Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Two Basic Residues of the h-VPAC1 Receptor Second Transmembrane Helix Are Essential for Ligand Binding and Signal Transduction

2001; Elsevier BV; Volume: 276; Issue: 2 Linguagem: Inglês

10.1074/jbc.m007696200

ISSN

1083-351X

Autores

Rosa M. Solano, Ingrid Langer, Jason Perret, Pascale Vertongen, Marı́a G. Juarranz, Patrick Robberecht, Magalì Waelbroeck,

Tópico(s)

Chemical Synthesis and Analysis

Resumo

We mutated the vasoactive intestinal peptide (VIP) Asp3 residue and two VPAC1receptor second transmembrane helix basic residues (Arg188and Lys195). VIP had a lower affinity for R188Q, R188L, K195Q, and K195I VPAC1 receptors than for VPAC1 receptors. [Asn3] VIP and [Gln3] VIP had lower affinities than VIP for VPAC1 receptors but higher affinities for the mutant receptors; the two basic amino acids facilitated the introduction of the negatively charged aspartate inside the transmembrane domain. The resulting interaction was necessary for receptor activation. 1/[Asn3] VIP and [Gln3] VIP were partial agonists at VPAC1 receptors; 2/VIP did not fully activate the K195Q, K195I, R188Q, and R188L VPAC1 receptors; a VIP analogue ([Arg16] VIP) was more efficient than VIP at the four mutated receptors; and [Asn3] VIP and [Gln3] VIP were more efficient than VIP at the R188Q and R188L VPAC1 receptors; 3/the [Asp3] negative charge did not contribute to the recognition of the VIP1antagonist, [AcHis1,D-Phe2,Lys15,Arg16,Leu27] VIP (1Christophe J. Biochim. Biophys. Acta. 1993; 1154: 183-199Crossref PubMed Scopus (223) Google Scholar, 2Rawlings S.R. Hezareh M. Endocr. Rev. 1996; 17: 4-29PubMed Google Scholar, 3Vaudry D. Gonzalez B.J. Basille M. Yon L. Fournier A. Vaudry H. Pharmacol. Rev. 2000; 52: 269-324PubMed Google Scholar, 4Harmar A.J. Arimura A. Gozes I. Journot L. Laburthe M. Pisegna J.R. Rawlings S.R. Robberecht P. Said S.I. Sreedharan S.P. Wank S.A. Waschek J.A. Pharmacol. Rev. 1998; 50: 265-270PubMed Google Scholar, 5Usdin T.B. Bonner T.I. Mezey E. Endocrinology. 1994; 135: 2662-2680Crossref PubMed Scopus (409) Google Scholar, 6Vertongen P. Schiffmann S.N. Gourlet P. Robberecht P. Ann. N. Y. Acad. Sci. 1998; 865: 412-415Crossref PubMed Scopus (16) Google Scholar, 7Spengler D. Waeber C. Pantaloni C. Holsboer F. Bockaert J. Seeburg P.H. Journot L. Nature. 1993; 365: 170-175Crossref PubMed Scopus (1132) Google Scholar)/growth hormone releasing factor (8–27). This is the first demonstration that, to activate the VPAC1 receptor, the Asp3 side chain of VIP must penetrate within the transmembrane domain, in close proximity to two highly conserved basic amino acids from transmembrane 2. We mutated the vasoactive intestinal peptide (VIP) Asp3 residue and two VPAC1receptor second transmembrane helix basic residues (Arg188and Lys195). VIP had a lower affinity for R188Q, R188L, K195Q, and K195I VPAC1 receptors than for VPAC1 receptors. [Asn3] VIP and [Gln3] VIP had lower affinities than VIP for VPAC1 receptors but higher affinities for the mutant receptors; the two basic amino acids facilitated the introduction of the negatively charged aspartate inside the transmembrane domain. The resulting interaction was necessary for receptor activation. 1/[Asn3] VIP and [Gln3] VIP were partial agonists at VPAC1 receptors; 2/VIP did not fully activate the K195Q, K195I, R188Q, and R188L VPAC1 receptors; a VIP analogue ([Arg16] VIP) was more efficient than VIP at the four mutated receptors; and [Asn3] VIP and [Gln3] VIP were more efficient than VIP at the R188Q and R188L VPAC1 receptors; 3/the [Asp3] negative charge did not contribute to the recognition of the VIP1antagonist, [AcHis1,D-Phe2,Lys15,Arg16,Leu27] VIP (1Christophe J. Biochim. Biophys. Acta. 1993; 1154: 183-199Crossref PubMed Scopus (223) Google Scholar, 2Rawlings S.R. Hezareh M. Endocr. Rev. 1996; 17: 4-29PubMed Google Scholar, 3Vaudry D. Gonzalez B.J. Basille M. Yon L. Fournier A. Vaudry H. Pharmacol. Rev. 2000; 52: 269-324PubMed Google Scholar, 4Harmar A.J. Arimura A. Gozes I. Journot L. Laburthe M. Pisegna J.R. Rawlings S.R. Robberecht P. Said S.I. Sreedharan S.P. Wank S.A. Waschek J.A. Pharmacol. Rev. 1998; 50: 265-270PubMed Google Scholar, 5Usdin T.B. Bonner T.I. Mezey E. Endocrinology. 1994; 135: 2662-2680Crossref PubMed Scopus (409) Google Scholar, 6Vertongen P. Schiffmann S.N. Gourlet P. Robberecht P. Ann. N. Y. Acad. Sci. 1998; 865: 412-415Crossref PubMed Scopus (16) Google Scholar, 7Spengler D. Waeber C. Pantaloni C. Holsboer F. Bockaert J. Seeburg P.H. Journot L. Nature. 