Tumor Necrosis Factor α Blockade Restores Growth Hormone Signaling in Murine Colitis
2005; Elsevier BV; Volume: 128; Issue: 5 Linguagem: Inglês
10.1053/j.gastro.2005.02.003
ISSN1528-0012
AutoresLisa DiFedele, Jiman He, Erin Bonkowski, Xiaonan Han, Matthew A. Held, Alan Bohan, Ram K. Menon, Lee A. Denson,
Tópico(s)Immune Cell Function and Interaction
ResumoBackground & Aims: Cytokines including tumor necrosis factor α (TNFα) may create a state of growth hormone (GH) resistance in Crohn's disease. Anabolic effects of GH are mediated via phosphorylation of the signal transducer and activator of transcription (STAT)5b transcription factor. Although GH resistance in other settings has been linked to a defect in janus kinase-STAT signaling, the molecular basis for GH resistance in colitis was not known. We hypothesized that the GH-induced phosphorylation of STAT5b would be impaired in colitis, and that TNFα blockade would restore GH signaling.Methods: Growth, body composition, and molecular regulators of GH signaling were determined in interleukin-10 null mice with chronic colitis and wild-type controls, ± treatment with an anti-TNFα antibody.Results: Interleukin-10 null mice exhibited significant alterations in growth, body composition, and feed efficiency. Liver insulin-like growth factor 1 expression was reduced in colitic mice. This was associated with down-regulation of GH receptor (GHR) expression and impaired GH-dependent STAT5b activation. Down-regulation of GHR expression was associated with reduced nuclear abundance and DNA binding of the GHR gene-promoter transactivator, Sp3. TNFα down-regulated GHR abundance and prevented GH-induced tyrosine phosphorylation of STAT5 in rat hepatocytes in culture. TNFα neutralization up-regulated liver GHR abundance and restored GH activation of STAT5 and serum insulin-like growth factor 1 levels in colitic mice; this preceded improvements in weight gain and disease activity.Conclusions: GH resistance in experimental colitis is caused by down-regulation of GHR expression, thereby reducing GH-dependent STAT5 activation. TNFα blockade restores liver GH signaling and improves anabolic metabolism in this setting. Background & Aims: Cytokines including tumor necrosis factor α (TNFα) may create a state of growth hormone (GH) resistance in Crohn's disease. Anabolic effects of GH are mediated via phosphorylation of the signal transducer and activator of transcription (STAT)5b transcription factor. Although GH resistance in other settings has been linked to a defect in janus kinase-STAT signaling, the molecular basis for GH resistance in colitis was not known. We hypothesized that the GH-induced phosphorylation of STAT5b would be impaired in colitis, and that TNFα blockade would restore GH signaling. Methods: Growth, body composition, and molecular regulators of GH signaling were determined in interleukin-10 null mice with chronic colitis and wild-type controls, ± treatment with an anti-TNFα antibody. Results: Interleukin-10 null mice exhibited significant alterations in growth, body composition, and feed efficiency. Liver insulin-like growth factor 1 expression was reduced in colitic mice. This was associated with down-regulation of GH receptor (GHR) expression and impaired GH-dependent STAT5b activation. Down-regulation of GHR expression was associated with reduced nuclear abundance and DNA binding of the GHR gene-promoter transactivator, Sp3. TNFα down-regulated GHR abundance and prevented GH-induced tyrosine phosphorylation of STAT5 in rat hepatocytes in culture. TNFα neutralization up-regulated liver GHR abundance and restored GH activation of STAT5 and serum insulin-like growth factor 1 levels in colitic mice; this preceded improvements in weight gain and disease activity. Conclusions: