Portal de Periódicos da CAPES

Separate Cis-acting DNA Elements Control Cell Type- and Tissue-specific Expression of Collagen Binding Molecular Chaperone HSP47

1999; Elsevier BV; Volume: 274; Issue: 50 Linguagem: Inglês

10.1074/jbc.274.50.35703

1083-351X

Hiromi Hirata, Isao Yamamura, Kunihiko Yasuda, Akio Kobayashi, Norihiro Tada, Misao Suzuki, Kazunori Hirayoshi, Nobuko Hosokawa, Kazuhiro Nagata,

thermodynamics and calorimetric analyses

HSP47 is a collagen-binding heat shock protein and is assumed to act as a molecular chaperone in the biosynthesis and secretion of procollagen. As the synthesis of HSP47 is closely correlated with that of collagen in various cell lines and tissues, we performed a promoter/reporter assay using HSP47-producing and nonproducing cells. 280 base pairs (bp(s)) of upstream promoter were shown to be necessary for the basal expression but not to be enough for the cell type-specific expression. When the first and the second introns were introduced downstream of this 280-bp region, marked up-regulation of the reporter activity was observed in HSP47-producing cells but not in nonproducing cells. This was confirmed in transgenic mice by staining the lacZ gene product under the control of the 280-bp upstream promoter and the introns. Staining was observed in skin, chondrocytes, precursor of bone, and other HSP47/collagen-producing tissues. A putative Sp1-binding site at −210 bp in the promoter, to which Sp3 and an unidentified protein bind, was shown to be responsible for this up-regulation when combined with the introns. However no difference in the binding to this probe was observed between HSP47-producing and nonproducing cells. The responsible region for cell type-specific up-regulation was found to be located in a 500-bp segment in the first intron. On electrophoresis mobility shift assay using this 500-bp probe, specific DNA-protein complexes were only observed in HSP47-producing cell extracts. These results suggest that two separate elements are necessary for the cell type-specific expression of the hsp47 gene; one is a putative Sp1-binding site at −210 bp necessary for basal expression, and the other is a 500-bp region within the first intron, required for cell type-specific expression. HSP47 is a collagen-binding heat shock protein and is assumed to act as a molecular chaperone in the biosynthesis and secretion of procollagen. As the synthesis of HSP47 is closely correlated with that of collagen in various cell lines and tissues, we performed a promoter/reporter assay using HSP47-producing and nonproducing cells. 280 base pairs (bp(s)) of upstream promoter were shown to be necessary for the basal expression but not to be enough for the cell type-specific expression. When the first and the second introns were introduced downstream of this 280-bp region, marked up-regulation of the reporter activity was observed in HSP47-producing cells but not in nonproducing cells. This was confirmed in transgenic mice by staining the lacZ gene product under the control of the 280-bp upstream promoter and the introns. Staining was observed in skin, chondrocytes, precursor of bone, and other HSP47/collagen-producing tissues. A putative Sp1-binding site at −210 bp in the promoter, to which Sp3 and an unidentified protein bind, was shown to be responsible for this up-regulation when combined with the introns. However no difference in the binding to this probe was observed between HSP47-producing and nonproducing cells. The responsible region for cell type-specific up-regulation was found to be located in a 500-bp segment in the first intron. On electrophoresis mobility shift assay using this 500-bp probe, specific DNA-protein complexes were only observed in HSP47-producing cell extracts. These results suggest that two separate elements are necessary for the cell type-specific expression of the hsp47 gene; one is a putative Sp1-binding site at −210 bp necessary for basal expression, and the other is a 500-bp region within the first intron, required for cell type-specific expression. heat shock protein 5-bromo-4-chloro-3-indolyl β-d-galactopyranoside heat shock