1993; 365: 170-175Crossref PubMed Scopus (1132) Google Scholar)/growth hormone releasing factor (8–27). This is the first demonstration that, to activate the VPAC1 receptor, the Asp3 side chain of VIP must penetrate within the transmembrane domain, in close proximity to two highly conserved basic amino acids from transmembrane 2. vasoactive intestinal peptide transmembrane helix pituitary adenylate cyclase-activating polypeptide Chinese hamster ovary polymerase chain reaction growth hormone releasing factor parathyroid hormone The neuropeptides vasoactive intestinal polypeptide (VIP)1 and pituitary adenylate cyclase-activating polypeptide (PACAP) contribute to the regulation of intestinal secretion and motility, of the vascular tone, of the exocrine and endocrine secretions, of immunological responses, and to the development of the central nervous system (1Christophe J. Biochim. Biophys. Acta. 1993; 1154: 183-199Crossref PubMed Scopus (223) Google Scholar, 2Rawlings S.R. Hezareh M. Endocr. Rev. 1996; 17: 4-29PubMed Google Scholar, 3Vaudry D. Gonzalez B.J. Basille M. Yon L. Fournier A. Vaudry H. Pharmacol. Rev. 2000; 52: 269-324PubMed Google Scholar). The effects of VIP are mediated through interaction with two receptor subclasses named the VPAC1 and VPAC2 receptors; the effects of PACAP are also mediated through interactions with the same receptors, as well as through a selective receptor named PAC1 (3Vaudry D. Gonzalez B.J. Basille M. Yon L. Fournier A. Vaudry H. Pharmacol. Rev. 2000; 52: 269-324PubMed Google Scholar, 4Harmar A.J. Arimura A. Gozes I. Journot L. Laburthe M. Pisegna J.R. Rawlings S.R. Robberecht P. Said S.I. Sreedharan S.P. Wank S.A. Waschek J.A. Pharmacol. Rev. 1998; 50: 265-270PubMed Google Scholar). VPAC1, VPAC2, and PAC1 receptors are encoded by different genes and expressed in different cell populations in both the central nervous system and peripheral tissues (3Vaudry D. Gonzalez B.J. Basille M. Yon L. Fournier A. Vaudry H. Pharmacol. Rev. 2000; 52: 269-324PubMed Google Scholar, 5Usdin T.B. Bonner T.I. Mezey E. Endocrinology. 1994; 135: 2662-2680Crossref PubMed Scopus (409) Google Scholar, 6Vertongen P. Schiffmann S.N. Gourlet P. Robberecht P. Ann. N. Y. Acad. Sci. 1998; 865: 412-415Crossref PubMed Scopus (16) Google Scholar). They are preferentially coupled to Gαsproteins that stimulate adenylate cyclase activity. The PAC1 and VPAC1 receptors may stimulate, in addition, inositol trisphosphate synthesis and calcium mobilization (7Spengler D. Waeber C. Pantaloni C. Holsboer F. Bockaert J. Seeburg P.H. Journot L. Nature. 1993; 365: 170-175Crossref PubMed Scopus (1132) Google Scholar,8Van Rampelbergh J. Poloczek P. Francoys I. Delporte C. Winand J. Robberecht P. Waelbroeck M. Biochim. Biophys. Acta. 1997; 1357: 249-255Crossref PubMed Scopus (68) Google Scholar). This effect is however detected only at high VPAC1receptor expression levels (8Van Rampelbergh J. Poloczek P. Francoys I. Delporte C. Winand J. Robberecht P. Waelbroeck M. Biochim. Biophys. Acta. 1997; 1357: 249-255Crossref PubMed Scopus (68) Google Scholar). VIP and PACAP receptors are members of a large family of G protein-coupled receptors, often referred as the GPCR-B family (4Harmar A.J. Arimura A. Gozes I. Journot L. Laburthe M. Pisegna J.R. Rawlings S.R. Robberecht P. Said S.I. Sreedharan S.P. Wank S.A. Waschek J.A. Pharmacol. Rev. 1998; 50: 265-270PubMed Google Scholar, 9Rawlings S.R. Mol. Cell. Endocrinol. 1994; 101: C5-C9Crossref PubMed Scopus (86) Google Scholar), that includes the secretin, glucagon, glucagon-like peptide-1, calcitonin, parathyroid hormone, and growth hormone releasing factor (GRF) receptors. The VIP, PACAP, secretin, and GRF receptors constitute a subfamily based on the homology of the ligands and of the receptors. Each receptor recognizes its own cognate ligand with a high affinity but recognizes at least one other parent peptide with a comparable or a lower affinity (4Harmar A.J. Arimura A. Gozes I. Journot L. Laburthe M. Pisegna J.R. Rawlings S.R. Robberecht P. Said S.I. Sreedharan S.P. Wank S.A. Waschek J.A. Pharmacol. Rev. 1998; 50: 265-270PubMed Google Scholar). Because of the sequence homology of the ligands and the receptors, the information obtained on one receptor-ligand pair can be anticipated to be relevant also in the other systems. The positioning of the ligand on the receptors is still poorly understood. Investigations of chimeric receptors and mutants have indicated that the large amino-terminal domain (10Vilardaga J.P. De Neef P. Di Paolo E. Bollen A. Waelbroeck M. Robberecht P. Biochem. Biophys. Res. Commun. 1995; 211: 885-891Crossref PubMed Scopus (77) Google Scholar, 11Hashimoto H. Ogawa N. Hagihara N. Yamamoto K. Imanishi K. Nogi H. Nishino A. Fujita T. Matsuda T. Nagata S. Baba A. Mol. Pharmacol. 1997; 52: 128-135Crossref PubMed Scopus (46) Google Scholar, 12Holtmann M.H. Ganguli S. Hadac E.M. Dolu V. Miller L.J. J. Biol. Chem. 1996; 271: 14944-14949Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar, 13Holtmann M.H. Hadac E.M. Miller L.J. J. Biol. Chem. 1995; 270: 14394-14398Abstract Full Text Full Text PDF PubMed Scopus (168) Google Scholar) structured by disulfide bridges (14Knudsen S.M. Tams J.W. Wulff B.S. Fahrenkrug J. FEBS Lett. 1997; 412: 141-143Crossref PubMed Scopus (39) Google Scholar, 15Vilardaga J.P. Di Paolo E. Bialek C. De Neef P. Waelbroeck M. Bollen A. Robberecht P. Eur. J. Biochem. 1997; 246: 173-180Crossref PubMed Scopus (48) Google Scholar, 16Grauschopf U. Lilie H. Honold K. Wozny M. Reusch D. Esswein A. Schafer W. Rucknagel K.P. Rudolph R. Biochemistry. 2000; 39: 8878-8887Crossref PubMed Scopus (106) Google Scholar) makes a key contribution to ligand recognition that several other highly conserved residues play a role in the general structure (17Di Paolo E. Vilardaga J.P. Petry H. Moguilevsky N. Bollen A. Robberecht P. Waelbroeck M. Peptides. 1999; 20: 1187-1193Crossref PubMed Scopus (31) Google Scholar, 18Du K. Nicole P. Couvineau A. Laburthe M. Biochem. Biophys. Res. Commun. 1997; 230: 289-292Crossref PubMed Scopus (40) Google Scholar) and that creating constitutively active receptors through mutations in the intracellular part of the receptor is possible (19Gaudin P. Couvineau A. Rouyer-Fessard C. Maoret J.J. Laburthe M. Biochem. Biophys. Res. Commun. 1999; 254: 15-20Crossref PubMed Scopus (16) Google Scholar). The amino-terminal part of the ligand is necessary for high affinity binding and for second messenger activation; its deletion in VIP, PACAP, and secretin reduced both the affinity and the intrinsic activity of the peptide (20Ciccarelli E. Vilardaga J.P. De Neef P. Di Paolo E. Waelbroeck M. Bollen A. Robberecht P. Regul. Pept. 1994; 54: 397-407Crossref PubMed Scopus (58) Google Scholar). The identification of the receptor residues interacting with the amino terminus of the ligand is a prerequisite to model the active form of the receptor and conceive new ligands, preferably non-peptidic, that could be of therapeutic interest. We focused in this work on the human VPAC1receptors and investigated the contribution of two basic residues located in the second transmembrane helix to ligand recognition and adenylate cyclase activation. We obtained evidence that both basic residues are important for recognition of the Asp3 of VIP and stabilization of the active VIP-receptor complex conformation. Our results also suggested that a second binding mode, that does not involve recognition of the VIP Asp3 residue and does not induce receptor activation, is also possible. The human VPAC1 receptor cDNA was cloned by PCR according to the previously reported sequence (21Couvineau A. Rouyer-Fessard C. Darmoul D. Maoret J.J. Carrero I. Ogier-Denis E. Laburthe M. Biochem. Biophys. Res. Commun. 1994; 200: 769-776Crossref PubMed Scopus (150) Google Scholar), using specific primers. Generation of the four mutated receptors was achieved using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla CA) essentially according to the manufacturer's instructions. Briefly, the human VPAC1 receptor-coding region, inserted into the mammalian expression vector pcDNA3.1 (Invitrogen Corp.), was submitted to 22 cycles of PCR (95 °C for 30 s, 54 °C for 1 min, and 68 °C for 14 min) in a 50-μl reaction volume. The forward and reverse primers were complementary and contained the desired nucleotide changes, flanked on either side by 15 perfectly matched nucleotides (only the forward primers are shown): Arg188 to Leu, CATATCCTTCATCCTGCTGGCTGCCGCTGTCTTC; Arg188 to Gln, CATATCCTTCATCCTGCAGGCTGCCGCTGTCTTC; Lys195to Ile, GCCGCTGTCTTCATCATAGACTTGGCCCTCTTC; Lys195 to