Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

A CalDAG-GEFI/Rap1/B-Raf Cassette Couples M1Muscarinic Acetylcholine Receptors to the Activation of ERK1/2

2001; Elsevier BV; Volume: 276; Issue: 27 Linguagem: Inglês

10.1074/jbc.m101277200

ISSN

1083-351X

Autores

Feifan Guo, Eiko Kumahara, David Saffen,

Tópico(s)

Neuroscience and Neuropharmacology Research

Resumo

In this study we examine signaling pathways linking the M1 subtype of muscarinic acetylcholine receptor (M1 mAChR) to activation of extracellular signal-regulated kinases (ERK) 1 and 2 in neuronal PC12D cells. We first show that activation of ERK1/2 by the M1 mAChR agonist carbachol takes place primarily via a Ras-independent pathway that depends largely upon Rap1, another small GTP-binding protein in the Ras family. Rap1 in turn activates B-Raf, an upstream activator of ERK1/2. Consistent with these results, carbachol was found to activate Rap1 more potently than Ras. Similar to other small GTP-binding proteins, activation of Rap1 requires a guanine nucleotide exchange factor (GEF) to promote its conversion from the GDP- to GTP-bound form. Using specific antibodies, we show that a recently identified Rap1 GEF,calcium- anddiacylglycerol-regulatedguanine nucleotide exchange factorI (CalDAG-GEFI), is expressed in PC12D cells and that carbachol stimulates the formation of a complex containing CalDAG-GEFI, Rap1, and activated B-Raf. Finally, we show that expression of CalDAG-GEFI antisense RNA largely blocks carbachol-stimulated activation of hemagglutinin (HA)1-tagged B-Raf and formation of the CalDAG-GEFI/Rap1/HA1-tagged B-Raf complex. Together, these data define a novel signaling pathway for M1 mAChR, where increases in Ca2+ and diacylglycerol stimulate the sequential activation of CalDAG-GEFI, Rap1, and B-Raf, resulting in the activation of MEK and ERK1/2. In this study we examine signaling pathways linking the M1 subtype of muscarinic acetylcholine receptor (M1 mAChR) to activation of extracellular signal-regulated kinases (ERK) 1 and 2 in neuronal PC12D cells. We first show that activation of ERK1/2 by the M1 mAChR agonist carbachol takes place primarily via a Ras-independent pathway that depends largely upon Rap1, another small GTP-binding protein in the Ras family. Rap1 in turn activates B-Raf, an upstream activator of ERK1/2. Consistent with these results, carbachol was found to activate Rap1 more potently than Ras. Similar to other small GTP-binding proteins, activation of Rap1 requires a guanine nucleotide exchange factor (GEF) to promote its conversion from the GDP- to GTP-bound form. Using specific antibodies, we show that a recently identified Rap1 GEF,calcium- anddiacylglycerol-regulatedguanine nucleotide exchange factorI (CalDAG-GEFI), is expressed in PC12D cells and that carbachol stimulates the formation of a complex containing CalDAG-GEFI, Rap1, and activated B-Raf. Finally, we show that expression of CalDAG-GEFI antisense RNA largely blocks carbachol-stimulated activation of hemagglutinin (HA)1-tagged B-Raf and formation of the CalDAG-GEFI/Rap1/HA1-tagged B-Raf complex. Together, these data define a novel signaling pathway for M1 mAChR, where increases in Ca2+ and diacylglycerol stimulate the sequential activation of CalDAG-GEFI, Rap1, and B-Raf, resulting in the activation of MEK and ERK1/2. muscarinic acetylcholine receptors phospholipase C diacylglycerol protein kinase C inositol-1,4,5-triphosphate mitogen-activated protein kinases extracellular signal-regulated kinases nerve growth factor epidermal growth factor guanine nucleotide exchange factor mammalian son-of-sevenless MAPK/ERK kinase calcium- and diacylglycerol-regulated guanine nucleotide exchange factor I hemagglutinin reverse transcription-polymerase chain reaction dimethyl