GH resistance in experimental colitis is caused by down-regulation of GHR expression, thereby reducing GH-dependent STAT5 activation. TNFα blockade restores liver GH signaling and improves anabolic metabolism in this setting. Children with Crohn's disease experience significant reductions in linear growth, lean body mass, bone mineral density (BMD), and mucosal healing.1Cezard J.P. Touati G. Alberti C. Hugot J.P. Brinon C. Czernichow P. Growth in paediatric Crohn's disease.Horm Res. 2002; 58: 11-15Google Scholar, 2Markowitz J. Grancher K. Rosa J. Aiges H. Daum F. Growth failure in pediatric inflammatory bowel disease.J Pediatr Gastroenterol Nutr. 1993; 16: 373-380Google Scholar, 3Sentongo T.A. Semeao E.J. Piccoli D.A. Stallings V.A. Zemel B.S. Growth, body composition, and nutritional status in children and adolescents with Crohn's disease.J Pediatr Gastroenterol Nutr. 2000; 31: 33-40Google Scholar Intact growth hormone (GH) signaling leading to the synthesis of the anabolic hormone, insulin-like growth factor 1 (IGF-1), is essential for normal growth and body composition.4Zhou Y. Xu B.C. Maheshwari H.G. He L. Reed M. Lozykowski M. Okada S. Cataldo L. Coschigamo K. Wagner T.E. Baumann G. Kopchick J.J. A mammalian model for Laron syndrome produced by targeted disruption of the mouse growth hormone receptor/binding protein gene (the Laron mouse).Proc Natl Acad Sci U S A. 1997; 94: 13215-13220Google Scholar, 5Yakar S. Rosen C.J. Beamer W.G. Ackert-Bicknell C.L. Wu Y. Liu J.L. Ooi G.T. Setser J. Frystyk J. Boisclair Y.R. LeRoith D. Circulating levels of IGF-1 directly regulate bone growth and density.J Clin Invest. 2002; 110: 771-781Scopus (0) Google Scholar Recent studies have indicated that the GH/IGF-1 axis also may regulate mucosal healing after colonic injury.6Williams K.L. Fuller C.R. Dieleman L.A. DaCosta C.M. Haldeman K.M. Sartor R.B. Lund P.K. Enhanced survival and mucosal repair after dextran sodium sulfate-induced colitis in transgenic mice that overexpress growth hormone.Gastroenterology. 2001; 120: 925-937Abstract Full Text Full Text PDF Scopus (215) Google Scholar, 7Slonim A.E. Bulone L. Damore M.B. Goldberg T. Wingertzahn M.A. McKinley M.J. A preliminary study of growth hormone therapy for Crohn's disease.N Engl J Med. 2000; 342: 1633-1637Google Scholar, 8Kara E. Sungurtekin H. Sungertekin U. Alkanat M. Ilkgul O. The effect of recombinant human growth hormone (rhGH) on trinitrobenzene sulfonic acid-induced colitis in rats an experimental study.Inflamm Bowel Dis. 2004; 10: 112-115Google Scholar Alterations in growth, body composition, and mucosal repair in children with colitis may in part be caused by an acquired GH resistance, which is characterized by reduced circulating IGF-1 levels despite normal to increased GH secretion.9Ballinger A.B. Camacho-Hubner C. Croft N.M. Growth failure and intestinal inflammation.QJM. 2001; 94: 121-125Google Scholar, 10Thomas A.G. Holly J.M. Taylor F. Miller V. Insulin like growth factor-I, insulin like growth factor binding protein-1, and insulin in childhood Crohn's disease.Gut. 1993; 34: 944-947Google Scholar This is associated with increased disease activity and increased circulating levels of inflammatory cytokines including tumor necrosis factor α (TNFα).11Murch S.H. Lamkin V.A. Savage M.O. Walker-Smith J.A. MacDonald T.T. Serum concentrations of tumour necrosis factor alpha in childhood chronic inflammatory bowel disease.Gut. 1991; 32: 913-917Google Scholar Therapies including enteral nutrition or anti-TNFα antibody (infliximab) administration that reduce disease activity and normalize cytokine levels are associated with increases in circulating IGF-1 levels and restoration of age-appropriate height velocity.12Beattie R.M. Camacho-Hubner C. Wacharasindhu S. Cotterill A.M. Walker-Smith J.A. Savage M.O. Responsiveness of IGF-I and IGFBP-3 to therapeutic intervention in children and adolescents with Crohn's disease.Clin Endocrinol (Oxf). 