) that is responsible for ATP hydrolysis. The V0 domain is a 260-kDa integral complex composed of five subunits of molecular mass 100–17 kDa (subunits a, d, c, c′, and c′′) that is responsible for proton translocation. The V-ATPases are thus similar in structure to the ATP synthases (F-ATPases) of mitochondria, chloroplasts and bacteria (14Weber J. Senior A.E. Biochim. Biophys. Acta. 1997; 1319: 19-58Crossref PubMed Scopus (396) Google Scholar, 15Fillingame R.H. Jiang W. Dmitriev O.Y. J. Exp. Biol. 2000; 203: 9-17Crossref PubMed Google Scholar, 16Cross R.L. Duncan T.M. J. Bioenerg. Biomembr. 1996; 28: 403-408Crossref PubMed Scopus (67) Google Scholar, 17Pedersen P.L. J. Bioenerg. Biomembr. 1996; 28: 389-395Crossref PubMed Scopus (58) Google Scholar, 18Capaldi R.A. Aggeler R. Wilkens S. Gruber G. J. Bioenerg. Biomembr. 1996; 28: 397-401Crossref PubMed Scopus (62) Google Scholar, 19Futai M. Omote H. J. Bioenerg. Biomembr. 1996; 28: 409-414Crossref PubMed Scopus (31) Google Scholar), both in overall structure (20Dschida W.J. Bowman B.J. J. Biol. Chem. 1992; 267: 18783-18789Abstract Full Text PDF PubMed Google Scholar, 21Boekema E.J. Ubbink-Kok T. Lolkema J.S. Brisson A. Konings W.N. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 14291-14293Crossref PubMed Scopus (92) Google Scholar, 22Wilkens S. Vasilyeva E. Forgac M. J. Biol. Chem. 1999; 274: 31804-31810Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar, 23Wilkens S. Capaldi R.A. Nature. 1998; 393: 29Crossref PubMed Scopus (135) Google Scholar) and as revealed by sequence homology of several of the subunits (24Zimniak L. Dittrich P. Gogarten J.P. Kibak H. Taiz L. J. Biol. Chem. 1988; 263: 9102-9112Abstract Full Text PDF PubMed Google Scholar, 25Bowman E.J. Tenney K. Bowman B.J. J. Biol. Chem. 1988; 263: 13994-14001Abstract Full Text PDF PubMed Google Scholar, 26Mandel M. Moriyama Y. Hulmes J.D. Pan Y.C. Nelson H. Nelson N. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 5521-5524Crossref PubMed Scopus (239) Google Scholar). Of the five V0 subunits, three (subunits c, c′, and c′′) are highly hydrophobic proteins termed proteolipids because of their ability to be extracted with organic solvents (27Arai H. Berne M. Forgac M. J. Biol. Chem. 1987; 262: 11006-11011Abstract Full Text PDF PubMed Google Scholar). Subunits c and c′ are both 16 kDa and are encoded by the VMA3 andVMA11 genes in yeast (28Nelson H. Nelson N. FEBS Lett. 1989; 247: 147-153Crossref PubMed Scopus (124) Google Scholar, 29Umemoto N. Ohya Y. Anraku Y. J. Biol. Chem. 1991; 266: 24526-24532Abstract Full Text PDF PubMed Google Scholar) whereas subunit c′′ is 21 kDa and is encoded by the VMA16 gene (30Apperson M. Jensen R.E. Suda K. Witte C. Yaffe M.P. Biochem. Biophys. Res. Commun. 1990; 168: 574-579Crossref PubMed Scopus (24) Google Scholar, 31Hirata R. Graham L.A. Takatsuki A. Stevens T.H. Anraku Y. J. Biol. Chem. 1997; 272: 4795-4803Abstract Full Text Full Text PDF PubMed Scopus (191) Google Scholar). All three proteins are homologous to each other and to subunit c of the F-ATPase, although they contain different numbers of putative transmembrane segments. Subunits c and c′ of the V-ATPase contain four putative transmembrane helices and appear to have arisen by gene duplication and fusion of the gene encoding the F-ATPase subunit c (26Mandel M. Moriyama Y. Hulmes J.D. Pan Y.C. Nelson H. Nelson N. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 5521-5524Crossref PubMed Scopus (239) Google Scholar), which is composed of two transmembrane helices (15Fillingame R.H. Jiang W. Dmitriev O.Y. J. Exp. Biol. 2000; 203: 9-17Crossref PubMed Google Scholar). Subunit c′′ (Vma16p) contains an additional putative transmembrane helix at the amino terminus (31Hirata R. Graham L.A. Takatsuki A. Stevens T.H. Anraku Y. J. Biol. Chem. 1997; 272: 4795-4803Abstract Full Text Full Text PDF PubMed Scopus (191) Google Scholar). Each of the proteolipid subunits contains an essential buried carboxyl group that is critical for proton transport (31Hirata R. Graham L.A. Takatsuki A. Stevens T.H. Anraku Y. J. Biol. Chem. 1997; 272: 4795-4803Abstract Full Text Full Text PDF PubMed Scopus (191) Google Scholar). For the F-ATPase c subunit, this critical carboxyl group is in TM2 (15Fillingame R.H. Jiang W. Dmitriev O.Y. J. Exp. Biol. 2000; 203: 9-17Crossref PubMed Google Scholar) whereas for subunits c and c′ of the V-ATPase, the critical residue is located in TM4. Subunit c′′ contains an essential glutamic acid residue in TM3 (31Hirata R. Graham L.A. Takatsuki A. Stevens T.H. Anraku Y. J. Biol. Chem. 1997; 272: 4795-4803Abstract Full Text Full Text PDF PubMed Scopus (191) Google Scholar). Mutation of any of these sites completely abolishes proton transport by the V-ATPase, indicating that each V-ATPase complex must contain at least one copy of each of the proteolipid subunits (31Hirata R. Graham L.A. Takatsuki A. Stevens T.H. Anraku Y. J. Biol. Chem. 1997; 272: 4795-4803Abstract Full Text Full Text PDF PubMed Scopus (191) Google Scholar). In mammalian cells, a homologue of Vma3p has been identified in mouse (32Hanada H. Hasebe M. Moriyama Y. Maeda M. Futai M. Biochem. Biophys. Res. Commun. 1991; 176: 1062-1067Crossref PubMed Scopus (49) Google Scholar), bovine (26Mandel M. Moriyama Y. Hulmes J.D. Pan Y.C. Nelson H. Nelson N. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 5521-5524Crossref PubMed Scopus (239) Google Scholar), and human (33Gillespie G.A. Somlo S. Germino G.G. Weinstat-Saslow D. Reeders S.T. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 4289-4293Crossref PubMed Scopus (47) Google Scholar), and recently a homologue of Vma16p (the 21-kDa c′′ subunit) has been identified in human (34Nishigori H. Yamada S. Tomura H. Fernald A.A. Le Beau M.M. Takeuchi T. Takeda J. Genomics. 1998; 50: 222-228Crossref PubMed Scopus (13) Google Scholar), although little information concerning this protein has been reported. In this paper, we report the sequence of the mouse Vma16p homologue and demonstrate that its expression pattern and intracellular localization are similar to that of the 16-kDa proteolipid subunit, consistent with its function as a subunit of the V0 domain. Unlike subunit c, however, subunit c′′ appears to have a different orientation in the membrane. The possible functional significance of this difference is discussed. Escherichia coli culture media was purchased from Difco Laboratories. Minimal essential medium, fetal bovine serum, and other reagents for tissue culture were purchased from Life Technologies, Inc. Restriction endonucleases, T4 DNA ligase, and other molecular biology reagents were from Life Technologies, Inc., Promega, and New England Biolabs. Most other chemicals were purchased from Sigma. The cDNA encoding the mouse Vma16p homologue (21 kDa subunit) was identified in the expression sequence tag (EST) data base and EST clone number AA018009was obtained from the American Tissue Culture Collection (Manassas, VA). The cDNA encoding the mouse Vma3p homologue (16-kDa subunit) (EST clone number AA791459) was also obtained from the American Tissue Culture Collection (Manassas, VA). Yeast cells lacking the functional endogenousVMA16 gene were made from YPH500 (MATαura3–52 lys2–801amber ade2–101ochre trp1-Δ63 his3-Δ200 leu2-Δ1) by replacing the coding region of the