sulfoxide dominant-negative Rap1 (or Ras) polyacrylamide gel electrophoresis glutathione S-transferase protein kinase A Dulbecco's modified Eagle's medium isopropyl-β-d-thiogalactoside phorbol 12-myristate 13-acetate polyvinylidene difluoride 1,4-piperazinediethanesulfonic acid Ras binding domain 1-oleoyl- 2-acetyl-sn-glycerol Muscarinic acetylcholine receptors (mAChR)1 are members of the seven-transmembrane family of receptors, which initiate intracellular signaling by activating heterogeneous G proteins. They can be classified into two functional groups as follows: subtypes M1, M3, and M5 couple to Gq/11 to activate phospholipase C (PLC)β, and M2 and M4 couple to Gi/o to inhibit adenylate cyclase (1Wess J. Trends Pharmacol. Sci. 1993; 14: 308-313Abstract Full Text PDF PubMed Scopus (167) Google Scholar, 2Caulfield M.P. Pharmacol. Ther. 1993; 58: 319-379Crossref PubMed Scopus (1142) Google Scholar, 3Felder C.C. FASEB J. 1995; 9: 619-625Crossref PubMed Scopus (450) Google Scholar). The M1 subtype is widely expressed in the central nervous system, including the hippocampus and cerebral cortex, where it is thought to play a role in learning and memory (4Mrzljak L. Levey A.I. Goldman-Rakic P.S. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 5194-5198Crossref PubMed Scopus (223) Google Scholar, 5Levey A.I. Edmunds S.M. Koliatsos V. Wiley R.G. Heilman C.J. J. Neurosci. 1995; 15: 4077-4092Crossref PubMed Google Scholar, 6Rouse S.T. Gilmor M.L. Levey A.I. Neuroscience. 1998; 86: 221-232Crossref PubMed Scopus (42) Google Scholar, 7Marino M.J. Rouse S.T. Levey A.I. Potter L.T. Conn P.J. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 11465-11470Crossref PubMed Scopus (241) Google Scholar). Intracellular signaling events that are activated by M1 mAChR include PLCβ-mediated production of diacylglycerol (DAG), which activates protein kinase C (PKC), and inositol-1,4,5-triphosphate (IP3), which stimulates the release of Ca2+ from the endoplasmic reticulum. This release of Ca2+ is often accompanied by a sustained influx of extracellular Ca2+ (3Felder C.C. FASEB J. 1995; 9: 619-625Crossref PubMed Scopus (450) Google Scholar, 8Berstein G. Blank J.L. Smrcka A.V. Higashijima T. Sternweis P.C. Exton J.H. Ross E.M. J. Biol. Chem. 1992; 267: 8081-8088Abstract Full Text PDF PubMed Google Scholar, 9Lambert D.G. Burford N.T. Nahorski S.R. Biochem. Soc. Trans. 1992; 20: 130-135Crossref PubMed Scopus (13) Google Scholar). Signaling events that occur further downstream, however, are poorly understood. One downstream event that has been reported is the activation of the mitogen-activated protein kinases (MAPK) 1 and 2, also known as extracellular signal-regulated kinases (ERK) 1 and 2 (10Sugden P.H. Clerk A. Cell. Signal. 1997; 9: 337-351Crossref PubMed Scopus (281) Google Scholar, 11Haring R. Fisher A. Marciano D. Pittel Z. Kloog Y. Zuckerman A. Eshhar N. Heldman E. J. Neurochem. 1998; 71: 2094-2103Crossref PubMed Scopus (123) Google Scholar, 12Gutkind J.S. J. Biol. Chem. 1998; 273: 1839-1842Abstract Full Text Full Text PDF PubMed Scopus (688) Google Scholar, 13Berkeley J.L. Levey A.I. J. Neurochem. 2000; 75: 487-493Crossref PubMed Scopus (47) Google Scholar). Activation of ERK1/2 has been suggested to be necessary for the establishment of long term potentiation of synaptic transmission (14English J.D. Sweatt J.D. J. Biol. Chem. 1997; 272: 19103-19106Abstract Full Text Full Text PDF PubMed Scopus (726) Google Scholar, 15Impey S. Obrietan K. Wong S.T. Poser S. Yano S. Wayman G. Deloulme J.C. Chan G. Storm D.R. Neuron. 1998; 21: 869-883Abstract Full Text Full Text PDF PubMed Scopus (759) Google Scholar, 16Orban P.C. Chapman P.F. Brambilla R. Trends Neurosci. 