Gln, GCCGCTGTCTTCATCCAAGACTTGGCCCTCTTC. Following PCR, 10 μl were analyzed by agarose gel electrophoresis, and the remaining 40 μl were digested for at least 2 h by 1 μl of DpnI restriction enzyme (Stratagene, La Jolla, CA) to remove the parental methylated DNA. The digested PCR products were transformed into TOP10 One Shot competent Escherichia coli bacterial cells (Invitrogen Corp.). Of several colonies verified by agarose gel electrophoresis of miniprep plasmid DNA (22Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York1989Google Scholar), three were retained and further purified on Qiaquick PCR purification spin columns, and the mutations were checked for by DNA sequencing on an ABI automated sequencing apparatus, using the BigDye Terminator sequencing prism kit from ABI (Perkin-Elmer). Plasmid DNA from one clone for each mutation, containing the correct nucleotide substitutions, was prepared using a midiprep endotoxin-free kit (Stratagene, La Jolla, CA), the complete nucleotide sequence of the receptor coding region was verified by DNA sequencing, and 20 μg were electroporated (Electroporator II; Invitrogen Corp.) into wild type CHO-K1 cells. Selection was carried out in culture medium (50% HamF12, 50% Dulbecco's modified Eagle's medium, 10% fetal calf serum, 1% penicillin (10 milliunits/ml), 1% streptomycin (10 μg/ml), 1% l-glutamine (200 mm; Life Technologies LTD, Paisley, United Kingdom), supplemented with 600 μg of geneticin (Gly418)/ml culture medium. After 10 to 15 days of selection, isolated colonies were transferred to 24-well microtiter plates and grown until confluence, trypsinized, and further expanded in 6-well microtiter plates, from which cells were scraped and membranes prepared for screening by an adenylate cyclase activity assay in the presence of 10 μm VIP. Membranes were prepared from scraped cells lysed in 1 mm NaHCO3 by immediate freezing in liquid nitrogen. After thawing, the lysate was first centrifuged at 4 °C for 10 min at 400 × g, and the supernatant was further centrifuged at 20,000 × g for 10 min. The resulting pellet, resuspended in 1 mmNaHCO3, was used immediately as a crude membrane fraction. Binding studies were performed as described (23Gourlet P. De Neef P. Cnudde J. Waelbroeck M. Robberecht P. Peptides. 1997; 18: 1555-1560Crossref PubMed Scopus (161) Google Scholar) using125I-VIP, 125I-[Gln3] VIP, or125I-VIP1 antagonist. The three tracers were radiolabeled similarly and had comparable specific radioactivity (6Vertongen P. Schiffmann S.N. Gourlet P. Robberecht P. Ann. N. Y. Acad. Sci. 1998; 865: 412-415Crossref PubMed Scopus (16) Google Scholar,23Gourlet P. De Neef P. Cnudde J. Waelbroeck M. Robberecht P. Peptides. 1997; 18: 1555-1560Crossref PubMed Scopus (161) Google Scholar). In all cases, the nonspecific binding was defined as residual binding in the presence of the corresponding unlabeled peptide (1 μm). Binding was performed at 20 °C in a total volume of 120 μl containing 20 mm Tris-maleate, 2 mmMgCl2, 0.1 mg/ml bacitracin, 1% bovine serum albumin (pH 7.4) buffer. 3 to 30 μg of protein were used per assay. Bound and free radioactivity were separated by filtration through glass-fiber GF/C filters presoaked for 24 h in 0.01% polyethyleneimine and rinsed three times with a 20 mm (pH 7.4) sodium phosphate buffer containing 1% bovine serum albumin. Adenylate cyclase activity was determined by the procedure of Salomon et al. (24Salomon Y. Londos C. Rodbell M. Anal. Biochem. 1974; 58: 541-548Crossref PubMed Scopus (3502) Google Scholar), as described previously. Membrane proteins (3–15 μg) were incubated in a total volume of 60 μl containing 0.5 mm[α32P]ATP, 10 μm GTP, 5 mmMgCl2, 0.5 mm EGTA, 1 mm cAMP, 1 mm theophylline, 10 mm phospho(enol)pyruvate, 30 μg/ml pyruvate kinase, and 30 mm Tris-HCl at a final pH value of 7.8. The reaction was initiated by membranes addition and was terminated after a 15-min incubation at 37 °C by adding 0.5 ml of a 0.5% sodium dodecyl sulfate solution containing 0.5 mm ATP, 0.5 mm cAMP, and 20,000 cpm [3H]cAMP. cAMP was separated from ATP by two successive chromatographies on Dowex 50W × 8 and neutral alumina. VIP(1–28)-amide (VIP), [Asn3] VIP(1–28)-amide ([Asn3] VIP), [Glu3] VIP(1–28)-amide ([Glu3] VIP), [Gln3] VIP(1–28)-amide ([Gln3] VIP), [Arg16] VIP(1–28)-amide ([Arg16] VIP), [Lys15,Arg16,Leu27] VIP(1–7)/GRF(8–27)-amide (VIP1 agonist), [AcHis1,DPhe2,Lys15,Arg16,Leu27] VIP(1–7)/GRF(8–27)-amide (PG 97, 269, or VIP1antagonist), [Asn3,Lys15,Arg16,Leu27] VIP(1–7)/GRF(8–27)-amide ([Asn3] VIP1agonist) and [AcHis1,DPhe2,Asn3,Lys15, Arg16,Leu27] VIP (1Christophe J. Biochim. Biophys. Acta. 1993; 1154: 183-199Crossref PubMed Scopus (223) Google Scholar, 2Rawlings S.R. Hezareh M. Endocr. Rev. 1996; 17: 4-29PubMed Google Scholar, 3Vaudry D. Gonzalez B.J. Basille M. Yon L. Fournier A. Vaudry H. Pharmacol. Rev. 2000; 52: 269-324PubMed Google Scholar, 4Harmar A.J. Arimura A. Gozes I. Journot L. Laburthe M. Pisegna J.R. Rawlings S.R. Robberecht P. Said S.I. Sreedharan S.P. Wank S.A. Waschek J.A. Pharmacol. Rev. 1998; 50: 265-270PubMed Google Scholar, 5Usdin T.B. Bonner T.I. Mezey E. Endocrinology. 1994; 135: 2662-2680Crossref PubMed Scopus (409) Google Scholar, 6Vertongen P. Schiffmann S.N. Gourlet P. Robberecht P. Ann. N. Y. Acad. Sci. 1998; 865: 412-415Crossref PubMed Scopus (16) Google Scholar, 7Spengler D. Waeber C. Pantaloni C. Holsboer F. Bockaert J. Seeburg P.H. Journot L. Nature. 1993; 365: 170-175Crossref PubMed Scopus (1132) Google Scholar)/GRF(8–27)-amide ([Asn3] VIP1antagonist) were synthesized in our laboratory by the Fmoc (9-fluorenylmethoxy carbonyl) strategy on an Applied Biosystems Apparatus 431A (Foster City, CA). The peptide purity (>97%) was assessed by capillary electrophoresis, and the conformity was verified by electrospray mass spectrometry. All competition curves and dose-effect curves were analyzed by a non-linear regression program (Graph Pad Prism, San Diego, CA). The VPAC1 IC50values, measured in 125I-VIP competition curves on membranes of CHO cells expressing 900 ± 50 fmol of receptor/mg of protein, are summarized in Table I. The agonists EC50 values, evaluated from complete dose-effect curves (Fig. 1), are summarized in TableII. Calculation of the maximal stimulation of adenylate cyclase activity indicated that VIP and [Arg16] VIP (25Gourlet P. Vandermeers A. Vandermeers-Piret M.C. De Neef P. Waelbroeck M. Robberecht P. Biochim. Biophys. Acta. 1996; 1314: 267-273Crossref PubMed Scopus (35) Google Scholar) reached the same maximum effect, higher than that obtained in the presence of [Glu3] VIP, [Asn3] VIP, [Gln3] VIP (this work), or VIP1 agonist (26Gourlet P. Vandermeers A. Vertongen P. Rathe J. De Neef P. Cnudde J. Waelbroeck M. Robberecht P. Peptides. 1997; 18: 1539-1545Crossref PubMed Scopus (168) Google Scholar) (Table II). The VIP1antagonist, PG 97 269 (23Gourlet P. De Neef P. Cnudde J. Waelbroeck M. Robberecht P. Peptides. 1997; 18: 1555-1560Crossref PubMed Scopus (161) Google Scholar), did not stimulate adenylate cyclase at any concentration but inhibited competitively the effect of VIP with a Ki value of 2–3 nm.Table IBinding properties of VPAC1, R188Q, and K195I-VPAC1 receptorsIC50 values (in nm)VPAC1R188QK195QVIP3300200[Arg16]VIP0.61520[Glu3]VIP401000150[Asn3]VIP100530[Gln3]VIP300515VIP1agonist2202[Asn3]VIP1agonist2041VIP1 antagonist451[Asn3]VIP1230.3AntagonistThe standard deviation of the p Ki (−log Ki) values was always below 0.15 log units. IC50 values, measured in 125I-VIP,125I-[Gln3]VIP, or 125I-VIP1antagonist competition curves on membranes of CHO cells expressing VPAC1, R188Q-, or K195Q-VPAC1 receptors, respectively. Open table in a new tab Table IIAdenylate cyclase stimulation through VPAC1 R188Q, and K195I-VPAC1EC50 values (in nm) and Emax (in percent of VIPs)VPAC1R188QK195QVIP5 (100%)30 (100%)200 (100%)[Arg16]VIP0.2 (100%)10 (150%)20 (150%)[Glu3]VIP30 (80%)200 (20%)200 (50%)[Asn3]VIP150 (25%)4 (170%)100 (20%)[Gln3]VIP100 (50%)4 (150%)30 (40%)VIP1 agonist5 (80%)20 (50%)? (≤10%)[Asn3]VIP1agonist? (0%)5 (160%)n.d.The standard deviation of the agonists pD2 (−log EC50) values was always below 0.15 log units, and the standard deviation of the agonists' efficiency (Emax, in % of VIPs) was lower than ± 10%. n.d., not determined. Open table in a new tab The standard deviation of the p Ki (−log Ki) values was always below 0.15 log units. IC50 values, measured in 125I-VIP,125I-[Gln3]VIP, or 125I-VIP1antagonist competition curves on membranes of CHO cells expressing VPAC1, R188Q-, or K195Q-VPAC1 receptors, respectively. The standard deviation of the agonists pD2 (−log EC50) values was always below 0.15 log units, and the standard deviation of the agonists' efficiency (Emax, in % of VIPs) was lower than ± 10%. n.d., not determined. The clones transfected with the DNA