VMA16 gene with the TRP1gene. The yeast VMA16 gene was integrated into theXbaI and EcoRI site of the pRS413 vector for expression. The mouse 21-kDa subunit gene was inserted just downstream of the VPH1 gene promoter and integrated into the 2-μm vector, YEp352. Cells were transformed with the plasmids pRS413, pRS413-VMA16, and YEp352–21K using the lithium acetate method and selected on SD histidine or uracil minus plates. Growth phenotypes of the transformants were assessed on YPD plates buffered with 50 mm KH2PO4 or 50 mm succinic acid to either pH 7.5 or 5.5. Membranes containing mRNAs derived from multiple mouse tissues were purchased fromCLONTECH (Palo Alto, CA). AnEcoRI-BglII region (−97 to 573 bp, with +1 the first base of the translation initiation codon) of EST clone AA018009and a PvuII-PvuII region (555 to 978 bp) ofAA791459 were ligated into pBluescript SK (Stratagene). Radiolabeled RNA probes were synthesized by T3 RNA polymerase from the plasmid constructs described above using the Strip-EZ RNA probe synthesis kit (Ambion). Hybridization was performed overnight by incubation at 65 °C using the Northern Max system (Ambion). Membranes were washed with 15 mm NaCl, 1.5 mm sodium citrate (pH 7.0), and 0.1% SDS at 65 °C for 15 min. Hybridized bands were visualized by exposing to x-ray film for overnight to 3 days. RT-PCR was performed using cDNA prepared from different developmental stages of mouse embryos and the following subunit specific primers: 16Fw, CTGCTTGCAGACATGGCTGACATC; 16Rv, GTCAGGCTGTTCGTTCTGGAATGAGGAG; 21Fw, GCTGCCATGACGGGGCTGGAGTTGCTCTAC; 21Rv, GCTGAGGGACACAGCTCCAGCTGTCCCAGG. To determine the transcription initiation site for each proteolipid gene, 5′-RACE was performed using the First-Choice RACE Kit (Ambion) and the SMART cDNA amplification kit (CLONTECH). Reactions were performed using the manufacturers recommended protocol and mouse heart poly(A) RNA was purchased from CLONTECH (Palo Alto, CA). Amplified fragments were cloned into the TOPO-pCR2.1 vector (Invitrogen) and sequenced. Primers specific for the gene encoding the 21-kDa subunit (Rv1 and Rv2) that were used for amplification are indicated in Fig.1 a. Primers used for amplification of the 16-kDa subunit gene were: 16-Rv2, GAGGCGCCCATGACACCGAAAAACGAAG, and 16-Rv2, CTTGATGTCAGCCATGTCTGCAAGCAG. Mouse genomic DNA was purchased fromCLONTECH. 10 μg of genomic DNA was digested with restriction endonucleases (EcoRI, BamHI,HindIII, and PstI) overnight and separated using a 0.9% agarose gel. DNA was transferred to the Immobilon-Ny+ membrane (Millipore, MA). Hybridization was performed using the same protocol as described in Northern blot analysis except that hybridization was performed at 55 °C. The genes encoding the mouse 21- and 16-kDa proteolipid subunits were isolated from mouse genomic DNA using the mouse genome walking kit fromCLONTECH and the manufacturers recommended protocol. Primers specific for the 21- and 16-kDa subunit genes are as follows: 21-Fw1, GCTGCCATGACGGGGCTGGAGTTGCTCTAC; 21-Rv1, GCTGAGGGACACAGCTCCAGCTGTCCCAGG; 21-Rv4, CAAAGATCCCGAGGTAGAGCAACTCCAG; 21-Rv5, GAGGCGCCCATGACACCGAAAAACGAAG; 16-Fw7, GTTCGAGAAGACGACTGCCTGGAGCTG; 16-Fw8, CGAAGACCCAGGCAAGGCTGAGCGTTG; 16-Fw10, TTGCCCTGATCTCCGACAGTGTCCCTG; 16-Rv1, GTCAGGCTGTTCGTTCTGGAATGAGGAG. NIH3T3 cells were cultured in modified Eagle's medium with 10% fetal calf serum (Life Technologies, Inc.). COS-1 cells were cultured in Dulbecco's modified Eagle's medium with 10% fetal calf serum (Life Technologies, Inc.). The 5′-upstream region of 21- or 16-kDa subunit genes was subcloned into the BglII andNcoI sites located upstream of the luciferase gene in the pGL3-Basic