Studies on the Reaction Mechanism of Rhodotorula gracilis d-Amino-acid Oxidase
1999; Elsevier BV; Volume: 274; Issue: 51 Linguagem: Inglês
10.1074/jbc.274.51.36233
ISSN1083-351X
AutoresChristopher M. Harris, Gianluca Molla, Mirella S. Pilone, Loredano Pollegioni,
Tópico(s)Chemical Synthesis and Analysis
ResumoWe have studied d-amino-acid oxidase from Rhodo- torula gracilis by site-directed mutagenesis for the purpose of determining the presence or absence of residues having a possible role in acid/base catalysis. Tyr-223, one of the very few conserved residues among d-amino-acid oxidases, has been mutated to phenylalanine and to serine. Both mutants are active catalysts in turnover with d-alanine, and they are reduced by d-alanine slightly faster than wild-type enzyme. The Tyr-223 → Phe mutant is virtually identical to the wild-type enzyme, whereas the Tyr-223 → Ser mutant exhibits 60-fold slower substrate binding and at least 800-fold slower rate of product release relative to wild-type. These data eliminate Tyr-223 as an active-site acid/base catalyst. These results underline the importance of Tyr-223 for substrate binding and exemplify the importance of steric interactions in RgDAAO catalysis. We have studied d-amino-acid oxidase from Rhodo- torula gracilis by site-directed mutagenesis for the purpose of determining the presence or absence of residues having a possible role in acid/base catalysis. Tyr-223, one of the very few conserved residues among d-amino-acid oxidases, has been mutated to phenylalanine and to serine. Both mutants are active catalysts in turnover with d-alanine, and they are reduced by d-alanine slightly faster than wild-type enzyme. The Tyr-223 → Phe mutant is virtually identical to the wild-type enzyme, whereas the Tyr-223 → Ser mutant exhibits 60-fold slower substrate binding and at least 800-fold slower rate of product release relative to wild-type. These data eliminate Tyr-223 as an active-site acid/base catalyst. These results underline the importance of Tyr-223 for substrate binding and exemplify the importance of steric interactions in RgDAAO catalysis. d-amino-acid oxidase (EC 1.4.3.3) R. gracilis d-amino-acid oxidase xanthine oxidase imino acid 3,3,3-trifluoro-dl-alanine The enzyme d-amino-acid oxidase (EC 1.4.3.3, DAAO)1 from the yeastRhodotorula gracilis has been exploited as a potent industrial biocatalyst (for a recent review see Ref. 1Pilone M.S. Pollegioni L. Recent Res. Dev. Biotechnol. Bioeng. 1998; 1: 285-298Google Scholar) and as a model system for mechanistic studies (2Pollegioni L. Blodig W. Ghisla S. J. Biol. Chem. 1997; 272: 4924-4934Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). In contrast to the well known pig kidney DAAO (3Curti B. Ronchi S. Pilone Simonetta M. Muller F. Chemistry and Biochemistry of Flavoenzymes. CRC Press, Boca Raton, FL1992: 69-94Google Scholar), the enzyme from R. gracilis is characterized by a comparatively much higher turnover number, good stability under a wide range of reaction conditions, and an active site sufficiently large to accommodate different substrates, even of considerable size (4Pollegioni L. Falbo A. Pilone M.S. Biochim. Biophys. Acta. 1992; 1120: 11-16Crossref PubMed Scopus (78) Google Scholar, 5Pollegioni L. Langkau B. Tischer W. Ghisla S. Pilone M.S. J. Biol. Chem. 1993; 268: 13850-13857Abstract Full Text PDF PubMed Google Scholar). Due to these properties, we have utilized the yeast enzyme for the oxidation of cephalosporin C in the two-step formation of 7-aminocephalosporanic acid (6Pilone M.S. Butò S. Pollegioni L. Biotechnol. Lett. 1995; 17: 199-204Crossref Scopus (42) Google Scholar) and for a human gene therapy paradigm that involves oxidant-mediated tumor cell death (7Stegman L.D. Zheng H. Neal E.R. Ben-Yoseph O. Pollegioni L. Pilone M.S. Ross B.D. Hum. Gene Ther. 1998; 9: 185-193Crossref PubMed Scopus (68) Google Scholar). DAAO catalyzes the oxidation of d-amino acids to α-keto acids and ammonia with concomitant reduction of molecular oxygen to hydrogen peroxide. In the reductive half-reaction, the amino acid substrate reduces the enzyme-bound FAD cofactor producing reduced flavin and the imino acid. In the oxidative half-reaction, the reduced FAD·imino acid complex reacts with molecular oxygen to form oxidized FAD·imino