Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Human Sex Hormone-binding Globulin Promoter Activity Is Influenced by a (TAAAA) Repeat Element within an Alu Sequence

2001; Elsevier BV; Volume: 276; Issue: 39 Linguagem: Inglês

10.1074/jbc.m104681200

ISSN

1083-351X

Autores

Kevin Hogeveen, Marja Talikka, Geoffrey L. Hammond,

Tópico(s)

Stress Responses and Cortisol

Resumo

Sex hormone-binding globulin (SHBG) is the major sex steroid-binding protein in human plasma and is produced by the liver. Plasma SHBG levels vary considerably between individuals and are influenced by hormonal, metabolic, and nutritional factors. We have now found that a (TAAAA)n pentanucleotide repeat, located within an alu sequence at the 5′ boundary of the human SHBG promoter, influences its transcriptional activity in association with downstream elements, including an SP1-binding site. Furthermore, SHBG alleles within the general population contain at least 6–10 TAAAA repeats, and the transcriptional activity of a human SHBGpromoter-luciferase reporter construct containing 6 TAAAA repeats was significantly lower than for similar reporter constructs containing 7–10 TAAAA repeats when tested in human HepG2 hepatoblastoma cells. This difference in transcriptional activity reflected the preferential binding of a 46-kDa liver-enriched nuclear factor to an oligonucleotide containing 6 rather than 7–10 TAAAA repeats. Thus, a (TAAAA)n element within the humanSHBG promoter influences transcriptional activity in HepG2 cells and may contribute to differences in plasma SHBG levels between individuals. Sex hormone-binding globulin (SHBG) is the major sex steroid-binding protein in human plasma and is produced by the liver. Plasma SHBG levels vary considerably between individuals and are influenced by hormonal, metabolic, and nutritional factors. We have now found that a (TAAAA)n pentanucleotide repeat, located within an alu sequence at the 5′ boundary of the human SHBG promoter, influences its transcriptional activity in association with downstream elements, including an SP1-binding site. Furthermore, SHBG alleles within the general population contain at least 6–10 TAAAA repeats, and the transcriptional activity of a human SHBGpromoter-luciferase reporter construct containing 6 TAAAA repeats was significantly lower than for similar reporter constructs containing 7–10 TAAAA repeats when tested in human HepG2 hepatoblastoma cells. This difference in transcriptional activity reflected the preferential binding of a 46-kDa liver-enriched nuclear factor to an oligonucleotide containing 6 rather than 7–10 TAAAA repeats. Thus, a (TAAAA)n element within the humanSHBG promoter influences transcriptional activity in HepG2 cells and may contribute to differences in plasma SHBG levels between individuals. sex hormone-binding globulin nucleotide(s) polyacrylamide gel electrophoresis polymerase chain reaction electrophoretic mobility shift assay dithiothreitol lipoprotein (a) Plasma sex hormone-binding globulin (SHBG)1 binds testosterone and estradiol with high affinity and selectivity, and regulates the access of these sex steroids to their target tissues (1Siiteri P.K. Murai J.T. Hammond G.L. Nisker J.A. Raymoure W.J. Kuhn R.W. Recent Prog. Horm. Res. 1982; 38: 457-510PubMed Google Scholar). Hepatocytes are the primary site of plasma SHBG biosynthesis, and changes in the blood levels of SHBG are influenced by hormonal, as well as metabolic and nutritional status (2Hammond G.L. Endocr. Rev. 1990; 11: 65-79Crossref PubMed Scopus (262) Google Scholar). Low serum SHBG levels are commonly found in women with polycystic ovarian syndrome and disorders characterized by androgen excess (3Anderson D.C. Clin. Endocrinol. 1974; 3: 69-96Crossref PubMed Scopus (964) Google Scholar), and have been reported to be a prognostic indicator for the onset of type II diabetes and cardiovascular disease (4Lim S.C. Caballero A.E. Arora S. Smakowski P. Bashoff E.M. Brown F.M. Logerfo F.W. Horton E.S. Veves A. J. Clin. Endocrinol. Metab. 1999; 84: 4159-4164Crossref PubMed Scopus (56) Google Scholar, 5Skafar D.F. Xu R. Morales J. Ram J. Sowers J.R. J. Clin. Endocrinol. Metab. 1997; 82: 3913-3918Crossref PubMed Scopus (130) Google Scholar). Low serum levels of SHBG are also inherited within families (6Meikle A.W. Stanish W.M. Taylor N. Edwards C.Q. Bishop C.T. Metabolism. 1982; 31: 6-9Abstract Full Text PDF PubMed Scopus (58) Google Scholar,7Jaquish C.E. Blangero J. Haffner S.M. Stern M.P. MacCluer J.W. Metabolism. 