1999; 22: 38-44Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar), a form of neuronal plasticity that may be the cellular basis of learning and memory (17Bliss T.V. Collingridge G.L. Nature. 1993; 361: 31-39Crossref PubMed Scopus (9396) Google Scholar, 18Malenka R.C. Nicoll R.A. Science. 1999; 285: 1870-1874Crossref PubMed Scopus (2206) Google Scholar). Intracellular signaling pathways linking M1 mAChR and ERK1/2 activation in neurons, however, have not yet been elucidated. To study mechanisms of signal transduction activated by M1mAChR, we have been using PC12D cells (19Katoh-Semba R. Kitajima S. Yamazaki Y. Sano M. J. Neurosci. Res. 1987; 17: 36-44Crossref PubMed Scopus (99) Google Scholar), a spontaneously arising variant of neuronal PC12 cells (20Greene L.A. Tischler A.S. Proc. Natl. Acad. Sci. U. S. A. 1976; 73: 2424-2428Crossref PubMed Scopus (4803) Google Scholar) that expresses M1 and M4 mAChRs (21Ebihara T. Saffen D. J. Neurochem. 1997; 68: 1001-1010Crossref PubMed Scopus (32) Google Scholar). Using an M1 mAChR-specific toxin (m1-toxin) isolated from the venom of Dendroaspis angusticeps (22Max S.I. Liang J.S. Potter L.T. J. Neurosci. 1993; 13: 4293-4300Crossref PubMed Google Scholar), we previously showed that the acetylcholine analogue carbachol induces expression of the immediate-early genezif268 (also designated egr-1, NGF1-A, andkrox-24 (23Gashler A. Sukhatme V.P. Prog. Nucleic Acids Res. Mol. Biol. 1995; 50: 191-224Crossref PubMed Scopus (551) Google Scholar, 24Beckmann A.M. Wilce P.A. Neurochem. Int. 1997; 31: 477-516Crossref PubMed Scopus (270) Google Scholar, 25O'Donovan K.J. Tourtellotte W.G. Millbrandt J. Baraban J.M. Trends Neurosci. 1999; 22: 167-173Abstract Full Text Full Text PDF PubMed Scopus (370) Google Scholar)) exclusively via M1 mAChR in PC12D cells (21Ebihara T. Saffen D. J. Neurochem. 1997; 68: 1001-1010Crossref PubMed Scopus (32) Google Scholar). We also showed that carbachol-mediatedzif268 gene induction involves both the influx of extracellular Ca2+ and activation of PKC (21Ebihara T. Saffen D. J. Neurochem. 1997; 68: 1001-1010Crossref PubMed Scopus (32) Google Scholar), and that activation of ERK1/2 is also crucial for this induction (26Kumahara E. Ebihara T. Saffen D. J. Biol. Chem. 1999; 274: 10430-10438Abstract Full Text Full Text PDF PubMed Scopus (22) Google Scholar). The signaling pathways linking influx of Ca2+ and activation of PKC to the activation of ERK1/2 in PC12D cells, however, are still not defined. One well studied pathway for ERK1/2 activation is mediated by the small GTP-binding protein Ras (27Thomas S.M. DeMarco M. D'Arcangelo G. Halegoua S. Brugge J.S. Cell. 1992; 68: 1031-1040Abstract Full Text PDF PubMed Scopus (501) Google Scholar, 28Wood K.W. Sarnecki C. Roberts T.M. Blenis J. Cell. 1992; 68: 1041-1050Abstract Full Text PDF PubMed Scopus (656) Google Scholar, 29Marshall C.J. Curr. Opin. Genet. & Dev. 1994; 4: 82-89Crossref PubMed Scopus (896) Google Scholar, 30Seger R. Krebs E.G. FASEB J. 1995; 9: 726-735Crossref PubMed Scopus (3175) Google Scholar, 31Lewis T.S. Shapiro P.S. Ahn N.G. Adv. Cancer Res. 1998; 74: 49-139Crossref PubMed Google Scholar, 32Schaeffer H.J. Weber M.J. Mol. Cell. Biol. 1999; 19: 2435-2444Crossref PubMed Scopus (1392) Google Scholar). Stimulation of high affinity receptors (TrkA) for nerve growth factor (NGF) or epidermal growth factor (EGF) receptors, for example, activates mammalian son-of-sevenless, a guanine nucleotide exchange factor (GEF) that stimulates the conversion of Ras from the GDP- to GTP-bound form (33McCormick F. Curr. Opin. Genet. & Dev. 1994; 4: 71-76Crossref PubMed Scopus (208) Google Scholar,34Feig L.A. Curr. Opin. Cell Biol. 1994; 6: 204-211Crossref PubMed Scopus (89) Google Scholar). Activated Ras subsequently recruits the serine-threonine kinases Raf-1 (35Vojtek A.B. Hollenberg S.M. Cooper J.A. Cell. 1993; 74: 205-214Abstract Full Text PDF PubMed Scopus (1654) Google Scholar, 36Stokoe D. Macdonald S.G. Cadwallader K. Symons M. Hancock J.F. Science. 