1998; 49: 483-489Google Scholar, 13Cezard J.P. Nouaili N. Talbotec C. Hugot J.P. Gobert J.G. Schmitz J. Mougenot J.F. Alberti C. Goulet O. A prospective study of the efficacy and tolerance of a chimeric antibody to tumor necrosis factors (remicade) in severe pediatric Crohn disease.J Pediatr Gastroenterol Nutr. 2003; 36: 632-636Google Scholar, 14Borrelli O. Bascietto C. Viola F. Bueno de Mesquita M. Barbato M. Mancini V. Bosco S. Cucchiara S. Infliximab heals intestinal inflammatory lesions and restores growth in children with Crohn's disease.Dig Liver Dis. 2004; 36: 342-347Google Scholar Under normal conditions, GH binds to the GH receptor (GHR), triggering autophosphorylation of janus kinase 2 and tyrosine phosphorylation of the signal transducer and activator of transcription 5a and 5b (STAT5a and STAT5b) transcription factors. STAT5a/b phosphoproteins then translocate to the nucleus, activating transcription of anabolic target genes including IGF-1 and the IGF binding protein acid labile subunit (ALS).15Woelfle J. Billiard J. Rotwein P. Acute control of insulin-like growth factor-I gene transcription by growth hormone through Stat5b.J Biol Chem. 2003; 278: 22696-22702Google Scholar, 16Woelfle J. Chia D.J. Rotwein P. Mechanisms of growth hormone (GH) action. Identification of conserved Stat5 binding sites that mediate GH-induced insulin-like growth factor-I gene activation.J Biol Chem. 2003; 278: 51261-51266Google Scholar, 17Ooi G.T. Hurst K.R. Poy M.N. Rechler M.M. Boisclair Y.R. Binding of STAT5a and STAT5b to a single element resembling a gamma-interferon-activated sequence mediates the growth hormone induction of the mouse acid-labile subunit promoter in liver cells.Mol Endocrinol. 1998; 12: 675-687Google Scholar, 18Boisclair Y.R. Hurst K.R. Ueki I. Tremblay M.L. Ooi G.T. Regulation and role of the acid-labile subunit of the 150-kilodalton insulin-like growth factor complex in the mouse.Pediatr Nephrol. 2000; 14: 562-566Google Scholar IGF-1 then circulates in a complex comprised of IGF-1, ALS, and IGF binding protein 3 (IGFBP-3).18Boisclair Y.R. Hurst K.R. Ueki I. Tremblay M.L. Ooi G.T. Regulation and role of the acid-labile subunit of the 150-kilodalton insulin-like growth factor complex in the mouse.Pediatr Nephrol. 2000; 14: 562-566Google Scholar Studies in STAT5b and liver-specific IGF-1 null mice have confirmed that STAT5b is essential for GH-dependent up-regulation of hepatic IGF-1 synthesis, which accounts for the majority of circulating IGF-1.5Yakar S. Rosen C.J. Beamer W.G. Ackert-Bicknell C.L. Wu Y. Liu J.L. Ooi G.T. Setser J. Frystyk J. Boisclair Y.R. LeRoith D. Circulating levels of IGF-1 directly regulate bone growth and density.J Clin Invest. 2002; 110: 771-781Scopus (0) Google Scholar, 19Davey H.W. Park S.H. Grattan D.R. McLachlan M.J. Waxman D.J. STAT5b-deficient mice are growth hormone pulse-resistant. Role of STAT5b in sex-specific liver p450 expression.J Biol Chem. 1999; 274: 35331-35336Google Scholar, 20Yakar S. Liu J.L. Stannard B. Butler A. Accili D. Sauer B. LeRoith D. Normal growth and development in the absence of hepatic insulin-like growth factor I.Proc Natl Acad Sci U S A. 1999; 96: 7324-7329Google Scholar, 21Davey H.W. Xie T. McLachlan M.J. Wilkins R.J. Waxman D.J. Grattan D.R. STAT5b is required for GH-induced liver IGF-I gene expression.Endocrinology. 2001; 142: 3836-3841Google Scholar Moreover, STAT5b also has been shown to account for the increased growth rate that is observed in males, whereas the combined deletion of STAT5a and STAT5b has been required to suppress growth in females.22Davey H.W. Wilkins R.J. Waxman D.J. STAT5 signaling in sexually dimorphic gene expression and growth patterns.Am J Hum Genet. 