1997; 46: 988-991Abstract Full Text PDF PubMed Scopus (30) Google Scholar), and associations between abnormal serum SHBG levels and disease processes may therefore be obscured by genetic differences that contribute to variations in human SHBG gene expression. We have recently characterized two binding sites for HNF-4 and COUP-TF within the human SHBG proximal promoter, which influence its transcriptional activity in human HepG2 hepatoblastoma cells (8Jänne M. Hammond G.L. J. Biol. Chem. 1998; 273: 34105-34114Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar). In particular, binding of HNF-4 to a TA-rich sequence close to the transcription start site in liver cells appears to substitute for the TATA-binding protein in the initiation of transcription (8Jänne M. Hammond G.L. J. Biol. Chem. 1998; 273: 34105-34114Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar). The possible function of the second HNF-4 binding site in theSHBG proximal promoter is not as clear, but it may contribute to phylogenetic differences in the temporal and tissue-specific expression of SHBG because it lies within a region that is absent in the corresponding region of SHBGgenes in other mammalian species (8Jänne M. Hammond G.L. J. Biol. Chem. 1998; 273: 34105-34114Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar). Apart from this obvious difference in SHBG promoter sequences between species, the human and rodent SHBG promoters show a remarkable degree of sequence conservation, which only begins to diverge at the boundary of several alu sequences located at about −700 nt from the human SHBG transcription start site (8Jänne M. Hammond G.L. J. Biol. Chem. 1998; 273: 34105-34114Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar). This likely represents a functional boundary within the promoter sequence because human SHBG gene sequences containing only 803 nt of promoter sequence are expressed in a spatially and temporally appropriate manner when introduced as transgenes into the mouse genome (9Jänne M. Deol H.K. Power S.G.A. Yee S.-P. Hammond G.L. Mol. Endocrinol. 1998; 12: 123-136Crossref PubMed Scopus (85) Google Scholar, 10Jänne M. Hogeveen K.N. Deol H.K. Hammond G.L. Endocrinology. 1999; 140: 4166-4174Crossref PubMed Scopus (31) Google Scholar). Although the significance of repetitive elements within promoter sequences is unclear, they may contain nuclear factor binding sites that contribute to the regulation of transcription (11Sharan C. Hamilton N.M. Parl A.K. Singh P.K. Chaudhuri G. Biochem. Biophys. Res. Commun. 1999; 265: 285-290Crossref PubMed Scopus (30) Google Scholar, 12Norris J. Fan D. Aleman C. Marks J.R. Futreal P.A. Wiseman R.W. Iglehart J.D. Deininger P.L. McDonnell D.P. J. Biol. Chem. 1995; 270: 22777-22782Abstract Full Text Full Text PDF PubMed Scopus (199) Google Scholar, 13Vansant G. Reynolds W.F. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 8229-8233Crossref PubMed Scopus (141) Google Scholar). By characterizing the upstream region of the human SHBGpromoter, we have now found that a (TAAAA)6 repeat within an alu sequence binds a 46-kDa liver enriched nuclear protein and acts to silence transcription. More importantly, the number of TAAAA repeats at this location is highly variable between individuals within the general population, and the transcriptional activity of the SHBG promoter and the binding of nuclear protein to this element are both directly related to the number of TAAAA repeats. In vitrofootprinting templates of human SHBG promoter upstream regions were produced by digesting a human SHBG fragment (14Hammond G.L. Underhill D.A. Rykse H.M. Smith C.L. Mol. Endocrinol. 1989; 3: 1869-1876Crossref PubMed Scopus (125) Google Scholar) with XhoI and XbaI. This released a 504-base pair region of the SHBG promoter corresponding to −803/−299 nt relative to the transcription start site in the liver (8Jänne M. Hammond G.L. J. Biol. Chem. 1998; 273: 34105-34114Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar). This fragment was further digested with HaeIII orHinfI, and the products (−803/−656 ntXhoI-HaeIII, −735/−587 ntHinfI-HinfI, −587/−362 ntHinfI-HinfI, −541/−298 ntHaeIII-XbaI) were cloned into theEcoRV site of pBluescript (Stratagene, La Jolla, CA) in the correct orientation to permit labeling of the sense strand after digestion with HindIII. The HindIII-digested constructs were end-labeled with the Klenow fragment of DNA polymerase I in the presence of [α-32P]dCTP and purified using a NICK™ column (Amersham Pharmacia Biotech, Baie d'Urfé, Québec, Canada). Radiolabeled probes were released from the plasmids by digestion with EcoRI and purified by 6% polyacrylamide gel electrophoresis (PAGE). The DNase I footprinting reactions with mouse liver nuclear extracts were carried out as described previously (8Jänne M. Hammond G.L. J. Biol. Chem. 1998; 273: 34105-34114Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar). Hydroxy-radical footprinting with the same extracts was also performed using the −803/−656 ntXhoI-HaeIII region of the human SHBGpromoter (15Tullius T.D. Dombroski B.A. Churchill M.E.A. Kam L. Methods Enzymol. 1987; 155: 537-558Crossref PubMed Scopus (283) Google Scholar, 16O'Halloran T.V. Frantz B. Shin M.K. Ralston D.M. Wright J.G. Cell. 1989; 56: 119-129Abstract Full Text PDF PubMed Scopus (194) Google Scholar). Mouse liver nuclear extracts were used in these and other experiments to characterize and study the regulation of humanSHBG promoter activity because human SHBGtransgenes are expressed efficiently in mouse hepatocytes postnatally (9Jänne M. Deol H.K. Power S.G.A. Yee S.-P. Hammond G.L. Mol. Endocrinol. 1998; 12: 123-136Crossref PubMed Scopus (85) Google Scholar, 10Jänne M. Hogeveen K.N. Deol H.K. Hammond G.L. Endocrinology. 1999; 140: 4166-4174Crossref PubMed Scopus (31) Google Scholar). Human SHBG promoter deletion constructs were generated by amplifying a region from anSHBG fragment (14Hammond G.L. Underhill D.A. Rykse H.M. Smith C.L. Mol. Endocrinol. 