vector (Promega). Expression plasmids (0.2 μg DNA) were transfected into NIH3T3 cells (1 × 105 cells per well on 12-well plates) using the Effecten transfection reagent (Qiagen). All cells also received 0.05 μg of the pRL-TK plasmid. After 24 h, cells were lysed with Passive Lysis buffer (Promega) and luciferase activity was measured using a luminometer and the Dual Luciferase reporter system (Promega). Myc and HA epitope tags were introduced into the COOH-terminal end of the 21- and 16-kDa subunits, respectively, by PCR using the following primers: 21-Fw-Xba, 5′-CCGTCTAGAGCCACCATGACGGGGCTGGAGTTGC-3′; 21-Rv-myc, 5′-CCCTTGCGGCCGCTACAGATCCTCTTCTGAGATGAGTTTTTGTTCGTCACCCATCTTCACTCTGGA-3′; 16-Fw-HA, 5′-GGTAGGCTAGCCACCATGGCTGACATCAAGAACAAC-3′; 16-Rv-HA, 5′-ATCGATAAGCTTACTAGGCGTAGTCGGGCACGTCGTAGGGGTACTTTGTGGAGAGGATTA-3′. An HA epitope tag was also introduced into the COOH terminus of the 21-kDa subunit using the 21-Fw-Xba primer and a 21-Rv-HA primer, 5′-CCCTTGCGGCCGCTAGGCGTAGTCGGGCACGTCGTAGGGGTAGTCACCCATCTTCACTCT-3′. Amplified fragments were digested with XbaI andNotI (21-kDa subunit) or NheI andEcoRI (16-kDa subunit) and then introduced into theXbaI and NotI sites or NheI andEcoRI sites of the mammalian expression vector pcDNA3.1(−) (Invitrogen) or pIRES (CLONTECH). For immunofluorescence microscopy, cells were grown on coverslips and transfected using the Effecten transfection reagent (Qiagen). After 36–48 h post-transfection, cells were fixed with 4% paraformaldehyde in phosphate-buffered saline. For selective permeabilization, cells were treated for 15 min at 4 °C with 0.1% Triton X-100 to expose both cytoplasmic and lumenal sites or 5 μg/ml digitonin to expose only cytoplasmic sites. After blocking with 0.5% bovine serum albumin in phosphate-buffered saline, primary and secondary antibodies were diluted in the same solution as follows: the anti-HA antibody was diluted 1:250; the anti-A subunit antibody was diluted 1:10; the anti-mouse IgG and anti-rabbit IgG secondary antibodies were diluted 1:200. The cDNA sequence of the 21-kDa subunit c′′ of the V-ATPase (Vma16p) was first reported in yeast (30Apperson M. Jensen R.E. Suda K. Witte C. Yaffe M.P. Biochem. Biophys. Res. Commun. 1990; 168: 574-579Crossref PubMed Scopus (24) Google Scholar, 31Hirata R. Graham L.A. Takatsuki A. Stevens T.H. Anraku Y. J. Biol. Chem. 1997; 272: 4795-4803Abstract Full Text Full Text PDF PubMed Scopus (191) Google Scholar), and more recently in Caenorhabditis elegans (VHA4) (35Oka T. Yamamoto R. Futai M. J. Biol. Chem. 1997; 272: 24387-24392Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar) and human (ATP6F) (34Nishigori H. Yamada S. Tomura H. Fernald A.A. Le Beau M.M. Takeuchi T. Takeda J. Genomics. 1998; 50: 222-228Crossref PubMed Scopus (13) Google Scholar). A search of the mouse EST (expression sequence tag) data base revealed several clones possessing significant homology with Vma16p. One of these clones (AA18009) was completely sequenced and the nucleotide sequence and the deduced amino acid sequence are shown in Fig. 1 a. The protein encoded contains 205 amino acid residues and has a predicted molecular mass of 21,606. The overall identity (and similarity) to human ATP6F (34Nishigori H. Yamada S. Tomura H. Fernald A.A. Le Beau M.M. Takeuchi T. Takeda J. Genomics. 1998; 50: 222-228Crossref PubMed Scopus (13) Google Scholar),C. elegans VHA4 (35Oka T. Yamamoto R. Futai M. J. Biol. Chem. 1997; 272: 24387-24392Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar), and yeast Vma16p (30Apperson M. Jensen R.E. Suda K. Witte C. Yaffe M.P. Biochem. Biophys. Res. Commun. 