coding for the mutated receptors were selected on the basis of the ability of 10 μm VIP membranes to activate adenylate cyclase. The selected clones were then tested for 125I-VIP binding. Binding was non-significant in all the clones tested. As expected from the binding data, the EC50 values for VIP were 30 to 100-fold higher than at VPAC1 receptors (Fig.1). There was no noticeable difference between the R188L and R188Q receptors on one hand and the K195I and K195Q on the other hand. We then tested the ability of VIP analogues to stimulate adenylate cyclase. [Arg16] VIP, [Asn3] VIP, and [Gln3] VIP were more potent and more efficient than VIP at the R188L- and R188Q-VPAC1 receptors, and [Glu3] VIP and the VIP1 agonist behaved as partial agonists on both mutant receptors (Fig. 1 and results not shown). The results are compared in Table II with the data obtained at wild type receptors with the same peptides. [Arg16] VIP was also more potent and more efficient than VIP on the K195Q- (Fig. 1) and K195I-VPAC1 receptors (data not shown). [Glu3] VIP, [Gln3] VIP, and [Asn3] VIP behaved as partial agonists on this construct, and the VIP1 agonists' ability to activate adenylate cyclase through K195Q- and K195I-VPAC1 receptor mutants was barely detectable (Table II). The VIP1 antagonists' affinity for the mutated receptors was evaluated by comparing VIP, [Arg16] VIP, or VIP1 agonist dose-effect curves in the absence and presence of 0.1, 0.3, or 1.0 μm antagonist (Fig.2 and results not shown). The VIP dose-effect curves were shifted dose-dependently to higher concentrations in the presence of antagonist, as expected for Ki values ≈ 2–3 nm at the five receptors (Fig. 2 and results not shown). Taken together, these results suggested that the affinity of [Gln3] VIP and of the VIP1 antagonist for the mutant receptors might be sufficient to allow binding studies using these radiolabeled peptides. This was indeed the case. The binding experiments were performed at 20 °C as tracer binding was unstable at 37 °C (probably because of a receptor instability, as already noted for chimeric receptors (10Vilardaga J.P. De Neef P. Di Paolo E. Bollen A. Waelbroeck M. Robberecht P. Biochem. Biophys. Res. Commun. 1995; 211: 885-891Crossref PubMed Scopus (77) Google Scholar, 25Gourlet P. Vandermeers A. Vandermeers-Piret M.C. De Neef P. Waelbroeck M. Robberecht P. Biochim. Biophys. Acta. 1996; 1314: 267-273Crossref PubMed Scopus (35) Google Scholar)). The binding of both tracers was rapid (equilibrium was achieved within 20 min) and reversible (data not shown). The peptides' IC50 values (reported in Table I) did not depend on the tracer used. Representative competition curves are shown in Fig.3. The R188Q and K195Q receptor concentrations were comparable (within 2-fold) to the VPAC1 receptor concentration. We were surprised that, even though the presence of a negative charge in position 3 was clearly deleterious for recognition of the R188Q, R188L, K195Q, and K195I mutant VPAC1 receptors by agonists, the VIP1 antagonist (that also possesses an Asp3 residue) retained a high affinity for the mutated receptors. We therefore synthesized and tested two additional peptides with an Asn3 residue, the Asn3 VIP1agonist and Asn3 VIP1 antagonist. As shown in Tables I and II, replacing the Asp3 by an Asn3residue reduced the affinity and efficacy of the VIP1agonist at wild type receptors but increased its affinity and efficacy on the mutated R188Q receptor. In contrast, replacing Asp3by an Asn3 residue in the VIP1 antagonist did not affect its affinity for the receptors studied in this work; the modified peptide always behaved as a high affinity antagonist (Fig.4). VIP receptors belong to a G protein-coupled receptor family that does not share any sequence homology with rhodopsin or with the β-adrenergic receptor family. Previous work with chimeric receptors (see Refs. 10Vilardaga J.P. De Neef P. Di Paolo E. Bollen A. Waelbroeck M. Robberecht P. Biochem. Biophys. Res. Commun. 1995; 211: 885-891Crossref PubMed Scopus (77) Google Scholar, 11Hashimoto H. Ogawa N. Hagihara N. Yamamoto K. Imanishi K. Nogi H. Nishino A. Fujita T. Matsuda T. Nagata S. Baba A. Mol. Pharmacol. 