1989; 3: 1869-1876Crossref PubMed Scopus (125) Google Scholar) in a polymerase chain reaction (PCR). This was done using a common reverse primer containing anXbaI site (−299) and forward primers (containing anXhoI site) corresponding to various positions in the 5′ promoter region (Table I). These PCR products were digested with XhoI and XbaI and then subcloned into a pSP72 vector (Promega Corp., Madison, WI) containing the −299/+60 nt region of the human SHBGproximal promoter. The entire promoter sequences were then excised withHindIII and XhoI and inserted into a pGL2 Basic luciferase reporter plasmid (Promega).Table ISequences of oligonucleotides used for deleting (A) or mutating (B) human SHBG promoter sequence in the context of luciferase reporter gene constructsA. DescriptionPCR oligonucleotides for promoter deletions−299 reverse5′-GAGGTCTAGAAACAGTCCTCCCCTGCGT−696 forward5′-TGAACTCGAGGGGTCAGGGAGTGGGTGA−670 forward5′-GAACTCGAGCTAGACTGTTTAGGCCCTGT−617 forward5′-TGAACTCGAGGGGGGCAGGTCCCTTCTTAAT−552 forward5′-TGAACTCGAGGCCTCAGAGGCCTGGGAAAAG−509 forward5′-TGAACTCGAGAGATGCCAGGCACTGTGCCTG−458 forward5′-TGAACTCGAGACCCCGTAAAGTATTATTTTCB. DescriptionMutagenic oligonucleotidesΔ6TAAAA5′-GAAATCACCCACTCCCTGACCCGACAGAGTCTTGCTCTATCACCC4xTAAAA5′-GAAATCACCCACTCCCTGACCCA(TTTTA)4GACAGAGTCTTGCTCTATCACCC5xTAAAA5′-GAAATCACCCACTCCCTGACCCA(TTTTA)5GACAGAGTCTTGCTCTATCACCC7xTAAAA5′-GAAATCACCCACTCCCTGACCCA(TTTTA)7GACAGAGTCTTGCTCTATCACCC8xTAAAA5′-GAAATCACCCACTCCCTGACCCA(TTTTA)8GACAGAGTCTTGCTCTATCACCC9xTAAAA5′-GAAATCACCCACTCCCTGACCCA(TTTTA)9GACAGAGTCTTGCTCTATCACCC10xTAAAA5′-GAAATCACCCACTCCCTGACCCA(TTTTA)10GACAGAGTCTTGCTCTATCACCCMutation of SP1 (−536/−510)5′-GGTCTGAACTCCTAACCCAGTCTTTTUnderlined sequences denote restriction enzyme recognition sites used for creation of human SHBG promoter constructs. Δ6TAAAA oligonucleotide designed to remove the TAAAA sequence. Mutations introduced into the FP12 SP1 binding site (−536/−510) (in bold) were designed based upon a previous mutation in an SP1 consensus sequence (39Xie M. Shao G. Buyse I.M. Huang S. J. Biol. Chem. 1997; 272: 26360-26366Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar). Open table in a new tab Underlined sequences denote restriction enzyme recognition sites used for creation of human SHBG promoter constructs. Δ6TAAAA oligonucleotide designed to remove the TAAAA sequence. Mutations introduced into the FP12 SP1 binding site (−536/−510) (in bold) were designed based upon a previous mutation in an SP1 consensus sequence (39Xie M. Shao G. Buyse I.M. Huang S. J. Biol. Chem. 1997; 272: 26360-26366Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar). Site-directed mutagenesis was accomplished using a pSELECT vector containing the −803/−299 nt region of the human SHBGpromoter, according to the Altered Sites manual (Promega). Mutated sequences in pSELECT were removed by XhoI andXbaI digestion and subcloned into the pSP72 vector containing the −299/+60 nt region of the human SHBGpromoter, and the entire promoter sequences were then inserted into pGL2 Basic, as described above. All PCR-generated and mutated sequences were confirmed by DNA sequencing using a commercially available kit (Amersham Pharmacia Biotech). All cell culture reagents were from Life Technologies, Inc. (Burlington, Canada). Human HepG2 hepatoblastoma cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, and were transiently transfected with human SHBG promoter-pGL2 reporter constructs (1.2 μg) and pCMV LacZ (0.2 μg) using LipofectAMINE® reagent (8Jänne M. Hammond G.L. J. Biol. Chem. 1998; 273: 34105-34114Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar). Cells were harvested 48 h following transfection, and cell extracts were prepared by three cycles of freezing and thawing for analysis of luciferase and β-galactosidase activity. Luciferase units were divided by readings obtained from a β-galactosidase assay to correct for efficiency of transfection. Mouse liver nuclear protein extracts (4 μg) were prepared (17Sierra F. BioMethods: A Laboratory Guide to In Vitro Transcription. Birkhäuser Verlag, Berlin1990Crossref Google Scholar), and then incubated in EMSA buffer (2.5 mm HEPES, pH 7.6, 0.5 mm EDTA, 0.5 mm DTT, 50 mm NaCl, 6.25% glycerol, and 3 μg of poly(dI-dC)) on ice for 10 min in the presence or absence of double-stranded competitor oligonucleotides (Table II). The corresponding end-labeled oligonucleotide probes were then added, and the binding reaction was allowed to proceed for 15 min at room temperature. For antibody supershift assays, radiolabeled probe was incubated with nuclear extract on ice for 15 min prior to addition of either normal rabbit serum, or an antiserum specific to SP1 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA). Reactions were then incubated for 15 min at room temperature before electrophoresis. Nuclear proteins bound to radiolabeled oligonucleotides were separated from free probe by 5% PAGE, and the gel was dried and exposed to Biomax MR film (Eastman Kodak Co., Rochester, NY) against an intensifying screen at −80 °C.Table IISequences of oligonucleotides used in South-western blotting, UV cross-linking experiments, and electrophoretic mobility shift assays (EMSAs)DescriptionEMSA