1990; 168: 574-579Crossref PubMed Scopus (24) Google Scholar) is 96 (97), 58 (72), and 48% (64), respectively. This result suggests that cloneAA018009 encodes the mouse homologue of the 21-kDa subunit c′′ of the V-ATPase. Comparison of the amino acid sequence between species revealed that the predicted transmembrane regions are highly conserved, with the exception of TM1, which shows significant homology only between mouse and human (Fig. 1 b). A glutamate residue present in TM3 (shown by the asterisk in Fig. 1 b) was observed to be essential for V-ATPase activity in yeast (31Hirata R. Graham L.A. Takatsuki A. Stevens T.H. Anraku Y. J. Biol. Chem. 1997; 272: 4795-4803Abstract Full Text Full Text PDF PubMed Scopus (191) Google Scholar) and is conserved in all four species. To analyze the function of the mouse 21-kDa subunit, we expressed the mouse 21-kDa subunit in yeast cells lacking the endogenous VMA16 gene. Despite the relatively high identity and similarity between the mouse 21-kDa subunit and the yeast Vma16p (48 and 64%, respectively), the mouse 21-kDa subunit did not complement the growth defect at pH 7.5 of the VMA16deletion strain (Fig. 2). In addition to Vma16p, V-ATPase activity in yeast requires two additional proteolipid subunits (Vma3p and Vma11p), both of which have a molecular mass of ∼16 kDa and contain four putative transmembrane helices (28Nelson H. Nelson N. FEBS Lett. 1989; 247: 147-153Crossref PubMed Scopus (124) Google Scholar,29Umemoto N. Ohya Y. Anraku Y. J. Biol. Chem. 1991; 266: 24526-24532Abstract Full Text PDF PubMed Google Scholar). A cDNA encoding the mouse homologue of the 16-kDa Vma3p has previously been reported (32Hanada H. Hasebe M. Moriyama Y. Maeda M. Futai M. Biochem. Biophys. Res. Commun. 1991; 176: 1062-1067Crossref PubMed Scopus (49) Google Scholar). To compare the expression pattern of these two proteolipid subunits in mouse, Northern blot analysis was performed on mRNA isolated from various mouse tissues using RNA probes specific for each subunit. As shown in Fig.3 a, transcripts encoding the 21-kDa subunit were detected in all tissues, with the highest expression detected in heart, brain, liver, kidney, and testis. The signals observed for both proteolipids in skeletal muscle was very low, but this is consistent with the intensity of the band for β-actin. The pattern of expression of the 21-kDa subunit generally paralleled that observed for the 16-kDa subunit. Interestingly, two different size bands were detected by Northern blot in all tissues tested using the probe specific for the 21-kDa subunit (Fig. 3 a). The size of the lower band matched that predicted for clone AA018009. This result suggests the existence of alternatively spliced forms of this message. The expression of the 21- and 16-kDa subunits at various developmental stages was also investigated (Fig. 3 b), with mRNA for both subunits detectable at all stages tested. It was previously reported that there exist several pseudogenes for the 16-kDa subunit in both human (36Hasebe M. Hanada H. Moriyama Y. Maeda M. Futai M. Biochem. Biophys. Res. Commun. 1992; 183: 856-863Crossref PubMed Scopus (33) Google Scholar) and mouse (37Inoue H. Noumi T. Nagata M. Murakami H. Kanazawa H. Biochim. Biophys. Acta. 1999; 1413: 130-138Crossref PubMed Scopus (76) Google Scholar). To test whether this was also the case for the 21-kDa subunit and to determine whether the two bands observed for the 21-kDa subunit by Northern blot correspond to alternatively spliced variants of a single gene, Southern blot analysis was performed on mouse genomic DNA digested using several different restriction enzymes. As can be seen in Fig.4, a single band was observed for each