1994; 264: 1463-1467Crossref PubMed Scopus (832) Google Scholar) and B-Raf (37Jaiswal R.K. Moodie S.A. Wolfman A. Landreth G.E. Mol. Cell. Biol. 1994; 14: 6944-6953Crossref PubMed Google Scholar, 38Papin C. Denouel A. Calothy G. Eychene A. Oncogene. 1996; 12: 2213-2221PubMed Google Scholar) to the plasma membrane, resulting in their activation. Activated Raf-1 (39Kyriakis J.M. App H. Zhang X.F. Banerjee P. Brautigan D.L. Rapp U.R. Avruch J. Nature. 1992; 358: 417-421Crossref PubMed Scopus (964) Google Scholar) and B-Raf (40Vaillancourt R.R. Gardner A.M. Johnson G.L. Mol. Cell. Biol. 1994; 14: 6522-6530Crossref PubMed Scopus (146) Google Scholar) then activate MAP/ERK kinase (MEK), which directly phosphorylates and activates ERK1/2 (41Crews C.M. Alessandrini A. Erikson R.L. Science. 1992; 258: 478-480Crossref PubMed Scopus (733) Google Scholar). In addition to this well established Ras-dependent ERK1/2 kinase pathway, the ERK1/2 kinase cascade has been proposed to be activated by the small GTP-binding protein Rap1 in cells expressing B-Raf (42Vossler M.R. Yao H. York R.D. Pan M.G. Rim C.S. Stork P.J. Cell. 1997; 89: 73-82Abstract Full Text Full Text PDF PubMed Scopus (941) Google Scholar, 43York R.D. Yao H. Dillon T. Ellig C.L. Eckert S.P. McCleskey E.W. Stork P.J. Nature. 1998; 392: 622-626Crossref PubMed Scopus (755) Google Scholar, 44Grewal S.S. York R.D. Stork P.J. Curr. Opin. Neurobiol. 1999; 9: 544-553Crossref PubMed Scopus (504) Google Scholar, 45Grewal S.S. Horgan A.M. York R.D. Withers G.S. Banker G.A. Stork P.J. J. Biol. Chem. 2000; 275: 3722-3728Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar). Rap1 was first identified as a protein that antagonizes Ras-dependent activation of Raf-1 (46Kitayama H. Sugimoto Y. Matsuzaki T. Ikawa Y. Noda M. Cell. 1989; 56: 77-84Abstract Full Text PDF PubMed Scopus (753) Google Scholar), but recent studies have shown that it can activate B-Raf both in vitro (47Ohtsuka T. Shimizu K. Yamamori B. Kuroda S. Takai Y. J. Biol. Chem. 1996; 271: 1258-1261Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar) andin vivo (42Vossler M.R. Yao H. York R.D. Pan M.G. Rim C.S. Stork P.J. Cell. 1997; 89: 73-82Abstract Full Text Full Text PDF PubMed Scopus (941) Google Scholar, 43York R.D. Yao H. Dillon T. Ellig C.L. Eckert S.P. McCleskey E.W. Stork P.J. Nature. 1998; 392: 622-626Crossref PubMed Scopus (755) Google Scholar, 44Grewal S.S. York R.D. Stork P.J. Curr. Opin. Neurobiol. 1999; 9: 544-553Crossref PubMed Scopus (504) Google Scholar, 45Grewal S.S. Horgan A.M. York R.D. Withers G.S. Banker G.A. Stork P.J. J. Biol. Chem. 2000; 275: 3722-3728Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar). Activation of Rap1 and B-Raf has been proposed to be essential for the sustained activation of ERK1/2 kinase in PC12 cells by NGF (43York R.D. Yao H. Dillon T. Ellig C.L. Eckert S.P. McCleskey E.W. Stork P.J. Nature. 1998; 392: 622-626Crossref PubMed Scopus (755) Google Scholar). The ability of Rap1 to activate B-Raf is still controversial, however, since activated Rap1 does not activate ERK1/2 in some cell lines (48Zwartkruis F.J. Wolthuis R.M. Nabben N.M. Franke B. Bos J.L. EMBO J. 1998; 17: 5905-5912Crossref PubMed Scopus (191) Google Scholar, 49Busca R. Abbe P. Mantoux F. Aberdam E. Peyssonnaux C. Eychene A. Ortonne J.P. Ballotti R. EMBO J. 2000; 19: 2900-2910Crossref PubMed Scopus (290) Google Scholar). Several pathways for Rap1 activation have been shown to be mediated by GEFs that respond to specific intracellular signals (50Zwartkruis F.J. Bos J.L. Exp. Cell Res. 1999; 253: 157-165Crossref PubMed Scopus (148) Google Scholar). For example, increases in the intrinsic tyrosine kinase activities of growth factor receptors (e.g. TrkA, EGF receptors) activate Rap1 via the GEF C3G (51Quilliam L.A. Khosravi-Far R. Huff S.Y. Der C.J. BioEssays. 