1997; 52: 128-135Crossref PubMed Scopus (46) Google Scholar, 12Holtmann M.H. Ganguli S. Hadac E.M. Dolu V. Miller L.J. J. Biol. Chem. 1996; 271: 14944-14949Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar, 13Holtmann M.H. Hadac E.M. Miller L.J. J. Biol. Chem. 1995; 270: 14394-14398Abstract Full Text Full Text PDF PubMed Scopus (168) Google Scholar and 29Van Rampelbergh J. Juarranz M.G. Perret J. Bondue A. Solano R.M. Delporte C. De Neef P. Robberecht P. Waelbroeck M. Br. J. Pharmacol. 2000; 130: 819-826Crossref PubMed Scopus (11) Google Scholar, 30Juarranz M.G. Van Rampelbergh J. Gourlet P. De Neef P. Cnudde J. Robberecht P. Waelbroeck M. Eur. J. Biochem. 1999; 265: 449-456Crossref PubMed Scopus (25) Google Scholar, 31Juarranz M.G. Van Rampelbergh J. Gourlet P. De Neef P. Cnudde J. Robberecht P. Waelbroeck M. Mol. Pharmacol. 1999; 56: 1280-1287Crossref PubMed Scopus (31) Google Scholar, 32Gourlet P. Vilardaga J.P. De Neef P. Waelbroeck M. Vandermeers A. Robberecht P. Peptides. 1996; 17: 825-829Crossref PubMed Scopus (79) Google Scholar, 33Gourlet P. Vilardaga J.P. De Neef P. Vandermeers A. Waelbroeck M. Bollen A. Robberecht P. Eur. J. Biochem. 1996; 239: 349-355Crossref PubMed Scopus (39) Google Scholar, 34Gourlet P. Vandermeers A. Vandermeers-Piret M.C. Rathe J. De Neef P. Robberecht P. Regul. Pept. 1996; 62: 125-130Crossref PubMed Scopus (27) Google Scholar) and cross-linking studies (35Dong, M., Asmann, Y. W., Zang, M., Pinon, D. I., and Miller, L. J. (2000) J. Biol. Chem.Google Scholar, 36Dong M. Wang Y. Hadac E.M. Pinon D.I. Holicky E. Miller L.J. J. Biol. Chem. 1999; 274: 19161-19167Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar, 37Dong M. Wang Y. Pinon D.I. Hadac E.M. Miller L.J. J. Biol. Chem. 1999; 274: 903-909Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar) led to a general VIP positioning model; the amino-terminal and carboxyl-terminal sequences of VIP and of its analogues seemed to interact with the "7TM" (transmembrane) receptor domain, whereas recognition of the central VIP sequence (from positions ≈6 to ≈22?) depends on the amino-terminal extracellular receptor domain. In view of the significant sequence homologies between secretin, VIP, PACAP, GRF, glucagon, glucagon-like peptide (7–36), and gastric inhibitory peptide on the one hand and between their receptors on the other hand, we hypothesized that these different peptides recognize "equivalent" binding sites in their respective receptors. The observation that all the aforementioned peptides except glucagon possess an acidic residue (Asp or Glu) in position 3, and that all the receptors (except glucagon's) possess aligned basic Arg and Lys residues at the extracellular end of TM2, led us to suspect that these residues might interact in the peptide-receptor complex. Our preliminary results confirmed that, as in secretin receptors (17Di Paolo E. Vilardaga J.P. Petry H. Moguilevsky N. Bollen A. Robberecht P. Waelbroeck M. Peptides. 1999; 20: 1187-1193Crossref PubMed Scopus (31) Google Scholar,38Vilardaga J.P. Di Paolo E. De Neef P. Waelbroeck M. Bollen A. Robberecht P. Biochem. Biophys. Res. Commun. 1996; 218: 842-846Crossref PubMed Scopus (36) Google Scholar), the VPAC1 receptor Arg188 and Lys195 were important for VIP recognition; we were unable to obtain significant 125I-VIP binding at the mutated receptors, and very high VIP concentrations were necessary to activate the adenylate cyclase. The following results suggested in addition that VIP was unable to stabilize the mutated receptors' active conformations sufficiently to ensure full receptor activation: [Asn3] VIP, [Gln3] VIP, and [Arg16] VIP were more efficient than VIP at the R188Q and R188L VPAC1 receptors, and [Arg16] VIP was more efficient than VIP at the K195Q and K195I VPAC1receptors. When VIP and its receptor are free, the VIP Asp3 and the receptor Arg188 and Lys195 side chains probably form dipole-ion interactions with surrounding water molecules. These favorable interactions are disrupted upon ligand binding; they must be compensated by ligand-receptor interactions to allow high affinity binding. The "uncharged VIP analogues" [Asn3] VIP and [Gln3] VIP had a higher affinity than VIP for the "uncharged receptor mutants" (R188Q, R188L, K195Q, and K195I VPAC1 receptors), suggesting that the VIP Asp3and the receptor Arg188 and Lys195 side chains were in close proximity in the agonist-receptor complex. The affinity loss that we observed upon replacement of the VIP Asp3, VPAC1 receptor Arg188, and VPAC1receptor Lys195 (30- to 100-fold) was however comparatively small and did not