of the restriction digests with the exception of PstI (see below). This result suggests that the 21-kDa subunit is encoded by a single gene in mouse, without the presence of pseudogenes. The gene encoding the mouse 21-kDa subunit was isolated from mouse genomic DNA by PCR genomic walking and was sequenced. As shown in Fig.5 a, the 21-kDa subunit gene contained eight exons and seven introns, with the exon/intron organization the same as that observed in human (34Nishigori H. Yamada S. Tomura H. Fernald A.A. Le Beau M.M. Takeuchi T. Takeda J. Genomics. 1998; 50: 222-228Crossref PubMed Scopus (13) Google Scholar). TwoPstI sites are present in the 21-kDa subunit gene, consistent with the multiple bands observed following PstI digestion by Southern blot. The gene encoding the mouse 16-kDa subunit was also isolated and shown to contain three exons and two introns (Fig. 5), consistent with a recent report (37Inoue H. Noumi T. Nagata M. Murakami H. Kanazawa H. Biochim. Biophys. Acta. 1999; 1413: 130-138Crossref PubMed Scopus (76) Google Scholar). All exon/intron boundaries were observed to follow the GT/AG rule (Fig.5 b). Because Northern blotting indicated that genes encoding the 16- and 21-kDa subunits were expressed in a similar tissue-specific pattern, it appeared possible that transcription of the two genes might be regulated in a similar manner (62Nishi T. Kubo K. Hasebe M. Maeda M. Futai M. J. Biochem. 1997; 121: 922-929Crossref PubMed Scopus (28) Google Scholar). To test this, 5′-upstream regions of different lengths from both genes were ligated upstream of the luciferase reporter gene and the constructs transfected together with a control reporter plasmid (pRL-TK) into NIH3T3 cells followed by measurement of luciferase activity using a dual assay system. The SV40 promoter and enhancer were used as a positive control (pGL3-control) whereas the luciferase gene lacking promoter and enhancer sequences was used as a negative control (pGL3-basic). As shown in Fig.6, the 5′-upstream regions of both the 16- and 21-kDa subunit genes showed significant promoter activity compared with the positive control. In addition, full promoter activity was observed for 5′-upstream regions as short as −670 bp (16-kDa subunit gene) and −706 bp (21-kDa subunit gene), whereas promoter activity decreased sharply upon further reduction of the 5′-upstream length to −187 and −186 bp, respectively. Interestingly the basal transcriptional activity of the constructs containing the first 187 bp of 5′-upsteam sequence was the same for both genes (13%), suggesting that common elements contribute to this basal activity. Nevertheless, additional sequences between −186 and −706 bp greatly enhance promoter activity. Comparison of the 5′-upstream sequences for these two genes in this region (Fig. 7) reveals the lack of significant sequence homology and the absence of a typical TATA box. However, several putative transcription initiation factor-binding sites, including GC boxes and a CCAAT box, were identified.Figure 7Promoter regions of the 21- and 16-kDa subunit genes. Shown are the 5′-upsteam regions of the 21- and 16-kDa subunit genes, with identical bases indicated byshading, GC boxes indicated by wavy lines, and a CCAAT box shown with a straight line. The transcription initiation sites for each gene as determined by 5′-RACE are indicated by the closed circles (21-kDa subunit gene) and open circles (16-kDa subunit gene). The previously reported start sites for mRNA from mouse placenta (21-kDa subunit gene) and mouse brain (16-kDa subunit gene) are shown with asterisks.View Large Image Figure ViewerDownload Hi-res image

Referência(s)