oligonucleotides6xTAAAA5′-gTC(TAAAA)6TGGGT3′- AG(ATTTT)6ACCCAg7xTAAAA5′-gTC(TAAAA)7TGGGT3′- AG(ATTTT)7ACCCAg8xTAAAA5′-gTC(TAAAA)8TGGGT3′- AG(ATTTT)8ACCCAg9xTAAAA5′-gTC(TAAAA)9TGGGT3′- AG(ATTTT)9ACCCAg10xTAAAA5′-gTC(TAAAA)10TGGGT3′- AG(ATTTT)10ACCCAgFP125′-gAAAAGACTGGGGGAGGAGTTCAGAC3′- TTTTCTGACCCCCTCCTCAAGTCTGgFP12 mutant5′-GAAAAGACTGGGTTAGGAGTTCAGAC3′- TTTTCTGACCCAATCCTCAAGTCTGgSP15′-GCTGAGGGCGGGACCGCATC3′-CGACTCCCGCCCTGGCGTAGHNF-4/COUP-TF5′-tcgaCTGGGCAGGGGTCAAGGGTCAGTGCCC3′- GACCCGTCCCCAGTTCCCAGTCACGGGagctLowercase letters indicate additional sequences that were filled using the Klenow fragment of DNA polymerase I and [α-32P]dCTP (17Sierra F. BioMethods: A Laboratory Guide to In Vitro Transcription. Birkhäuser Verlag, Berlin1990Crossref Google Scholar). Mutations (in bold) introduced into FP12 (−536/−510) were based upon a previous mutation that disrupts an SP1 recognition sequence (39Xie M. Shao G. Buyse I.M. Huang S. J. Biol. Chem. 1997; 272: 26360-26366Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar). Double-stranded oligonucleotides representing SP1 (40Prince V.E. Rigby P.W. J. Virol. 1991; 65: 1803-1811Crossref PubMed Google Scholar) and HNF-4/COUP-TF (8Jänne M. Hammond G.L. J. Biol. Chem. 1998; 273: 34105-34114Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar) binding sites were used as reported by others. Open table in a new tab Lowercase letters indicate additional sequences that were filled using the Klenow fragment of DNA polymerase I and [α-32P]dCTP (17Sierra F. BioMethods: A Laboratory Guide to In Vitro Transcription. Birkhäuser Verlag, Berlin1990Crossref Google Scholar). Mutations (in bold) introduced into FP12 (−536/−510) were based upon a previous mutation that disrupts an SP1 recognition sequence (39Xie M. Shao G. Buyse I.M. Huang S. J. Biol. Chem. 1997; 272: 26360-26366Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar). Double-stranded oligonucleotides representing SP1 (40Prince V.E. Rigby P.W. J. Virol. 1991; 65: 1803-1811Crossref PubMed Google Scholar) and HNF-4/COUP-TF (8Jänne M. Hammond G.L. J. Biol. Chem. 1998; 273: 34105-34114Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar) binding sites were used as reported by others. Binding reactions of nuclear protein extracts to double-stranded oligonucleotides comprising various TAAAA repeats (Table II) were carried out under the same conditions used for EMSAs. After a 15-min incubation at room temperature, samples were exposed to UV light (302 nm) at a distance of 10 cm for 15 min at 0 °C. Equal volumes of sodium dodecyl sulfate (SDS) loading buffer were added, and samples were heated at 95 °C for 5 min and subjected to SDS-PAGE with 4 and 10% acrylamide in the stacking and resolving gels, respectively. Gels were dried and exposed to x-ray film, as described above. Nuclear proteins extracted from MSC-1 mouse Sertoli cells and human HeLa cervical cancer cells (18Dignam J.D. Lebovitz R.M. Roeder R.G. Nucleic Acids Res. 1983; 11: 1475-1488Crossref PubMed Scopus (9132) Google Scholar), as well as mouse liver (17Sierra F. BioMethods: A Laboratory Guide to In Vitro Transcription. Birkhäuser Verlag, Berlin1990Crossref Google Scholar), were fractionated by SDS-PAGE and transferred by electrophoresis onto a Hybond™ ECL™ nitrocellulose membrane (Amersham Pharmacia Biotech). The membrane was washed three times for 45 min in a buffer containing 10 mm Tris, pH 7.5, 150 mm NaCl, 10% glycerol, 2.5% Nonidet P-40, 5% milk powder, and 0.1 mm DTT. It was then rinsed twice in binding buffer (10 mm Tris, pH 7.5, 40 mm NaCl, 1 mm EDTA, 1 mm DTT, 8% glycerol, and 0.125% milk powder). A radiolabeled double-stranded oligonucleotide (250,000 cpm/ml) spanning the (TAAAA)6 sequence in theSHBG upstream promoter (Table II) was added to the binding solution containing 5 mm MgCl2 and 5 μg/ml poly(dI-dC), and was incubated with the membrane for 16 h at room temperature. The membrane was then washed in 50 mm Tris, pH 7.5, 150 mm NaCl and exposed to Biomax MR film, as described above. Genomic DNA was isolated from peripheral blood leukocytes of healthy human volunteers (19Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar). Amplification of the TAAAA repeat region was accomplished using PCR with a forward primer (5′-GCTTGAACTCGAGAGGCAG) within an alu sequence in the humanSHBG promoter (14Hammond G.L. Underhill D.A. Rykse H.M. Smith C.L. Mol. Endocrinol. 1989; 3: 1869-1876Crossref PubMed Scopus (125) Google Scholar), and a reverse primer (5′-CAGGGCCTAAACAGTCTAGCAGT) corresponding to a sequence at −651/−673 nt within the upstream promoter sequence. Amplified products were separated by 10% PAGE followed by staining with ethidium bromide. The number of TAAAA repeats was quantified by cloning PCR products in the pCR®-BluntII-TOPO® vector (Invitrogen Corp., Carlsbad, CA) for sequencing. Serum samples from the same individuals were also taken for measurements of SHBG concentrations using a commercially available immunoradiometric assay kit (Orion Diagnostica, Oulunsalo, Finland). Putative binding sites for nuclear proteins in the human SHBG upstream promoter were demonstrated by in vitro footprinting using mouse liver nuclear extracts (Fig. 1). One of these footprints (FP17) contains a sequence (5′-TGATAGAGCAAGAC), which resembles a CEBPβ binding site when examined by homology searches using MatInspector (20Quandt K. Frech K. Karas H. Wingender E. Werner T. Nucleic Acids Res. 1995; 23: 4878-4884Crossref PubMed Scopus (2419) Google Scholar) release 2.1. In addition, a sequence (5′-GGGGGAGGAGT) within FP12 (nt −527/−517) resembles a consensus SP1 binding site (5′-GGGGCGGGG(C/T)) by analysis using the TRANSFAC data base (21Wingender E. Chen X. Hehl R. Karas H. Liebich I. Matys V. Meinhardt T. Prüß M. Reuter I. Schacherer F. Nucleic Acids Res. 2000; 28: 316-319Crossref PubMed Scopus (1016) Google Scholar). A region containing six TAAAA repeats, which is resistant to DNase I digestion in the presence or absence of nuclear protein, lies between FP16 and FP17 (Fig. 1), and the boundary of the footprint within the TAAAA repeat region was confirmed by hydroxy-radical footprinting with a mouse liver nuclear protein extract (Fig.2).Figure 2Hydroxy-radical footprinting of the TAAAA repeat within the upstream region of the human SHBGpromoter. A radiolabeled −803/−656 fragment of the humanSHBG promoter was incubated in the absence (lane 2) or presence of 1 μg (lane 3) or 5 μg (lane 4) of mouse liver nuclear protein extract (NE) and was then subjected to hydroxy-radical DNA cleavage. The products were purified and separated on a denaturing 8% polyacrylamide gel, alongside the products of a Maxam-Gilbert (G/A) sequencing reaction as size marker (lane 1). The (TAAAA)6 region and FP17 were protected from cleavage and are shown in brackets.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Interaction between SP1 and a double-stranded oligonucleotide that included FP12 (nt −536/−510) was confirmed by EMSA (Fig.3A). The specificity of this interaction was demonstrated by inhibition of DNA-protein complexes using an oligonucleotide containing a known SP-1 binding site (TableII). In addition, the major DNA-protein complex formed in an EMSA reaction was supershifted with an SP1-specific antibody (Fig. 3B). The activity associated with the nuclear factor binding sites identified by DNase I footprinting (represented byboxes in Fig. 4A) was investigated by adding them sequentially to a human SHBGproximal promoter-luciferase reporter gene construct (8Jänne M. Hammond G.L. J. Biol. Chem. 1998; 273: 34105-34114Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar). These constructs were used for transcriptional activity measurements in a human hepatoblastoma cell line (HepG2) that produces SHBG (22Khan M.S. Knowles B.B. Aden D.P. Rosner W. J. Clin. Endocrinol. Metab. 1981; 53: 448-449Crossref PubMed Scopus (99) Google Scholar). This revealed that upstream sequences markedly reduce transcriptional activity when compared with the activity of the proximal promoter (Fig.4A). In particular, addition of sequences that include FP16, as well as a putative CEBPβ-binding site within FP17 and the intervening (TAAAA)6 sequence resulted in progressive and significant reductions of promoter activity (Fig. 4A). The reduction of transcription by sequences at the 5′ boundary of the upstream promoter appeared to be associated specifically with the (TAAAA)6 sequence because a 6-fold increase in transcription was observed when it was removed from the full-length promoter (Fig. 4B). It was also noted that mutation of the SP1 binding site (Table II) within FP12, which prevents its interaction with liver nuclear extracts in an EMSA (data not shown), also resulted in a similar increase in the transcriptional activity of the full-length promoter (Fig. 4B). However, recovery of the transcriptional activity of the full-length promoter was not further enhanced by removal of TAAAA pentanucleotide repeat in combination with a mutant SP1 binding site within FP12 (Fig. 4B). It is also important to note that the presence of FP12 appears to have a negative effect on transcription only in the context of upstream sequences within the full-length promoter (Fig. 4A). When tested in an EMSA, a radiolabeled oligonucleotide comprising the (TAAAA)6 sequence interacted with nuclear factor extracted from mouse liver and could be competed for by unlabeled oligonucleotides spanning this repeat region, but not with an unrelated DNA sequence (Fig. 5). To further characterize the nuclear factor(s) binding at this pentanucleotide repeat, a radiolabeled (TAAAA)6 repeat oligonucleotide sequence (Table II) was used as a probe for a Southwestern blot (Fig. 6). The radiolabeled probe recognized a nuclear protein with an apparent molecular mass of 46 kDa, which is enriched in mouse liver nuclear extracts when compared with nuclear extracts from mouse MSC-1 Sertoli cells or HeLa cells (Fig. 6). By contrast, a nuclear protein with a molecular mass of ∼67 kDa was recognized in all nuclear extracts and likely represents a ubiquitous nuclear factor, which binds to this sequence (Fig. 6).Figure 6Southwestern blotting of nuclear factors binding to the (TAAAA)6 repeat element. Nuclear proteins from adult mouse liver, a mouse Sertoli cell line (MSC-1), and HeLa cells were separated on a denaturing SDS-PAGE gel, followed by transfer to a nitrocellulose membrane. The blot was incubated with a radiolabeled double-stranded oligonucleotide spanning the six TAAAA pentanucleotide repeats in the 5′ region of the human SHBGpromoter. Migration of standards of known molecular mass is shown on the left.View Large Image Figure ViewerDownload Hi-res image Download (PPT) In view of reports that the number of TAAAA repeats in the promoters of other human genes varies among individuals (23Durocher F. Morissette J. Simard J. Pharmacogenetics. 