support the hypothesis that the Asp negative charge is close enough to the receptor Arg and Lys positive charges to form ionic bonds (40Andrews P. Trends Pharmacol. Sci. 1986; 7: 148-151Abstract Full Text PDF Scopus (33) Google Scholar). It is more likely that Asp3, Arg188, and Lys195 formed strong hydrogen bonds (i.e. dipole-dipole or ion-dipole interactions); the two receptor basic residues probably participated in the formation of an electrophilic pocket that recognized the negatively charged VIP Asp3 side chain. [Asn3] VIP and [Gln3] VIP behaved as partial agonists at wild type receptors but were more efficient than VIP at the R188Q and R188L mutant receptors. The incomplete activation of the mutant receptors by VIP might be caused by difficulties in burying the anionic Asp3 side chain deep enough in the (uncharged) mutant receptors' binding site. This hypothesis is indirectly supported by the observation that replacing the VIP Asp3 or the VPAC1 receptor Arg188or Lys195 with uncharged amino acids affected the recognition of the VIP1 agonist (an efficient partial agonist) somewhat less than the recognition of VIP and did not affect binding of the VIP1 antagonist, a compound that does not induce receptor activation. Due perhaps to steric hindrance between the receptor and the large d-Phe2 side chain, the VIP1 antagonist Asp3 was apparently unable to enter the agonist binding pocket and to trigger receptor activation. The parathyroid hormone (PTH) receptor belongs to the same receptor family as the VPAC1 receptor. A molecular model of the PTH-receptor interaction has been developed, based on experimental data from cross-linking studies, spectroscopic investigations of the hormone and receptor fragments, and theoretical structure predictions (39Pandol S.J. Dharmsathaphorn K. Schoeffield M.S. Vale W. Rivier J. Am. J. Physiol. 1986; 250: G553-G557PubMed Google Scholar). According to this model, PTH recognizes extracellular receptor domains (the amino-terminal domain and extracellular loops) but penetrates very little if at all inside the compact transmembrane helices bundle. It is tempting to suggest that, like PTH, VIP initially recognizes an extracellular binding site. In a second step, driven and stabilized i.e. by the Asp3-Lys195/Arg188 interactions, a transmembrane binding pocket opens and recognizes the agonists' amino-terminal amino acids, and the receptor activates intracellular G proteins. "Too large" amino-terminal VIP amino acids (d-Phe2 instead of Ser2 and pCl-Phe6 instead of Phe6) might prevent the recognition of this activated receptor conformation by steric hindrance; [d-Phe2] and [pCl-Phe6] VIP or VIP/GRF analogues usually behave as VIP antagonists (27Rolz C. Pellegrini M. Mierke D.F. Biochemistry. 1999; 38: 6397-6405Crossref PubMed Scopus (74) Google Scholar, 28Rekasi Z. Varga J.L. Schally A.V. Halmos G. Groot K. Czompoly T. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 1218-1223Crossref PubMed Scopus (32) Google Scholar). The location of the VIP and secretin "Asp3 binding site" to transmembrane helix 2 was somewhat unexpected; indeed, in the rhodopsin-like β-adrenergic G protein-coupled receptor family, the ligand binding pocket is lined by TMs 3 to 7 and does not involve TMs 1 and 2. It is important to note in this respect that most of the "signature" amino acids that define the β-adrenergic G protein-coupled receptor family, including the proline residues that participate in the formation of the agonist binding pocket, are absent from the secretin receptor family (including VPAC1receptors). Our results suggest that (in contrast with the G protein binding site that appears to involve the same intracellular loops in both receptor families) the agonist binding site was located in very different transmembrane regions in the secretin- and β-adrenergic-receptor families. Further studies will be needed to extend this observation and allow the construction of an activated agonist-receptor complex model. To conclude, our present results suggested that the VIP Asp3 side chain fitted inside the transmembrane helix bundle, in close proximity to TM2 Lys195 and Arg188. This interaction was essential for receptor activation. The VIP1 antagonist Asp3 residue did not recognize the same binding pocket perhaps because of unfavorable coulombic interactions between thed-Phe2 side chain and the receptor.

Referência(s)