acid. The catalytic cycle is completed when the imino acid dissociates from the re-oxidized enzyme. Solvolysis of the initial imino acid product rapidly yields the corresponding α-keto acid and ammonia. The enzyme has a broad substrate specificity, utilizing all of the naturally occurring amino acids efficiently, with the only exceptions being aspartate and glutamate (3Curti B. Ronchi S. Pilone Simonetta M. Muller F. Chemistry and Biochemistry of Flavoenzymes. CRC Press, Boca Raton, FL1992: 69-94Google Scholar, 4Pollegioni L. Falbo A. Pilone M.S. Biochim. Biophys. Acta. 1992; 1120: 11-16Crossref PubMed Scopus (78) Google Scholar). RgDAAO belongs to the large class of flavoprotein oxidases that catalyze the oxidation of amino or α-hydroxy acids. A fundamental question remains within this class of enzymes regarding the mechanism by which a proton and two electrons are transferred from the substrate to the flavin N-5 position during the reductive half-reaction. Substrate oxidation could be accomplished by hydride transfer from the α-carbon to the flavin N-5. Whereas hydride transfer certainly requires stringent orientation of the substrate and flavin cofactor, there is no theoretical argument against it (8Miura R. Miyake Y. Bioorg. Chem. 1988; 16: 97-110Crossref Scopus (30) Google Scholar). A carbanion mechanism has been proposed in which an enzyme base removes the α-proton (or possibly the amino proton) and so forms a carbanion intermediate (9Walsh C.T. Schonbrunn A. Abeles R. J. Biol. Chem. 1971; 248: 6855-6866Google Scholar) (see also Ref. 10Mattevi A. Vanoni M.A. Curti B. Curr. Opin. Struct. Biol. 1997; 7: 804-810Crossref PubMed Scopus (31) Google Scholar for a recent review). The resulting unstable carbanion would rapidly attack the N-5 locus of the flavin. Subsequent rapid rearrangement would result in reduced flavin and iminopyruvate. The most convincing evidence in favor of a carbanion mechanism is the observation of β-elimination when β-chloroalanine was used as the substrate of pig kidney DAAO (9Walsh C.T. Schonbrunn A. Abeles R. J. Biol. Chem. 1971; 248: 6855-6866Google Scholar). Deprotonation of the α-hydrogen of amino acids is highly unfavorable in aqueous solution. Thus, in order for an enzyme to deprotonate the α-proton, it must have some highly specific means of removing the proton and stabilizing the resulting carbanion. Hence, the presence of an enzyme base for α-proton abstraction is essential for the carbanion mechanism. In order to determine the mechanism of substrate dehydrogenation, we are currently studying the active site of RgDAAO using different experimental approaches. Site-directed mutagenesis of pig kidney DAAO (11Pollegioni L. Fukui K. Massey V. J. Biol. Chem. 1994; 269: 31666-31673Abstract Full Text PDF PubMed Google Scholar) and inspection of its three-dimensional structure (12Mattevi A. Vanoni M.A. Todone F. Rizzi M. Teplyakov A. Coda A. Bolognesi M. Curti B. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 7496-7501Crossref PubMed Scopus (281) Google Scholar, 13Mizutani H. Miyahara I. Hirotsu K. Nishina Y. Shiga K. Setoyama C. Miura R. J. Biochem. (Tokyo). 1996; 120: 14-17Crossref PubMed Scopus (125) Google Scholar) have demonstrated that there is no essential base in the vicinity of the flavin N-5. Arg-285, Tyr-238, and Tyr-223 are the only residues conserved in the amino acid sequence of DAAOs from pig, R. gracilis, and Trigonopsis variabilis (14Faotto L. Pollegioni L. Ceciliani F. Ronchi S. Pilone M.S. Biotechnol. Lett. 1995; 17: 193-198Crossref Scopus (47) Google Scholar). Mutagenesis of Tyr-238 is in progress and that of Arg-285 has shown this residue not to be essential for catalysis, 2L. Pollegioni, personal communication. and the study of Tyr-223 has been now completed. In this paper we report the production and characterization of Y223F and Y223S mutants of RgDAAO. The clarification of the role of the active-site residues of RgDAAO and the resolution of the three-dimensional structure are prerequisite for the identification of the molecular basis of the kinetics, higher catalytic efficiency, substrate specificity, and flavin binding properties that differentiate RgDAAO from the mammalian enzyme. Site-directed mutagenesis has a second application with regard to the use of RgDAAO as a biocatalyst (for a review see Ref. 1Pilone M.S. Pollegioni L. Recent Res. Dev. Biotechnol. Bioeng. 