1998; 8: 49-53Crossref PubMed Scopus (14) Google Scholar), we amplified the region of the SHBGupstream promoter containing the TAAAA repeat sequence from eight healthy male volunteers. The sizes of the PCR products indicated that the number of TAAAA repeats is highly variable both within and between individuals (Fig. 7A), and we demonstrated that the repeat number ranges from 6 to 10 by sequencing them (Fig. 7B). The serum SHBG concentrations in these individuals (with respect to their (TAAAA)n allele genotypes) were as follows: 13 nmol/liter (6/10), 14 nmol/liter (6/6), 15 nmol/liter (7/7), 25 nmol/liter (7/8), 24 nmol/liter (6/8), 24 nmol/liter (6/7), 15 nmol/liter (6/8), and 23 nmol/liter (9/7). Although there was no obvious relationship between serum SHBG concentrations and the number of TAAAA repeats on each allele, an individual with two (TAAAA)6 containing SHBG alleles had a relatively low serum SHBG level. However, the number of individuals we have studied is small, and no attempt was made to control for factors that might otherwise influence serum SHBG levels, such as body mass index. The influence of this polymorphism on transcription was tested in the context of the full-length human SHBG promoter. We found that the activity of human SHBG promoter-luciferase reporter constructs in HepG2 cells increased 5-fold as the number of TAAAA repeats was increased from six to seven. As additional repeat sequences were added, little if any further increases in promoter activity were observed (Fig. 8). These increases in promoter activity associated with increasing repeats is strikingly similar to the increase observed when the (TAAAA)6 sequence is removed from the full-length promoter (Fig. 4B). Taken together, these data suggest that the silencing activity is associated specifically with the presence of only six TAAAA repeats. This was confirmed by performing similar experiments using full-lengthSHBG promoter sequences containing only four or five TAAAA repeats, which also provided ∼5-fold higher levels of transcriptional activity when compared with the promoter sequence containing six repeats (Fig. 8). To further examine nuclear factor binding in relation to the number of TAAAA repeats, we performed a UV cross-linking experiment with radiolabeled oligonucleotides representing the various numbers (6Meikle A.W. Stanish W.M. Taylor N. Edwards C.Q. Bishop C.T. Metabolism. 1982; 31: 6-9Abstract Full Text PDF PubMed Scopus (58) Google Scholar, 7Jaquish C.E. Blangero J. Haffner S.M. Stern M.P. MacCluer J.W. Metabolism. 1997; 46: 988-991Abstract Full Text PDF PubMed Scopus (30) Google Scholar, 8Jänne M. Hammond G.L. J. Biol. Chem. 1998; 273: 34105-34114Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar, 9Jänne M. Deol H.K. Power S.G.A. Yee S.-P. Hammond G.L. Mol. Endocrinol. 1998; 12: 123-136Crossref PubMed Scopus (85) Google Scholar, 10Jänne M. Hogeveen K.N. Deol H.K. Hammond G.L. Endocrinology. 1999; 140: 4166-4174Crossref PubMed Scopus (31) Google Scholar) of TAAAA repeats observed in the general population (Fig. 7), in the presence of mouse liver nuclear protein extracts (Fig.9). This clearly demonstrated that the radiolabeled oligonucleotide containing six TAAAA repeats preferentially binds nuclear proteins, and the major complexes formed were 55–60 kDa in size (Fig. 9). Furthermore, the relative abundance of these complexes declined markedly when oligonucleotides containing more than six repeats were used, and this is consistent with the marked increase in transcriptional activity of promoters containing more than six TAAAA repeats (Fig. 8). The specificity of the complex formed using the TAAAA repeat oligonucleotide sequence was demonstrated by competition with unlabeled oligonucleotide, and the lack of complex formation in the presence of nuclear protein without exposure to UV light. In addition, exposure of radiolabeled oligonucleotides to UV did not result in the formation of any high molecular weight complexes in the absence of nuclear protein (data not shown). The size of the major UV cross-linked complexes is consistent with a complex between the oligonucleotide containing the six TAAAA repeats and the 46-kDa liver enriched protein identified as the TAAAA-binding protein by Southwestern blotting (Fig. 6). Blood levels of SHBG in humans are highly variable even between healthy individuals (6Meikle A.W. Stanish W.M. Taylor N. Edwards C.Q. Bishop C.T. Metabolism. 1982; 31: 6-9Abstract Full Text PDF PubMed Scopus (58) Google Scholar). To determine if this variability can be explained by a genetic polymorphism, we sequenced the first 300 nt of the human SHBG promoter from normal individuals and patients with various reproductive and endocrine disorders in a separate study, but found no significant deviations between sequences. 