1995; 17: 395-404Crossref PubMed Scopus (193) Google Scholar, 52Gotoh T. Hattori S. Nakamura S. Kitayama H. Noda M. Takai Y. Kaibuchi K. Matsui H. Hatase O. Takahashi H. Kurata T. Matsuda M. Mol. Cell. Biol. 1995; 15: 6746-6753Crossref PubMed Scopus (334) Google Scholar). The GEFs nRap GEP/PDZ-GEFI/Ra-GEF activate Rap1 upon binding to cell adhesion molecules via their PDZ domains (53Ohtsuka T. Hata Y. Ide N. Yasuda T. Inoue E. Inoue T. Mizoguchi A. Takai Y. Biochem. Biophys. Res. Commun. 1999; 265: 38-44Crossref PubMed Scopus (92) Google Scholar, 54de Rooij J. Boenink N.M. van Triest M. Cool R.H. Wittinghofer A. Bos J.L. J. Biol. Chem. 1999; 274: 38125-38130Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar, 55Liao Y. Kariya K. Hu C.D. Shibatohge M. Goshima M. Okada T. Watari Y. Gao X. Jin T.G. Yamawaki-Kataoka Y. Kataoka T. J. Biol. Chem. 1999; 274: 37815-37820Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar). Increases in intracellular concentrations of cAMP activate the Rap1 GEFs Epac ((56), also designated cAMP-GEFI (57Kawasaki H. Springett G.M. Mochizuki N. Toki S. Nakaya M. Matsuda M. Housman D.E. Graybiel A.M. Science. 1998; 282: 2275-2279Crossref PubMed Scopus (1158) Google Scholar)) and cAMP-GEFII (57Kawasaki H. Springett G.M. Mochizuki N. Toki S. Nakaya M. Matsuda M. Housman D.E. Graybiel A.M. Science. 1998; 282: 2275-2279Crossref PubMed Scopus (1158) Google Scholar), which are activated by direct binding of cAMP. Increases in intracellular levels of Ca2+ and DAG activate Rap1 by activating CalDAG-GEFI ((58), structurally related to RasGRP/HCDC25L (59Ebinu J.O. Bottorff D.A. Chan E.Y. Stang S.L. Dunn R.J. Stone J.C. Science. 1998; 280: 1082-1086Crossref PubMed Scopus (545) Google Scholar, 60Kedra D. Seroussi E. Fransson I. Trifunovic J. Clark M. Lagercrantz J. Blennow E. Mehlin H. Dumanski J. Hum. Genet. 1997; 100: 611-619Crossref PubMed Scopus (31) Google Scholar)) and CalDAG-GEFIII (which is actually a more effective GEF for Ras (61Yamashita S. Mochizuki N. Ohba Y. Tobiume M. Okada Y. Sawa H. Nagashima K. Matsuda M. J. Biol. Chem. 2000; 275: 25488-25493Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar)). Among these Rap1 GEFs, CalDAG-GEFI (calcium- anddiacylglycerol-regulatedguanine nucleotide exchange factorI (58Kawasaki H. Springett G.M. Toki S. Canales J.J. Harlan P. Blumenstiel J.P. Chen E.J. Bany I.A. Mochizuki N. Ashbacher A. Matsuda M. Housman D.E. Graybiel A.M. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 13278-13283Crossref PubMed Scopus (309) Google Scholar)), which has binding sites for both Ca2+and DAG, seemed to have just the right properties to link PLCβ-stimulated increases in Ca2+ and DAG to the activation of the ERK1/2 cascade. Until now, however, there have been no studies of the function of endogenous CalDAG-GEFI. In the present study we show that CalDAG-GEFI plays a central role in M1 mAChR-mediated activation of the ERK1/2 cascade in PC12D cells. First, we show that the mAChR agonist carbachol activates ERK1/2 largely via a Ras-independent pathway. Second, we show that carbachol rapidly activates B-Raf, an upstream activator of ERK1/2, and that this activation depends upon the activation of Rap1. Third, we use specific antibodies to show that CalDAG-GEFI is expressed in PC12D cells and that a complex containing CalDAG-GEFI, Rap1, and activated B-Raf is formed following stimulation of M1 mAChR. Finally, we show that carbachol-mediated activation of hemagglutinin (HA)1-tagged B-Raf and formation of the CalDAG-GEFI/Rap1/HA1-tagged B-Raf complex can be blocked