1998; 1: 285-298Google Scholar). Engineering of the substrate specificity and affinity of this enzyme could have relevant applications both in bioconversions and in gene therapy (the latter requiring an enzyme form with higher affinity for the d-amino acid and oxygen). Restriction enzymes and T4 DNA ligase were from Roche Molecular Biochemicals. FlexiPrep™ Kit and Sephaglass BandPrep™ Kit were from Amersham Pharmacia Biotech. Site-directed mutagenesis reactions were made using the Altered Sites™ II Kit (Promega). CF3-alanine was from ABCR GmbH.d-Amino acids, xanthine, xanthine oxidase, and all other compounds were purchased from Sigma. 5-Deazaflavin was a generous gift of Dr. Sandro Ghisla (University of Konstanz, Germany). All experiments were performed in 50 mm sodium pyrophosphate, pH 8.5, 1% glycerol, 0.3 mm EDTA, and 0.5 mm2-mercaptoethanol and at 25 °C, except where stated otherwise. The RgDAAO-Y223F mutant was generated by site-directed mutagenesis using the Altered Sites™ II Kit; the cDNA coding for the wild-type RgDAAO was subcloned in theEcoRI pALTER-1™ vector. The plasmid was then purified as single strand DNA by phage infection (as described in the Promega protocol) and used as a template for the in vitromutagenesis reactions. The mutant was generated using a dual primer method to introduce simultaneously a site-directed mutation (Y223F2, CCCGCTTCTCCCGCATTCATCATTCCCCGA, the codon for phenylalanine is underlined) and ampicillin resistance. In vitro mutagenesis reaction products were used to transform competent Escherichia coli ES1301 mutS cells and finallyE. coli JM109 cells (15Sambrook J. Fritsch E.P. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar). Successful mutagenesis was screened for the insertion of a new BsmI site (GAAT(G/C)N) by restriction analysis and confirmed by DNA sequencing. The Y223S mutant was generated by mutagenic polymerase chain reaction. The plasmid pCRII-DAAOwt carrying the wild-type RgDAAO cDNA (16Pollegioni L. Molla G. Campaner S. Martegani E. Pilone M.S. J. Biotechnol. 1997; 58: 115-123Crossref PubMed Scopus (43) Google Scholar) was used as the template in the amplification reactions. The DNA was amplified using the Y223S upstream primer (CAATCCGCGGGCAAACCGTCCTCGTCAAGTCCCCATGCAAGCGATGCACGATGGACTCGTCCGACCCCGCTTCTCCCGCCTCCATCATTC, the codon for serine is underlined), which carried the punctiform mutation, and the 3′ downstream primer (CTTGTAGATGCCCGCAATACAG). The latter was designed to anneal after the poly(A) tail of the cDNA. The amplification product was cloned into the pCRII vector (Invitrogen) and sequenced to confirm the presence of the desired mutation. A cassette (SacII and HindIII) containing the mutant Y223S was exchanged with the corresponding fragment of pKK-DAAO plasmid (16Pollegioni L. Molla G. Campaner S. Martegani E. Pilone M.S. J. Biotechnol. 1997; 58: 115-123Crossref PubMed Scopus (43) Google Scholar). The complete RgDAAO-Y223S and RgDAAO-Y223F cDNAs were subcloned into the EcoRI site of the pT7.7A expression vector (U. S. Biochemical Corp.), and the mutated region was sequenced again. The new expression plasmids were designated pT7-Y223S and pT7-Y223F and were used to transform E. coli BL21(DE3) and BL21(DE3)pLysS cells (Novagen Inc.). During purification, DAAO activity was assayed with an oxygen electrode at pH 8.5 and 25 °C with 28 mmd-alanine as substrate (4Pollegioni L. Falbo A. Pilone M.S. Biochim. Biophys. Acta. 1992; 1120: 11-16Crossref PubMed Scopus (78) Google Scholar). One DAAO unit is defined as the amount of enzyme that converts 1 μmol of d-alanine per min, at 25 °C. Analytical SDS-polyacrylamide gel electrophoresis was carried out as described by Laemmli (17Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207537) Google Scholar). The Y223S and Y223F RgDAAO mutants were expressed in E. coli using the recently developed pT7-DAAO expression system in BL21(DE3)pLysS E. coli cells (18Molla G. Vegezzi C. Pilone M.S. Pollegioni L. Protein Expression Purif. 