element endoplasmic reticulum base pair(s) kilobase pair(s) polymerase chain reaction electrophoresis mobility shift assay Heat shock proteins (HSPs)1 are a highly conserved set of proteins that can be induced by heat shock and other environmental stresses. Generally, most stress proteins are expressed not only under stress conditions but also under normal growth conditions and known to play important roles in protein folding and assembly. They are now generally known as molecular chaperones. The mechanism for heat induction of HSPs is well studied and now known to be transcriptionally regulated by the interaction of heat shock factors with heat shock elements (HSEs), which locate in the promoter region of HSPs (1Morimoto R.I. Tissieres A. Georgopoulos C. The Biology of Heat Shock Proteins and Molecular Chaperones. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1994Google Scholar). HSP47 was identified as a collagen-binding 47-kDa glycoprotein (pI = 9.0) (2Nagata K. Yamada K.M. J. Biol. Chem. 1986; 261: 7531-7536Abstract Full Text PDF PubMed Google Scholar) and proved to be a heat shock protein (3Nagata K. Saga S. Yamada K.M. J. Cell Biol. 1986; 103: 223-229Crossref PubMed Scopus (181) Google Scholar, 4Nakai A. Satoh M. Hirayoshi K. Nagata K. J. Cell Biol. 1992; 117: 903-914Crossref PubMed Scopus (223) Google Scholar, 5Sauk J.J. Smith T. Norris K. Ferreira L. J. Biol. Chem. 1994; 269: 3941-3946Abstract Full Text PDF PubMed Google Scholar, 6Satoh M. Hirayoshi K. Yokota S. Hosokawa N. Nagata K. J. Cell Biol. 1996; 133: 469-483Crossref PubMed Scopus (190) Google Scholar). This protein belongs to the serine protease inhibitor (serpin) superfamily containing a serpin signature sequence (7Whisstock J. Skinner R. Lesk A.M. Trends Biochem. Sci. 1998; 23: 63-67Abstract Full Text PDF PubMed Scopus (162) Google Scholar). HSP47 resides in the endoplasmic reticulum (ER), as inferred from the presence of a carboxyl-terminal RDEL sequence similar to the ER retrieval signal, KDEL (8Wang S.Y. Gudas L.J. J. Biol. Chem. 1990; 265: 15818-15822PubMed Google Scholar, 9Hirayoshi K. Kudo H. Takechi H. Nakai A. Iwamatsu A. Yamada K.M. Nagata K. Mol. Cell. Biol. 1991; 11: 4036-4044Crossref PubMed Scopus (118) Google Scholar, 10Clarke E.P. Cates G.A. Ball E.H. Sanwal B.D. J. Biol. Chem. 1991; 266: 17230-17235Abstract Full Text PDF PubMed Google Scholar, 11Clarke E.P. Sanwal B.D. Biochim. Biophys. Acta. 1992; 1129: 246-248Crossref PubMed Scopus (38) Google Scholar, 12Pearson D.S. Kulyk W.M. Kelly G.M. Krone P.H. DNA Cell Biol. 1996; 15: 263-272Crossref PubMed Scopus (40) Google Scholar, 13Pelham H.R.B. Annu. Rev. Cell Biol. 1989; 5: 1-23Crossref PubMed Scopus (541) Google Scholar). HSP47 binds to nascent procollagen chains in the ER of collagen-secreted cells and dissociates from them before reaching the cis-Golgi apparatus (4Nakai A. Satoh M. Hirayoshi K. Nagata K. J. Cell Biol. 1992; 117: 903-914Crossref PubMed Scopus (223) Google Scholar, 6Satoh M. Hirayoshi K. Yokota S. Hosokawa N. Nagata K. J. Cell Biol. 1996; 133: 469-483Crossref PubMed Scopus (190) Google Scholar, 14Saga S. Nagata K. Chen W.T. Yamada K.M. J. Cell Biol. 1987; 105: 517-527Crossref PubMed Scopus (145) Google Scholar). Thus HSP47 functions as a collagen-specific molecular chaperone (15Nagata K. Trends Biochem. Sci. 1996; 21: 23-26Abstract Full Text PDF Scopus (253) Google Scholar). The expression of HSP47 is markedly increased by various stresses including heat shock. This heat induction is due to the presence of a well conserved HSE at −80∼−62 bp in the promoter (16Takechi H. Hirayoshi K. Kudo H. Saga S. Nagata K. Eur. J. Biochem. 1992; 206: 323-329Crossref PubMed Scopus (93) Google Scholar, 17Hosokawa N. Takechi H. Hirayoshi K. Nagata K. Gene. 1993; 126: 187-193Crossref PubMed Scopus (35) Google Scholar). On the other hand, the constitutive expression of HSP47 appears to be co-regulated with that of several types of collagens (15Nagata K. Trends Biochem. Sci. 1996; 21: 23-26Abstract Full Text PDF Scopus (253) Google Scholar). For example, the synthesis of HSP47 and type IV collagen are coordinately increased during the differentiation of murine F9 teratocarcinoma cells (16Takechi H. Hirayoshi K. Kudo H. Saga S. Nagata K. Eur. J. Biochem. 