1999; 65: 959-965Google Scholar The importance of STAT5b for postnatal growth in humans has been confirmed with the recent report of a female child with a missense mutation in STAT5b who experienced severe growth failure refractory to GH administration.23Kofoed E.M. Hwa V. Little B. Woods K.A. Buckway C.K. Tsubaki J. Pratt K.L. Bezrodnik L. Jasper H. Tepper A. Heinrich J.J. Rosenfeld R.G. Growth hormone insensitivity associated with a STAT5b mutation.N Engl J Med. 2003; 349: 1139-1147Google Scholar Combined deletion of liver IGF-1 and ALS expression has identified a threshold for circulating IGF-1 levels below which linear growth is effected adversely.5Yakar S. Rosen C.J. Beamer W.G. Ackert-Bicknell C.L. Wu Y. Liu J.L. Ooi G.T. Setser J. Frystyk J. Boisclair Y.R. LeRoith D. Circulating levels of IGF-1 directly regulate bone growth and density.J Clin Invest. 2002; 110: 771-781Scopus (0) Google Scholar However, the molecular mechanisms by which chronic colitis might impair GH signaling and associated growth and body composition were not known. Recent studies in rodent models of colitis and acute systemic inflammation have begun to characterize cytokine-dependent mechanisms of hepatic GH resistance. Reduced IGF-1 expression has been observed in rodents with acute trinitrobenzene sulfonic acid-induced colitis, whereas sepsis caused by cecal ligation and puncture and systemic inflammation after endotoxin (lipopolysaccharide) administration has been shown to impair GH activation of STAT5.24Hong-Brown L.Q. Brown C.R. Cooney R.N. Frost R.A. Lang C.H. Sepsis-induced muscle growth hormone resistance occurs independently of STAT5 phosphorylation.Am J Physiol. 2003; 285: E63-E72Google Scholar, 25Denson L.A. Held M.A. Menon R.K. Frank S.J. Parlow A.F. Arnold D.L. Interleukin-6 inhibits hepatic growth hormone signaling via upregulation of Cis and Socs-3.Am J Physiol. 2003; 284: G646-G654Google Scholar, 26Ballinger A.B. Azooz O. El-Haj T. Poole S. Farthing M.J. Growth failure occurs through a decrease in insulin-like growth factor 1 which is independent of undernutrition in a rat model of colitis.Gut. 2000; 46: 694-700Google Scholar Antibodies to TNF-α and interleukin (IL)-6 partially have restored growth and IGF-1 expression in rodents with trinitrobenzene sulfonic acid colitis, confirming a role for these cytokines in causing GH resistance in colitis.9Ballinger A.B. Camacho-Hubner C. Croft N.M. Growth failure and intestinal inflammation.QJM. 2001; 94: 121-125Google Scholar, 26Ballinger A.B. Azooz O. El-Haj T. Poole S. Farthing M.J. Growth failure occurs through a decrease in insulin-like growth factor 1 which is independent of undernutrition in a rat model of colitis.Gut. 2000; 46: 694-700Google Scholar However, the molecular basis for the improvement in IGF-1 expression with cytokine blockade was not determined. In models of acute systemic inflammation based on lipopolysaccharide administration, several groups now have shown a specific impairment of liver GH signaling, characterized by reduced STAT5 phosphorylation and IGF-1 expression.25Denson L.A. Held M.A. Menon R.K. Frank S.J. Parlow A.F. Arnold D.L. Interleukin-6 inhibits hepatic growth hormone signaling via upregulation of Cis and Socs-3.Am J Physiol. 2003; 284: G646-G654Google Scholar, 27Mao Y. Ling P.R. Fitzgibbons T.P. McCowen K.C. Frick G.P. Bistrian B.R. Smith R.J. Endotoxin-induced inhibition of growth hormone receptor signaling in rat liver in vivo.Endocrinology. 1999; 140: 5505-5515Google Scholar, 28Lang C.H. Silvis C. Deshpande N. Nystrom G. Frost R.A. Endotoxin stimulates in vivo expression of inflammatory cytokines tumor necrosis factor alpha, interleukin-1beta, -6, and high-mobility-group protein-1 in skeletal muscle.Shock. 