1998; 14: 289-294Crossref PubMed Scopus (65) Google Scholar). A fermentor (PPS-3, Bioindustrie Mantovane) containing 10 liters of Luria Bertani medium, 100 μg/ml ampicillin, and 34 μg/ml chloramphenicol was inoculated with 500 ml of an overnight culture of pT7-Y223S or pT7-Y223F expression system (A 600 = 3.2). Cells were grown at 37 °C for 2.5 h (A 600 = 1.0) and then induced with 0.6 mm isopropyl-d-thiogalactopyranoside (final concentration). Induced cells were grown at 30 °C for 21 h and then harvested by centrifugation and stored at −20 °C. Purification of both Y223F and Y223S mutants was performed by the identical procedure as for recombinant wild-type RgDAAO (18Molla G. Vegezzi C. Pilone M.S. Pollegioni L. Protein Expression Purif. 1998; 14: 289-294Crossref PubMed Scopus (65) Google Scholar). The extinction coefficients for the mutant DAAO enzymes were determined by measuring the change in absorbance after release of the flavin. The enzymes were heat-denatured by boiling for 5 min in the dark; an extinction coefficient of 11,300m−1 cm−1 at 450 nm for free FAD was used. An anaerobic cuvette containing 7.5 μm enzyme, 5 mm EDTA, and 0.5 μm 5-deazaflavin was made anaerobic and photoreduced with a 250-watt lamp, with the cuvette immersed in a 0 °C water bath. Progress of the reaction was followed spectrophotometrically. When the semiquinone peak at 370 nm reached its maximal value, 15 min irradiation, 5 μm benzyl viologen was added from a side arm of the cuvette, and the absorbance changes were followed for up to 24 h at 15 °C. Redox potentials for theEFlox/EFlseq andEFlseq/EFlred couples (where EFlox is oxidized enzyme; EFlseq is enzyme flavin semiquinone; andE red and EFlred, reduced enzymes) of Y223F and Y223S mutants were determined by the method of dye equilibration (19Minnaert K. Biochim. Biophys. Acta. 1965; 110: 42-56Crossref PubMed Google Scholar) using the xanthine/xanthine oxidase (XO) reduction system, at 15 °C (20Massey V. Curti B. Ronchi S. Zanetti G. Flavins and Flavoproteins. Walter de Gruyter & Co., Berlin1991: 59-66Google Scholar). An anaerobic cuvette containing 7 μm enzyme, 0.2 mm xanthine, 5 μm benzyl viologen, and 1–10 μm of the appropriate dye was purged of oxygen, and the reaction was initiated by addition of 10 nm XO. The reaction was measured spectrophotometrically until completion, typically 3–4 h. Data were analyzed as described by Minnaert (19Minnaert K. Biochim. Biophys. Acta. 1965; 110: 42-56Crossref PubMed Google Scholar). The amount of oxidized and reduced dye was determined at a wavelength where the enzyme has no absorbance (>550 nm), and the amount of oxidized and reduced enzyme was determined at an isosbestic point for the dye or by subtraction of the dye's contribution in the 400–470 nm region. Dissociation constants for ligands were measured spectrophotometrically by addition of small volumes (1–10 μl) of concentrated stock solutions to samples containing 1 ml of 7–11 μm enzyme, at 15 °C. The change in absorbance upon adding ligand was plotted as a function of ligand concentration, after correction for any volume change. Wavelengths used for the ligands are 497 nm for sodium benzoate and sodium crotonate, 456 nm for sodium sulfite, 540 nm for sodium anthranilate, and 485 nm for CF3-alanine. Specificity for l-amino acids was checked by following the change in the absorbance spectrum after anaerobic addition of the amino acid to the enzyme solution. The experiments were performed at 25 °C in a thermostatted stopped-flow spectrophotometer with a 2-cm path length cell and that is equipped with a diode array detector as described previously (2Pollegioni L. Blodig W. Ghisla S. J. Biol. Chem. 1997; 272: 4924-4934Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). Steady-state kinetic analysis was performed by the method of enzyme-monitored turnover by mixing air-saturated enzyme, 10 μm (final concentration), with air-saturated solutions of d-alanine at 25 °C. Traces at 456 nm were analyzed as described previously (21Gibson Q.H. Swoboda B.E.P. Massey V. J. Biol. Chem. 1964; 259: 3927-3934Abstract Full Text PDF Google Scholar) using the Kaleidagraph program (Synergy Software). The ternary complex mechanism shown in the inner loop of Scheme 1 can be described using the conventions of Dalziel (22Dalziel K. Biochem. J. 1969; 114: 547-556Crossref PubMed Scopus (95) Google Scholar) as shown in Equations 1 and 2. et/v=Φ0+ΦAA/[AA]+ΦO2/[O2]+ΦAAO2/[AA][O2](Eq. 1) where (AA indicates d-amino