by expression of CalDAG-GEFI antisense RNA. Together, these data indicate that stimulation of M1 mAChR by carbachol causes the sequential activation of CalDAG-GEFI, Rap1, and B-Raf, leading to the activation of MEK and ERK1/2. Nerve growth factor (human 2.5 S) and carbamylcholine (carbachol) were obtained from Wako Chemicals Industries, Ltd. Phorbol 12-myristate 13-acetate (PMA) was obtained from Sigma. Dexamethasone was from Nacalai Tesque. K252a (a glycosylated indole carbazole alkaloid from Nocardiopsis species) was from Kyowa Medex Co. GF109203X (3-[1-(3-dimethylaminopropyl)-3-indolyl]-3(3-indolyl)maleimide) was purchased from Calbiochem. [γ-32P]ATP was obtained from Amersham Pharmacia Biotech. Restriction enzymes and other reagents for modification of DNA were obtained from Toyobo, Takara Shuzo Co., and New England Biolabs. A dominant-negative (dn)Rap1 (Rap1Asn-17) was obtained by PCR amplification from the mouse full-length Rap1 cDNA cloned in pT7T3d-Pac (identified in the mouse expressed sequence tag data base (GenBankTMaccession number AA272379) and purchased from Genome Systems, Inc., Livermore, CA) using the mutant oligonucleotide primer GGCGTGGGGAAGAATGCTCTAACAGTTCAGTTTGTTCAG to change the 17th amino acid from serine to asparagine with the QuikChange Site-directedTM Mutagenesis Kit (Stratagene). DNA sequencing was performed before and after mutagenesis. The Rap1Asn-17 cDNA was excised from this vector by digestion with NotI and XhoI and subcloned in pOPRSVI/MCS LacSwitchTM II (Stratagene) between theNotI and XhoI sites to produce the isopropyl-β-d-thiogalactoside (IPTG)-inducible expression vector (pRap1N17) containing Rap1Asn-17 under the control of the Rous sarcoma virus-long terminal repeat promoter and the Lac operator/repressor. Full-length rat CalDAG-GEFI cDNA was obtained by reverse transcription-polymerase chain reaction (RT-PCR) from RNA isolated from PC12D cells and rat brain. Primers were designed based on the mouse CalDAG-GEFI sequence (GenBankTMaccession number AF081193). The forward primer was 5′-AGGATCAGAGGCTGAGCTGGTT-3′, and the backward primer was 5′-TCTCCAAGGCAGGAATGAGTCC-3′. RT-PCR product was isolated from a 1% agarose gel and cloned in pGEM-T Easy (Promega). This plasmid was then used as a template for constructing an expression vector encoding c-Myc-tagged CalDAG-GEFI. The forward primer used in this construction was 5′-GGTGACACTATAGAATACTCAAGCTATGCATCC-3′, and the backward primer was 5′-TTATCGTCGACTAAGTGGATGTCGAACA-3′. This PCR product was purified from a 1% agarose gel and cloned in pGEM-T Easy. CalDAG-GEFI cDNA was excised from this vector by digestion with EcoRI andSalI and subcloned between the EcoRI andSalI sites of pCMV-Tag 5 (Stratagene). The resulting plasmid was designated pCalDAG-GEF1-myc. An antisense expression vector, pCalDAG-GEFI-myc-antisense, was constructed by subcloning a cDNA fragment encoding CalDAG-GEFI between the EcoRI andBamHI sites of pCMV-Tag 5. PC12D cells (19Katoh-Semba R. Kitajima S. Yamazaki Y. Sano M. J. Neurosci. Res. 1987; 17: 36-44Crossref PubMed Scopus (99) Google Scholar), a rapidly differentiating subline of rat pheochromocytoma-derived PC12 cells (20Greene L.A. Tischler A.S. Proc. Natl. Acad. Sci. U. S. A. 1976; 73: 2424-2428Crossref PubMed Scopus (4803) Google Scholar), were a gift from Prof. Mamoru Sano (Department of Biology, Faculty of Medicine, Kyoto Prefectural University of Medicine). PC12D cells were cultured in Dulbecco's modified Eagle's medium (DMEM, Nissui) supplemented with 5% fetal bovine serum, 5% horse serum, 0.16% sodium bicarbonate, 3.6 mm glutamine, 10 units/ml penicillin, and 45 ng/ml streptomycin at 37 °C under 5% CO2 as described previously (21Ebihara T. Saffen D. J. Neurochem. 