1992; 206: 323-329Crossref PubMed Scopus (93) Google Scholar, 18Wang S.Y. Larosa G.J. Gudas L.J. Dev. Biol. 1985; 107: 75-86Crossref PubMed Scopus (150) Google Scholar), and the synthesis of both HSP47 and type I collagen are decreased following viral transformation of the fibroblasts. Collagen-nonproducing cells such as mouse myeloid leukemia M1cells and rat pheochromocytoma PC12 cells do not synthesize HSP47 (19Nagata K. Hirayoshi K. Obara M. Saga S. Yamada K.M. J. Biol. Chem. 1988; 263: 8344-8349Abstract Full Text PDF PubMed Google Scholar, 20Nakai A. Hirayoshi K. Nagata K. J. Biol. Chem. 1990; 265: 992-999Abstract Full Text PDF PubMed Google Scholar). Immunocytochemical analysis has revealed that during murine tooth development, HSP47 synthesis coincides with type I collagen production (21Shroff B. Smith T. Norris K. Pileggi R. Sauk J.J. Connect. Tissue Res. 1993; 29: 273-286Crossref PubMed Scopus (39) Google Scholar, 22Shroff B. Pileggi R. Norris K. Orbegoso R. Wilson T. Sauk J.J. Arch. Oral Biol. 1994; 39: 231-243Crossref PubMed Scopus (20) Google Scholar) and that HSP47 is localized within developing tissues or cells that secrete various types of collagens (23Miyaishi O. Sakata K. Matsuyama M. Saga S. J. Histochem. Cytochem. 1992; 40: 1021-1029Crossref PubMed Scopus (45) Google Scholar, 24Pak B.J. Wigle D.A. Watson J.D. Cates G.A. Brickenden A.M. Ball E.H. Pang S.C. Biochem. Cell Biol. 1996; 74: 179-185Crossref PubMed Scopus (9) Google Scholar). Masuda et al. (25Masuda H. Fukumoto M. Hirayoshi K. Nagata K. J. Clin. Invest. 1994; 94: 2481-2488Crossref PubMed Scopus (198) Google Scholar) reported that the synthesis of HSP47 as well as of type I and III collagen increases during the progression of carbon tetrachloride-induced liver fibrosis. Marked induction of HSP47 was also reported in the fibrosis of kidney (26Cheng M. Razzaque M.S. Nazneen A Taguchi T. Int. J. Exp. Pathol. 1998; 79: 125-132Crossref PubMed Scopus (44) Google Scholar, 27Sunamoto M. Kuze T. Iehara H. Takaoka H. Nagata K. Kita T. Doi T. Int. J. Exp. Pathol. 1998; 79: 133-140Crossref PubMed Scopus (38) Google Scholar). These results suggest that the expression of HSP47 under nonstressed conditions is co-regulated with that of collagens in various cell lines and tissues as well as in pathophysiological conditions. In this paper, we analyzed the promoter activity of thehsp47 gene in terms of co-expression with collagen and show that the basal promoter activity of HSP47 exists within a 280-bp promoter region, which was identified as a putative Sp1-binding site, and the introduction of a downstream intron region caused marked up-regulation of its activity only in HSP47/collagen-producing cells but not in nonproducing cells. The mouse genomic DNA library was purchased fromCLONTECH.The recombinant phages carrying mouse DNA fragments were generated by partial digestion with Sau3AI followed by ligation to the EMBL-3 arms. This library was screened using a 1.2-kb fragment containing −1196∼+38 of the mousehsp47 gene (17Hosokawa N. Takechi H. Hirayoshi K. Nagata K. Gene. 1993; 126: 187-193Crossref PubMed Scopus (35) Google Scholar) as a probe. Hybridization-positive phage clones were amplified, and phage DNA was purified. Long PCR was performed as follows. Oligonucleotide primers corresponding to the −5.5-kb region and the third exon (−5.5-kb primer, 5′-ATCCATGCAGACAGCAGAGGTG-3′; third exon primer, 5′-CTGGTCTTTGGCCATCGCCT-3′) were used in Long and Accurate PCR (TaKaRa Shuzo Co., Ltd., Kyoto, Japan), with 1 μg of DNA isolated from BALB/c3T3 cells as a template. Whole cell extracts (20 μg for each lane) were electrophoresed on 10, 10, or 4% SDS-polyacrylamide gels, transferred to nitrocellulose membranes, and probed with anti-HSP47 (colligin) monoclonal antibody (StressGen, Victoria, BC, Canada), anti-actin monoclonal antibody (Chemicon International, Inc., CA), and anti-type I collagen polyclonal antibody (LSL, Japan). The immunoblots were then incubated with horseradish peroxidase-conjugated counter-antibody to