2003; 19: 538-546Google Scholar Defects in GH signaling at the receptor or postreceptor level have been identified.25Denson L.A. Held M.A. Menon R.K. Frank S.J. Parlow A.F. Arnold D.L. Interleukin-6 inhibits hepatic growth hormone signaling via upregulation of Cis and Socs-3.Am J Physiol. 2003; 284: G646-G654Google Scholar, 27Mao Y. Ling P.R. Fitzgibbons T.P. McCowen K.C. Frick G.P. Bistrian B.R. Smith R.J. Endotoxin-induced inhibition of growth hormone receptor signaling in rat liver in vivo.Endocrinology. 1999; 140: 5505-5515Google Scholar, 28Lang C.H. Silvis C. Deshpande N. Nystrom G. Frost R.A. Endotoxin stimulates in vivo expression of inflammatory cytokines tumor necrosis factor alpha, interleukin-1beta, -6, and high-mobility-group protein-1 in skeletal muscle.Shock. 2003; 19: 538-546Google Scholar, 29Denson L.A. Menon R.K. Shaufl A. Bajwa H.S. Williams C.R. Karpen S.J. TNF-alpha downregulates murine hepatic growth hormone receptor expression by inhibiting Sp1 and Sp3 binding.J Clin Invest. 2001; 107: 1451-1458Google Scholar, 30Defalque D. Brandt N. Ketelslegers J.M. Thissen J.P. GH insensitivity induced by endotoxin injection is associated with decreased liver GH receptors.Am J Physiol. 1999; 276: E565-E572Google Scholar The L2 transcript accounts for 60%–70% of total GHR gene transcripts in mouse liver and extrahepatic tissues. We have reported that lipopolysaccharide reduces total and L2 transcript liver GHR-RNA expression. This is caused by down-regulation of Sp3 transcription factor binding to adjacent cis-elements in the L2 transcript promoter, and requires intact TNF receptor 1 signaling.29Denson L.A. Menon R.K. Shaufl A. Bajwa H.S. Williams C.R. Karpen S.J. TNF-alpha downregulates murine hepatic growth hormone receptor expression by inhibiting Sp1 and Sp3 binding.J Clin Invest. 2001; 107: 1451-1458Google Scholar TNFα treatment of mouse liver cells in culture suppressed GHR gene-promoter activity via these Sp3 cis-elements, implicating TNFα in inflammatory down-regulation of GHR gene expression and associated GH resistance.29Denson L.A. Menon R.K. Shaufl A. Bajwa H.S. Williams C.R. Karpen S.J. TNF-alpha downregulates murine hepatic growth hormone receptor expression by inhibiting Sp1 and Sp3 binding.J Clin Invest. 2001; 107: 1451-1458Google Scholar However, whether TNFα-dependent down-regulation of liver GHR expression also impaired STAT5 phosphorylation in colitis was not known. Mice with targeted deletion of IL-10 develop a chronic, progressive colitis that typically peaks in severity between 16 and 20 weeks of age.31Spencer D.M. Veldman G.M. Banerjee S. Willis J. Levine A.D. Distinct inflammatory mechanisms mediate early versus late colitis in mice.Gastroenterology. 2002; 122: 94-105Abstract Full Text Full Text PDF Scopus (171) Google Scholar Inflammatory cytokines including TNFα that have been associated with growth failure in pediatric Crohn's disease also are increased during this phase of colitis in IL-10 null mice.11Murch S.H. Lamkin V.A. Savage M.O. Walker-Smith J.A. MacDonald T.T. Serum concentrations of tumour necrosis factor alpha in childhood chronic inflammatory bowel disease.Gut. 1991; 32: 913-917Google Scholar This is associated with a progressive reduction in weight gain relative to wild-type littermates, ultimately resulting in weight that is reduced by approximately 20%.31Spencer D.M. Veldman G.M. Banerjee S. Willis J. Levine A.D. Distinct inflammatory mechanisms mediate early versus late colitis in mice.Gastroenterology. 