2G. L. Hammond, unpublished data. By contrast, our studies of human SHBG promoter activity in HepG2 hepatoblastoma cells alerted our attention to a (TAAAA)6repeat located within an alu-Sx sequence close to the 5′ boundary of the transcription unit expressed in hepatocytes (9Jänne M. Deol H.K. Power S.G.A. Yee S.-P. Hammond G.L. Mol. Endocrinol. 1998; 12: 123-136Crossref PubMed Scopus (85) Google Scholar). This particular pentanucleotide repeat has been found to vary in number within the human cholesterol side-chain cleavage enzymeCYP11A1 promoter (23Durocher F. Morissette J. Simard J. Pharmacogenetics. 1998; 8: 49-53Crossref PubMed Scopus (14) Google Scholar), and there is a strong association between alleles with this polymorphism and total serum testosterone levels in patients with polycystic ovarian syndrome and hyperandrogenism (24Gharani N. Waterworth D.M. Batty S. White D. Gilling-Smith C. Conway G.S. McCarthy M. Franks S. Williamson R. Hum. Mol. Genet. 1997; 6: 397-402Crossref PubMed Scopus (248) Google Scholar). Since this (TAAAA)6 repeat appeared to have a silencing effect on SHBG promoter activity, we focused our attention on the possible factor(s) that might bind to it, and how it might function in concert with other elements in the upstream region of the human SHBG promoter to influence transcription. The upstream region of the human SHBG promoter silences transcription in HepG2 cells, and most of this activity is associated with a region between FP16 and FP17, which includes the (TAAAA)6 repeat element. We have demonstrated that the (TAAAA)6 repeat is responsible for this silencing activity by removing it or by increasing the number of repeats according to the number observed in the general population. It is also clear that this activity is dependent on downstream promoter elements and appears to involve an SP1 nuclear factor-binding site within FP12. Although SP1 is generally considered to be an activator of transcription, it can participate in transcriptional silencing through interactions with other transcriptional regulators in a context-dependent manner (25Talianidis I. Tambakaki A. Toursounova J. Zannis V.I. Biochemistry. 1995; 34: 10298-10309Crossref PubMed Scopus (49) Google Scholar, 26Shou Y. Baron S. Poncz M. J. Biol. Chem. 1998; 273: 5716-5726Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar). This might explain why FP12 only appears to regulateSHBG promoter activity in association with upstream elements (FP16-FP17) within the promoter. Although our EMSA supershift data indicate that SP1 binds to FP12, we also observed that a second protein complex forms with a FP12 oligonucleotide, and this complex does not appear to be supershifted with an SP1-specific antiserum. It is therefore possible that FP12 interacts with another SP1-related factor, such as SP3 (27Hagen G. Müller S. Beato M. Suske G. Nucleic Acids Res. 1992; 20: 5519-5525Crossref PubMed Scopus (521) Google Scholar, 28Hagen G. Müller S. Beato M. Suske G. EMBO J. 1994; 13: 3843-3851Crossref PubMed Scopus (650) Google Scholar), and this might be relevant because SP3 often acts as a negative regulator of transcription (29De Luca P. Majello B. Lania L. J. Biol. Chem. 1996; 271: 8533-8536Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar, 30Ammanamanchi S. Brattain M.G. J. Biol. Chem. 2001; 276: 3348-3352Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar). Furthermore, competition between SP3 and other SP1-related factors for a common site within promoter sequences alters their transcriptional activity (28Hagen G. Müller S. Beato M. Suske G. EMBO J. 1994; 13: 3843-3851Crossref PubMed Scopus (650) Google Scholar). Variations in the number of polynucleotide repeats within several other promoters have been reported to modulate transcription (31Yamada N. Yamaya M. Okinaga S. Nakayama K. Sekizawa K. Shibahara S. Sasaki H. Am. J. Hum. Genet. 2000; 66: 187-195Abstract Full Text Full Text PDF PubMed Scopus (503) Google Scholar, 32Beutler E. Gelbart T. Demina A. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 8170-8174Crossref PubMed Scopus (766) Google Scholar) and have been linked to disease states (24Gharani N. Waterworth D.M. Batty S. White D. Gilling-Smith C. Conway G.S. McCarthy M. Franks S. Williamson R. Hum. Mol. Genet. 1997; 6: 397-402Crossref PubMed Scopus (248) Google Scholar, 31Yamada N. Yamaya M. Okinaga S. Nakayama K. Sekizawa K. Shibahara S. Sasaki H. Am. J. Hum. Genet. 2000; 66: 187-195Abstract Full Text Full Text PDF PubMed Scopus (503) Google Scholar, 32Beutler E. Gelbart T. Demina A. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 8170-8174Crossref PubMed Scopus (766) Google Scholar). Although the number of (TAAAA)n repeats in the CYP11A1promoter is closely associated with serum testosterone levels and might therefore reflect variations in the expression of the gene (24Gharani N. Waterworth D.M. Batty S. White D. Gilling-Smith C. Conway G.S. McCarthy M. Franks S. Williamson R. Hum. Mol. Genet. 1997; 6: 397-402Crossref PubMed Scopus (248) Google Scholar), it is not known whether this is due to an effect at the level of transcription. Differences in the number of an inverted (TTTTA)n repeat in the apolipoprotein(a) gene (APO(a)) promoter have also been associated with individual variations in plasma Lp(a) levels (33Mooser V. Francesco P.M. Bopp S. Petho-Schramm A. Guerra R. Boerwinkle E. Muller E. Joachin H. Hobbs H.H. Hum. Mol. Genet. 