visualize the immunoreactive bands with an ECL system (Amersham Pharmacia Biotech). Mouse BALB/c3T3 fibroblasts, human embryonal kidney 293 cells, human epitheloid carcinoma HeLa cells, human osteosarcoma HOS cells, and mouse embryonal carcinoma F9 cells were cultured in Dulbecco's modified Eagle's medium (with low glucose) supplemented with 10% fetal bovine serum. Mouse osteoblastic MC3T3-E1 cells were cultured in minimum essential α medium supplemented with 10% fetal bovine serum. Human acute T cell leukemia Jurkat cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum. DNA from thehsp47 gene containing 5.5 kb of upstream promoter and 38 bp of exon I was cloned into a luciferase expression vector, pGL2-basic (Promega), to create pLUC5.5. pLUC2.2, pLUC280, and pLUC13 were generated from pLUC5.5 using the NcoI restriction site at −2.2, SacII site at −280, and SmaI site at −13, respectively. pLUC50 was generated by PCR cloning using the pLUC50 primer (5′-AAGTCGACGGGGGTGGGGCCAGCC-3′). pLUC890 and pLUC210 were generated with a double-stranded nested deletion kit (Amersham Pharmacia Biotech). Intron-containing constructs were generated by introducing a SalI restriction site just before the translational start site in the third exon of the hsp47gene to create pLUC5.5(III) and pLUC280(III). pLUC280(III)Sp1m was generated by site-directed mutagenesis (28Maniatis T. Fritsch E.F. Sambrook J. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1982: 15.51-15.62Google Scholar). Constructs lacking various regions in the introns were generated by using restriction sites as shown in Fig. 9. All plasmids were purified by ultracentrifugation twice and/or a Qiagen Maxi Kit, and it was confirmed that the transfection efficiencies were equal. Cells were plated at a density of 7 × 104/35-mm culture dish 16 h before transfection and transfected by the calcium phosphate method with 5 μg of the reporter plasmid and 1 μg of pact-β-galactosidase plasmid bearing the chicken β-actin promoter upstream of the lacZ gene (29Maekawa T. Matsuda S. Fujisawa J. Yoshida M. Ishii S. Oncogene. 1991; 6: 627-632PubMed Google Scholar) to normalize the differences in transfectional efficiencies. The precipitate was removed after 4 h, and fresh medium was added. At 48 h after the transfection, cells were harvested to perform the luciferase assay. Quantitation of luciferase activities was carried out by Lumat LB9501 (Berthold). β-Galactosidase assay was performed according to Maniatiset al. (28Maniatis T. Fritsch E.F. Sambrook J. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1982: 15.51-15.62Google Scholar). Transfection into Jurkat cells was performed with LipofectAMINE (Life Technologies, Inc.). Transgenic mice were produced by microinjecting each of the linearized DNA (5.5(III)ZβA, 280(III)ZβA, 280ZβA) into the pronuclei of fertilized eggs from F1 hybrid mice (C57BL/6 ×C3H) as described (30Hogan B.L.M. Beddington R. Constantini F. Lacy E. Manipulating the Mouse Embryo: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1994: 226-244Google Scholar). Founder mice were identified by PCR assays of genomic DNA extracted from the tail. The DNA was subjected to lacZ-specific PCR with a set of primers to amplify an 822-bp product (31Hanley T. Merlie J.P. Biotechniques. 1991; 10: 56PubMed Google Scholar). Positive founder mice were mated with wild-type mice to generate hemizygous embryos, and positive embryos were identified by PCR using placenta DNA. After being rinsed in phosphate-buffered saline, pH 7.2, mouse embryos were fixed for 6 h at 4 °C in phosphate-buffered saline, pH 7.4, containing 2% paraformaldehyde, 0.2% glutaraldehyde, and 0.02% Nonidet P-40. X-gal staining was performed as described (32Bonnerot C. Nicolas J.F. Methods Enzymol. 