2002; 122: 94-105Abstract Full Text Full Text PDF Scopus (171) Google Scholar In these respects, IL-10 null mice represent a useful animal model for examining mechanisms by which chronic colitis may impair growth and body composition. However, characterization of alterations in fat-free mass and fat mass, as well as potentially sexually dimorphic aspects of these parameters, were unknown. Moreover, whether colitic IL-10 null mice exhibited reduced liver IGF-1 expression, and the corresponding molecular basis for this, was not known. We have characterized growth failure and altered hepatic GH signaling in a murine model of chronic colitis. We hypothesized that colitic mice would exhibit growth failure and hepatic GH resistance, manifested as impaired GH-dependent STAT5 tyrosine phosphorylation, and that this could be attributed to reduced GHR expression. We have confirmed that IL-10 null mice with colitis develop a progressive growth failure that is associated with significant reductions in hepatic GHR abundance, GH-dependent STAT5 phosphorylation, and IGF-1 expression, and that TNFα blockade restores GHR expression and GH signaling. Breeding pairs for C3H/HeJBir IL-10+/+ (#004325) and −/− (#004326) mice were obtained from Dr. Edward Leiter, Jackson Laboratories (Bar Harbor, ME). These mice were used because of the earlier and more uniform onset of disease (after weaning at 4 weeks of age) relative to other strains.32Farmer M.A. Sundberg J.P. Bristol I.J. Churchill G.A. Li R. Elson C.O. Leiter E.H. A major quantitative trait locus on chromosome 3 controls colitis severity in IL-10-deficient mice.Proc Natl Acad Sci U S A. 2001; 98: 13820-13825Google Scholar H4IIE rat hepatoma cells were obtained from the American Type Culture Collection (Rockville, MD). Rat GH was obtained from Dr. Alfred Parlow, National Hormone & Peptide Program (Harbor-UCLA Medical Center, Torrance, CA). Human recombinant TNFα and IL-6 were obtained from R&D Systems (Minneapolis, MN). A rat/mouse monoclonal anti-TNFα antibody (clone cV1q) and isotype control immunoglobulin (Ig)G antibody (cVaM) were provided by Centocor (Malvern, PA). Sp3 (category sc-644), actin (category sc-1615), and sh-ptp1 (category sc-287) polyclonal antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). A tyrosine phosphorylation state-specific STAT5 antibody (anti-STAT5 A/B [Y694/Y699]), category s4308, was obtained from Sigma (St. Louis, MO). The GHR AL-47 polyclonal antibody that recognizes the cytoplasmic domain of the GHR has been described previously.33Zhang Y. Guan R. Jiang J. Kopchick J.J. Black R.A. Baumann G. Frank S.J. Growth hormone (GH)-induced dimerization inhibits phorbol ester-stimulated GH receptor proteolysis.J Biol Chem. 2001; 276: 24565-24573Google Scholar Primers and reagents for real-time polymerase chain reaction (PCR) were obtained from Invitrogen (Carlsbad, CA) and Stratagene (La Jolla, CA), respectively. The NE-PER kit for preparation of nuclear and cytosolic proteins was obtained from Pierce (Rockford, IL). TRIzol for preparation of RNA was obtained from Gibco-BRL (Rockville, MD). The Renaissance chemiluminescence kit was obtained from NEN (Wilmington, DE). The DIG electrophoretic mobility shift assay (EMSA) kit was obtained from Boeringher-Mannheim (Indianapolis, IN). The OCTEIA enzyme-linked immunosorbent assay kit for determination of serum IGF-1 was obtained from Immunodiagnostic Systems, Inc. (Fountain Hills, AZ). EMSA oligonucleotides were synthesized by Gibco-BRL. The following synthetic oligonucleotide was used for the consensus STAT5 cis element: STAT5s: GGACTTCTTGGAATTAAGGGA.34Park S.H. Liu X. Hennighausen L. Davey H.W. Waxman D.J. Distinctive roles of STAT5a and STAT5b in sexual dimorphism of hepatic P450 gene expression. Impact of STAT5a gene disruption.J Biol Chem. 1999; 274: 7421-7430Google Scholar The following synthetic oligonucleotide was used for the L2 transcript GHR gene promoter L2A Sp3 cis element: L2As: TTTCACCCCGCCCCCTTCCTC.29Denson L.A. Menon R.K. Shaufl A. Bajwa H.S. Williams C.R. Karpen S.J. TNF-alpha downregulates murine hepatic growth hormone receptor expression by inhibiting Sp1 and Sp3 binding.J Clin Invest. 