1997; 68: 1001-1010Crossref PubMed Scopus (32) Google Scholar). Cells were used in the non-differentiated state in all the experiments. Drugs were added directly to the culture medium and were present until the time when the cells were harvested. The corresponding vehicle (water, Me2SO, or ethanol) was added to control cells. Cells were seeded in 3.5-cm plastic dishes (Corning or Iwaki Glass Co.) at a density of 2 × 106 cells/dish and then cultured for 1 day, allowing the cells grow to 90–95% confluency prior to transfection. LipofectAMINETM (Life Technologies, Inc.) was used for making stable cell lines containing the dnRap1gene. Transfections were performed essentially as recommended by the manufacturer. 5 μg of PCMVLacI repressor (Stratagene) together with 5 μg of pRap1N17, and 39 μl of LipofectAMINE were used for each 10 cm dish. LipofectAMINETM 2000 Reagent (Life Technologies, Inc.) was used for other transfections (10 cm) essentially as recommended by the manufacturer. pCalDAG-GEFI-myc (1 μg or as indicated), 1 μg of pHA1-B1-Raf (an expression plasmid encoding hemagglutinin (HA) 1-tagged quail B-Raf, Ref. 62Papin C. Denouel-Galy A. Laugier D. Calothy G. Eychene A. J. Biol. Chem. 1998; 273: 24939-24947Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar; a gift from Dr. Alain Eychene, Unite Mixte de Recherche 146 du CNRS, Institut Curie, Center Universitaire, Laboratoire 110, 91405 Orsay Cedex, France), 1 μg of pCalDAG-GEFI-myc-antisense, 1 μg of pRap1N17, or 1 μg of pcDNA3, and 4 μl of LipofectAMINETM 2000 reagent were used for each dish in different combinations as indicated. Cells were kept in normal DMEM for 48 h until they were ready to be used. A PC12D subline, PC12D-37, stably expressing a dexamethasone-inducible dnRas gene (RasAsn-17) (63Feig L.A. Cooper G.M. Mol. Cell. Biol. 1988; 8: 3235-3243Crossref PubMed Scopus (672) Google Scholar), under the control of the mouse mammary tumor virus-long terminal repeat promoter (64Szeberenyi J. Cai H. Cooper G.M. Mol. Cell. Biol. 1990; 10: 5324-5332Crossref PubMed Scopus (276) Google Scholar), has been described previously (65Kumahara E. Ebihara T. Saffen D. J. Biochem. (Tokyo). 1999; 125: 541-553Crossref PubMed Scopus (27) Google Scholar). Stable cell lines that express the dnRap1 gene (Rap1Asn-17) under the control of the IPTG-inducible Lac operator/repressor were obtained by transfecting PC12D-37 cells with pRap1N17 and PCMVLacI repressor using LipofectAMINETM, followed by selection for hygromycin B-resistant colonies in DMEM containing 300 μg/ml hygromycin B. (Selection was initiated 1 week after transfection.) After 2 weeks of selection, hygromycin B-resistant colonies were isolated and screened for the ability of Rap1Asn-17 (induced by exposing cells to IPTG) to block the activation of B-Raf by carbachol. Cell lines that showed complete or nearly complete inhibition of carbachol-mediated B-Raf activation were chosen for further study. In this way, the cell line PC12D-37-19 containing RasAsn-17under the control of a dexamethasone-inducible promoter and Rap1Asn-17 under the control of an IPTG-inducible promoter was selected. PC12D-37-19 cells were subsequently maintained in DMEM containing 150 μg/ml hygromycin B and 100 μg/ml G418. Overexpression of dnRap1, dnRas, or dnRap1 and dnRas in these cells was achieved by pretreating the cells with 5 mm IPTG for 7 h, 0.5 μm dexamethasone for 19 h, or by pretreating the cells with both IPTG and dexamethasone. ERK1/2 kinase assays using anti-phospho-p44/42 MAPK (Thr-202/Tyr-204) antibodies were performed essentially as recommended by the manufacturer (New England Biolabs Inc.). Briefly, cells grown to 90–95% confluency in 3.5-cm uncoated plastic culture dishes were stimulated with various reagents for the times indicated and then lysed by adding 100 μl of SDS sample buffer