1993; 225: 451-469Crossref PubMed Scopus (91) Google Scholar). Cell extract (3 μg) in 20 ml of gel shift buffer (20 mm HEPES, pH 7.9, 1 mm MgCl2, 60 mm KCl, 12% glycerol) was incubated on ice for 15 min in the presence of 1 μg of poly(dI-dC), and then 32P-end-labeled probes were added, and the mixture was incubated at room temperature for an additional 20 min with or without nonradiolabeled competitors. Protein-DNA complexes were resolved on 4% polyacrylamide gels in electrophoresis buffer (22.5 mm Tris, 22.5 mm boric acid, 0.5 mm EDTA) and electrophoresed for 2 h. The sequences of the oligonucleotide probe and competitors are given below: HSP47Sp1 spanning nucleotides −228∼−194, CCCCCTCTACCTAGTAGGGCGAGGGGGCAGTAGGAC; HSP47Sp1m, CCCCTCTACCTAGTAGAATGAGGGGGCAGTAGGAC; consensus Sp1, TGGATTCGATCGGGGCGGGGCGAG. Antibodies against Sp1, Sp2, Sp3, and Sp4 were purchased from Santa Cruz Biotechnology. In the case of electrophoresis mobility shift assay (EMSA) using the 500-bp intron, protein-DNA complexes were resolved on 2.5% polyacrylamide gel. We used a 1.2-kb promoter region of the hsp47 gene (17Hosokawa N. Takechi H. Hirayoshi K. Nagata K. Gene. 1993; 126: 187-193Crossref PubMed Scopus (35) Google Scholar) to screen a mouse genomic library generated by partial digestion withSau3AI (CLONTECH). Four independent positive clones were isolated from 2 ×106 phage, and the restriction map was determined for the clone (Fig. 1). This clone contained a 5.5-kb promoter region and the entire hsp47 gene. Long distance PCR of mouse BALB/c3T3 genomic DNA confirmed that this clone does not contain chimeric inserts (data not shown). We used this clone for subcloning and further analysis. Mouse BALB/c3T3 fibroblasts produce high levels of both type I collagen and HSP47 (6Satoh M. Hirayoshi K. Yokota S. Hosokawa N. Nagata K. J. Cell Biol. 1996; 133: 469-483Crossref PubMed Scopus (190) Google Scholar). On the other hand, human embryonal kidney 293 cells do not produce any type of collagen nor HSP47 (33Nischt R. Pottgiesser J. Krieg T. Mayer U. Aumailley M. Timpl R. Eur. J. Biochem. 1991; 200: 529-536Crossref PubMed Scopus (87) Google Scholar,34Hosokawa N. Satoh M. Kühn K. Nagata K. J. Biochem. (Tokyo). 1998; 124: 654-662Crossref PubMed Scopus (29) Google Scholar). We confirmed this by immunoblot analysis as shown in Fig. 2 A using anti-HSP47 antibody and anti-type I collagen antibody, which can react with both mouse and human HSP47 and type I collagen, respectively (also see Fig. 4 A). DNA sequences from −5.5 kb to +38 bp were fused to the luciferase gene to create a fusion plasmid (pLUC5.5) to determine whether DNA sequences located in the 5′-flanking region of thehsp47 gene are involved in its cell type-specific expression. Several 5′-deletion constructs (pLUC2.2, pLUC890, pLUC280, pLUC50, and pLUC13) were also created as shown in Fig. 2 B. These plasmids were transiently transfected into HSP47/collagen-producing BALB/c3T3 cells or nonproducing 293 cells by the calcium phosphate method, and luciferase assays were performed after 48 h. Luciferase activity in both cells was normalized by the luciferase activity of the pSV40-LUC carrying both the promoter and enhancer of SV40. In both BALB/3T3 and 293 cells, the luciferase activity of pLUC280 containing HSE and putative Sp1-binding sites was higher than that of pLUC50, which contained only a TATA box. The luciferase activity was hardly detected in pLUC13, which did not a contain TATA box. In both BALB/c3T3 and 293 cells, pLUC5.5 did not exhibit any more activity than pLUC280. The luciferase activity of other 5′-deletion constructs (pLUC2.2 and pLUC890) was comparable with that of pLUC5.5 or pLUC280. Thus, the 280-bp promoter was postulated as a minimum promoter. However, no differences between BALB/c3T3 cells and 293 cells were observed in the luciferase activity of pLUC280 or pLUC5.5. These results suggest that 5.5 kb or 280 bp of the upstream region, which confers the basic promoter activity, is not sufficient for the cell type-specific transcriptional activation.FIG. 4Cell type-specific expression of HSP47. A, immunoblot of type I collagen, HSP47, and β-actin. Whole cell extracts (20 μg) from 7 cell lines were separated by 4, 10, and 10% SDS-polyacrylamide gel electrophoresis under reducing conditions to identify type I collagen, HSP47, and β-actin, respectively. B, luciferase assay in seven cell lines.Error bars represent means ± S.D. of at least three experiments in duplicate.View Large Image Figure ViewerDownload (PPT)