1995; 4: 173-181Crossref PubMed Scopus (112) Google Scholar, 34Valenti K. Aveynier E. Leaute S. Laporte F. Hadjian A.J. Atherosclerosis. 1999; 147: 17-24Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). Furthermore, anAPO(a) promoter containing nine TTTTA repeats is associated with low plasma Lp(a) levels, and has a 5-fold lower transcriptional activity in HepG2 cells, when compared with a promoter sequence containing eight TTTTA repeats from an individual with relatively high plasma levels of Lp(a) (35Wade D.P. Clarke J.G. Lindahl G.E. Liu A.C. Zysow B.R. Meer K. Schwartz K. Lawn R.M. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 1369-1373Crossref PubMed Scopus (157) Google Scholar). The (TAAAA)n repeat found within the 5′ region of the human SHBG promoter occurs frequently within the human genome (36Kim H.-S. Crow T.J. Cytogenet. Cell Genet. 1998; 83: 54-55Crossref PubMed Scopus (4) Google Scholar) and is a common feature of repetitive elements such as alu sequences (37Millar D.S. Paul C.L. Molloy P.L. Clark S.J. J. Biol. Chem. 2000; 275: 24893-24899Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar) and LINE elements (36Kim H.-S. Crow T.J. Cytogenet. Cell Genet. 1998; 83: 54-55Crossref PubMed Scopus (4) Google Scholar). Close inspection of the pentanucleotide repeats in theCYP11A1 and APO(a) promoters by RepeatMasker (www.genome.washington.edu/uwgc/analysistools/repeatmasker.htm) indicates that they also flank Sp/q and Sgsubfamilies of human alu sequences, respectively, and differences in the number of these repeats between individuals likely reflect an inherent instability of alu repetitive elements (38Mighell A.J. Markham A.F. Robinson P.A. FEBS Lett. 1997; 417: 1-5Crossref PubMed Scopus (147) Google Scholar). Unlike the (TA)n dinucleotide repeat in the UDP-glucuronosyltransferase 1 (UGT1A1) promoter, where increasing numbers of repeats are associated with decreased promoter activity (32Beutler E. Gelbart T. Demina A. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 8170-8174Crossref PubMed Scopus (766) Google Scholar), the activity of the human SHBG promoter is not linear with respect to TAAAA repeat number. Differences in the number of TTTTA repeats in the APO(a) promoter influence its transcriptional activity, but this has not been studied in any great detail (35Wade D.P. Clarke J.G. Lindahl G.E. Liu A.C. Zysow B.R. Meer K. Schwartz K. Lawn R.M. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 1369-1373Crossref PubMed Scopus (157) Google Scholar). In particular, there is no information concerning the identity of proteins that might interact with these types of repeats, or how they influence gene transcription. In experiments presented here, silencing of the human SHBG promoter was only observed in the presence of six TAAAA repeats, and this correlated with the preferential binding of a liver-enriched 46-kDa nuclear factor to the (TAAAA)6 repeat element. Although alleles containing less than six TAAAA repeats were not observed in the limited group of individuals we examined, the activities of SHBG promoters containing four or five TAAAA repeats also lacked the silencing properties associated with the presence of six repeats. These data suggest that the 46-kDa factor that binds six TAAAA repeats with high affinity acts in concert with downstream elements within the humanSHBG promoter to alter its transcriptional activity. In summary, a (TAAAA)n repeat polymorphism within the human SHBG promoter has a marked effect on its transcriptional activity in vitro in HepG2 cells. This could contribute to individual differences in plasma SHBG levels and thereby influence the access of sex steroids to their target tissues. Furthermore, variations in the number of TAAAA repeats within regulatory regions of other human genes may contribute to inter-individual differences in gene expression. The genomic DNA samples we examined were from healthy male volunteers of various ethnic backgrounds, and the number of TAAAA repeat elements ranged from 6 to 10 in this limited group of subjects. Although there was no obvious relationship between the number of TAAAA repeat elements and the serum SHBG concentrations, the number of individuals examined is too small to draw any conclusions, especially as almost all of them were all bi-allelic for different numbers of TAAAA repeats. It is, however, important to appreciate that the ability of the (TAAAA)n polymorphism to influence the transcriptional activity of the human SHBG promoter as naked DNA in transient transfection experiments may not necessarily reflect its activity in the context of genomic DNA within a chromatin structure. It will therefore be important to conduct a carefully controlled clinical study to determine whether this polymorphism is associated with differences in plasma SHBG levels, and to determine whether specific alleles are associated with sex steroid hormone-dependent diseases and/or correlate with responses to various hormone treatments that influence plasma SHBG levels. We thank Drs. Siu-Pok Yee, Joe Torchia, and David Rodenhiser for their suggestions and help and Denise Power for secretarial assistance.

Referência(s)