2001; 107: 1451-1458Google Scholar Double-stranded oligonucleotides for EMSA were generated by annealing the respective synthetic oligonucleotides with the complementary sequences: STAT5r: TCCCTTAATTCCAAGAAGTCC; L2Ar: GAGGAAGGGGGCGGGGTGAAA. Animals were maintained in the Yale Animal Research Center and Cincinnati Children's Hospital Research Foundation Animal Care Facility and housed in a standard facility with a temperature- and humidity-controlled environment under a constant light cycle with free access to chow and water. IL-10+/− mice were bred to produce IL-10−/− and IL-10+/+ littermates for study. Genotyping was performed using DNA prepared from tails and the following primers: p1: gTg ggT gCA gTT ATT gTC TTC CCg; p2: gCC TTC AgT ATA AAA ggg ggA CC; p3: CCT gCg TgC AAT CCA TCT Tg, as recommended by Dr. Leiter at Jackson Laboratories. PCR using p1 and p2 identified +/+ mice, whereas PCR using p2 and p3 identified −/− mice. This PCR yielded a product of 200 bp for wild-type (WT) and 450 bp for IL-10 null mice. The protocol was approved by the Yale and Cincinnati Children's Hospital Medical Center Animal Care and Use Committees, and all animals received humane care as outlined in the National Institutes of Health Guide for Care and Use of Laboratory Animals. We confirmed that more than 95% of IL-10 null mice developed colitis by 8 weeks of age, and had significant growth failure that progressed between 8 and 20 weeks. Length, weight, and body composition were determined before death at 20 weeks of age. Length was determined by measuring the distance from nose to anus in mice sedated with ketamine/xylazine.5Yakar S. Rosen C.J. Beamer W.G. Ackert-Bicknell C.L. Wu Y. Liu J.L. Ooi G.T. Setser J. Frystyk J. Boisclair Y.R. LeRoith D. Circulating levels of IGF-1 directly regulate bone growth and density.J Clin Invest. 2002; 110: 771-781Scopus (0) Google Scholar Body composition measurements including fat-free mass (FFM) in grams, fat mass in grams, and BMD in mg/cm2 were obtained using Lunar Piximus dual-energy x-ray absorptiometry scanning (Lunar Piximus Corp, Madison, WI) in the Yale Musculoskeletal Disorders Core Facility.35Brommage R. Validation and calibration of DEXA body composition in mice.Am J Physiol. 2003; 285: E454-E459Google Scholar Chow intake and weight gain were recorded weekly from 8 to 20 weeks of age to compute feed efficiency, and after isotype control IgG or anti-TNFα antibody administration. Serum IGF-1 level was determined by using an enzyme-linked immunosorbent assay per the manufacturer's recommendations (Immunodiagnostic Systems, Inc.). The entire cecum and colon from WT and IL-10 null mice were dissected longitudinally, fixed in 10% neutral buffered formalin, sectioned at 6 μm, and stained with H&E for light microscopic examination. The scoring system developed by Berg et al36Berg D.J. Davidson N. Kuhn R. Muller W. Menon S. Holland G. Thompson-Snipes L. Leach M.W. Rennick D. Enterocolitis and colon cancer in interleukin-10-deficient mice are associated with aberrant cytokine production and CD4(+) TH1-like responses.J Clin Invest. 