containing 62.5 mm Tris-Cl (pH 6.8), 2% w/v SDS, 10% glycerol, 50 mm dithiothreitol, 0.1% w/v bromphenol blue, and then immediately scraped off the plates. The resulting cell lysates were transferred to microcentrifuge tubes on ice, sonicated for 10–15 s in a bath sonicator, and boiled for 5 min. After centrifugation for 5 min to remove cellular debris, the proteins in the samples were resolved by 12% SDS-polyacrylamide gel electrophoresis (PAGE), transferred to polyvinylidene difluoride (PVDF) membranes (ImmobilonTM transfer membrane, Millipore), and probed with anti-phospho-p44/42 MAPK (Thr-202/Tyr-204) antibodies as described below. In vitro phosphorylation of the ERK1/2 substrate myelin basic protein in the presence of [γ-32P]ATP was carried out as described previously (26Kumahara E. Ebihara T. Saffen D. J. Biol. Chem. 1999; 274: 10430-10438Abstract Full Text Full Text PDF PubMed Scopus (22) Google Scholar). Quantification of ERK1/2 activation was performed by liquid scintillation counting. B-Raf kinase assays were performed as described previously (40Vaillancourt R.R. Gardner A.M. Johnson G.L. Mol. Cell. Biol. 1994; 14: 6522-6530Crossref PubMed Scopus (146) Google Scholar) with some modifications. Briefly, cells grown to 90–95% confluency in 3.5-cm uncoated plastic culture dishes were stimulated with various reagents for the times indicated and then lysed by addition of 200 μl of lysis buffer containing 10 mmTris-Cl (pH 7.4), 5 mm EDTA, 50 mm NaCl, 50 mm NaF, 0.1% bovine serum albumin, 20 units/ml aprotinin, 1 mm phenylmethanesulfonyl fluoride, 1 mmNa3VO4, and 1% Triton X-100. After 5 min centrifugation at 15,000 rpm at 4 °C to remove cellular debris, 1 μg of anti-B-Raf antibodies (Santa Cruz Biotechnology, for endogenous B-Raf) or 1 μg of anti-HA antibodies (Roche Molecular Biochemicals, for HA1-tagged B-Raf) were added to the supernatant fractions, which were then incubated for 1 h at 4 °C with rotation to provide gentle mixing. Protein A/G-agarose (10 μl of resin suspension, Santa Cruz Biotechnology) was subsequently added to each sample, and the incubation was continued with rotation at 4 °C for 1 h. The agarose in each sample was collected by centrifugation (2,500 rpm for 5 min) and washed twice with 200 μl of lysis buffer and once with PAN buffer containing 10 mmPIPES (pH 7.0), 20 units/ml aprotinin, and 100 mmNaCl. The resin from each sample was then resuspended in 16.5 μl of 1× MEK buffer containing 2 μg of MEK1 (Santa Cruz Biotechnology), 10 μl of PAN buffer, 1 μl of [γ-32P]ATP (3000 Ci/mm), and 4 μl of 5× kinase buffer (5× kinase buffer: 50 mm MgCl2, 20 units/ml aprotinin, and 10 mm PIPES (pH 7.0)). The reaction mixtures were incubated at 30 °C for 30 min, then resolved by 10% SDS-PAGE, and electroblotted onto PVDF membranes. Phosphorylated MEK1 was assessed by autoradiography and quantified using the BAS2000 Bio Imaging Analyzer (Fuji Co.). GTP-bound forms of Rap1 and Ras were detected as described by Frank et al. (66Franke B. Akkerman J.W. Bos J.L. EMBO J. 1997; 16: 252-259Crossref PubMed Scopus (362) Google Scholar) and Tayler and Shalloway (67Taylor S.J. Shalloway D. Curr. Biol. 1996; 6: 1621-1627Abstract Full Text Full Text PDF PubMed Scopus (351) Google Scholar), respectively. pGST-RalGDS-RBD encoding the 97 amino acids spanning the Rap binding domain (RBD) of Ral GDP dissociation stimulator (RalGDS) fused to glutathione S-transferase (GST) was a gift from Dr. Johannes Bos (Laboratory for Physiological Chemistry and Center for Biomedical Genetics, Utrecht University), and pGST-Raf-RBD encoding the 1–149 amino acids spanning the Ras-binding domain (RBD) of cRaf-1 fused to GST was a gift from Dr. David Shalloway (Section of Biochemistry, Molecular and Cell Biology, Cornell University). pGS

Referência(s)