1996; 98: 1010-1020Google Scholar was used. The score reflects the segmental extent and severity of colon inflammation, crypt hyperplasia, and mucin depletion, and ranges from 0 to 24. Colon histology was scored in a blinded fashion by 2 independent observers (X.H. and L.A.D.); the average score for each mouse then was determined. Rat GH administration consisted of a single intraperitoneal (IP) injection (1.0 mcg/g body wt) given 30 minutes before harvesting of liver. Control mice were injected with an equal volume of sterile phosphate-buffered saline (PBS). IL-10 null mice received anti-TNFα antibody, 1 mg IP, or isotype control IgG antibody, 1 mg IP, either as a single dose and then they were killed 24 hours later, or as a weekly dose and then they were killed after 3 weeks. H4IIE cells were grown to confluency in Dulbecco's modified Eagle medium with 10% fetal bovine serum. They then were serum starved for 24 hours before treatment with TNFα, IL-6, or IL-1β ± rat GH. Total liver RNA was extracted using TRIzol (Gibco Life Technologies, Gaithersburg, MD). The concentration and purity were confirmed by spectrophotometry (Beckmann DU-640B, Beckmann Instruments, Palo Alto, CA). RNA was stored at −80°C. Complementary DNA was prepared by reverse transcription from 5 mcg RNA as previously described.29Denson L.A. Menon R.K. Shaufl A. Bajwa H.S. Williams C.R. Karpen S.J. TNF-alpha downregulates murine hepatic growth hormone receptor expression by inhibiting Sp1 and Sp3 binding.J Clin Invest. 2001; 107: 1451-1458Google Scholar The following primers were used for the SYBR Green QPCR assay and the source for each primer pair is as indicated. mIGF-1: forward: GCTATGGCTCCAGCATTCG; reverse: GCTCCGGAAGCAACACTCA (Applied Biosystems Primer Design Software; Applied Biosystems, Foster City, CA); mIGF1Exon 1: forward: GATGGGGAAAATCAGCAGCC; reverse: CAACACTCATCCACAATGCC37Li Y. Iida K. O'Neil J. Zhang P. Li S. Frank A. Gabai A. Zambito F. Liang S.H. Rosen C.J. Cavener D.R. PERK eIF2alpha kinase regulates neonatal growth by controlling the expression of circulating insulin-like growth factor-I derived from the liver.Endocrinology. 2003; 144: 3505-3513Google Scholar; mIGF1Exon 2: forward: TGCTGTGTAAACGACCCG; reverse: CAACACTCATCCACAATGCC37Li Y. Iida K. O'Neil J. Zhang P. Li S. Frank A. Gabai A. Zambito F. Liang S.H. Rosen C.J. Cavener D.R. PERK eIF2alpha kinase regulates neonatal growth by controlling the expression of circulating insulin-like growth factor-I derived from the liver.Endocrinology. 2003; 144: 3505-3513Google Scholar; mALS: forward: TCAGTCACCTTTGGGACCTC; reverse: CGGTCCAGGTAGAGCTTCTG (Primer3 Primer Design Software); mIGFBP3: forward: GACACCCAGAACTTCTCCTCC; reverse: CATACTTGTCCACACACCAGC38Schuller A.G. Groffen C. van Neck J.W. Zwarthoff E.C. Drop S.L. cDNA cloning and mRNA expression of the six mouse insulin-like growth factor binding proteins.Mol Cell Endocrinol. 1994; 104: 57-66Google Scholar; mGHR: forward: GGATCTTTGTCAGGTCTTCTTAACCT; reverse: CAAGAGTAGCTGGTGTAGCCTCACT29Denson L.A. Menon R.K. Shaufl A. Bajwa H.S. Williams C.R. Karpen S.J. TNF-alpha downregulates murine hepatic growth hormone receptor expression by inhibiting Sp1 and Sp3 binding.J Clin Invest. 2001; 107: 1451-1458Google Scholar; mGHRL2: forward: GTCCACGCGGCCTGAG; reverse: TCGCCTCGGGAGACAGAAC29Denson L.A. Menon R.K. Shaufl A. Bajwa H.S. Williams C.R. Karpen S.J. TNF-alpha downregulates murine hepatic growth hormone receptor expression by inhibiting Sp1 and Sp3 binding.J Clin Invest. 2001; 107: 1451-1458Google Scholar; m18S: forward: CCCTGTAATTGGAATGAGTCCAC; reverse: GCTGGAATTACCGCGGCT.39Scharte M. Han X. Bertges D.J. Fink M.P. Delude R.L. Cytokines induce HIF-1 DNA binding and the expression of HIF-1-dependent genes in cultured rat enterocytes.Am J Physiol. 2003; 284: G373-G384Google Scholar The SYBR Green real-time quantitative PCR assay was performed on a Stratagene Mx4000 Sequence Detection System, according to the manufacturer's protocol (Stratagene). Standard curves were used to determine relative quantification for each target gene. Dissociation curves were used to confirm the absence of primer-dimers and/or nonspecific target amplification. Amplification of actin and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) initially were performed to nor
Referência(s)