acid) kcat=1/Φ0;Km(DAla)=ΦAA/Φ0;Km,O2=ΦO2/Φ0etv=k2+k4k2·k4+k−1+k2k1·k2[AA]+k2+k−2k2·k3[O2]+k−1+k−2k1·k2·k3[AA][O2](Eq. 2) For reductive half-reaction experiments, the stopped-flow instrument was made anaerobic by overnight equilibration with concentrated sodium dithionite solutions. Prior to use, the instrument was well rinsed with nitrogen-bubbled buffer to remove the dithionite. The reaction was followed by taking spectra with a diode array detector from 3 ms until completion. Reaction rates were calculated by extracting traces at individual wavelengths (456 and 530 nm) and fitting them to a sum of exponentials equation using Program A (developed in the laboratory of Dr. David P. Ballou at the University of Michigan). Subsequent analysis of k obs values determined with Program A were fit by non-linear least means squares procedures with Kaleidagraph. Unlike the wild-type RgDAAO, formation of the E red·IA complex for study of the oxidative half-reaction could not be obtained by addition of stoichiometricd-alanine in the presence of pyruvate and ammonia. Instead the xanthine/XO system was used. A tonometer with an anaerobic cuvette was loaded with a 4.5-ml solution containing 16–18 μmmutant DAAO in buffer A (50 mm sodium pyrophosphate, pH 8.5, 1% glycerol, 20 mm sodium pyruvate and 0.4m ammonium chloride), 84 nm XO, 4 μm methyl viologen, and 9 μm cresyl violet (for Y223F-DAAO) or 4 μm benzyl viologen and 1.3 μm indigo disulfonate (for Y223S-DAAO). The sample was made anaerobic, and enzyme reduction was initiated by addition of 400 μm xanthine. The sample required about 2 h for full reduction. The pre-reduced enzyme was loaded onto the stopped-flow instrument under anaerobic conditions. It was then reacted with solutions of buffer A that had been bubbled at 25 °C with air, commercially available N2/O2 mixtures (90/10, 50/50), or pure oxygen. Data were collected and analyzed as described for the reductive half-reaction. The pT7-Y223F and pT7-Y223S plasmids were used to transform BL21(DE3) and BL21(DE3)pLysSE. coli cells, and the induction conditions were investigated with both expression systems by Western blot analysis and DAAO activity assay. Analogously to the wild-type RgDAAO (18Molla G. Vegezzi C. Pilone M.S. Pollegioni L. Protein Expression Purif. 1998; 14: 289-294Crossref PubMed Scopus (65) Google Scholar), the highest level of DAAO expression and DAAO specific activity was obtained when the BL21(DE3) E. coli carried the pLysS plasmid (8.7 units/mg protein and 0.07 units/mg protein for the Y223F and Y223S mutants, respectively), inducing the cells with 0.6 mm isopropyl-d-thiogalactopyranoside at saturation (A 600 ≥ 2.0) and growing at 30 °C for additional 3–24 h. Typically 45–75 mg of pure enzyme was isolated from 10 liters of bacterial growth of Y223S or Y223F, compared with 180 mg for wild-type DAAO (18Molla G. Vegezzi C. Pilone M.S. Pollegioni L. Protein Expression Purif. 1998; 14: 289-294Crossref PubMed Scopus (65) Google Scholar). Both Y223F and Y223S mutations yielded well behaved enzymes that retained their FAD prosthetic group and that were stable when stored at −20 °C for several months. Visible spectra of Y223F and Y223S enzymes are shown in Fig. 1 in comparison to the wild-type RgDAAO. Both mutants, in their oxidized state, show an extinction coefficient at 455 nm of 12750 m−1 cm−1 and a ratio of A 274/A 455 ≈ 8.7. Anaerobic addition of an excess of d-alanine (Fig. 1) resulted in instantaneous enzyme reduction of both mutant DAAOs, with a spectrum like that of the wild type. The amount of semiquinone form stabilized by each mutant was determined by anaerobic photoreduction (23Massey V. Hemmerich P. Biochemistry. 1978; 17: 9-16Crossref PubMed Scopus (293) Google Scholar) until the spectrum of the flavin semiquinone (EFlseq) reached a maximum (Fig. 1); this species represents near-complete formation ofEFlseq (≈ 95%). The maximal semiquinone formed by photoreduction is a kinetically stabilized species. Anaerobic addition of benzyl viologen resulted in dismutation ofEFlseq to the oxidized and reduced forms over a period of 15 min with the end point containing the thermodynamically stabilized amount of semiquinone. Y223F and Y223S enzymes stabilized 60 and 63%, respectively, of the red, anionic flavin semiquinone, compared with 65% for the wild type (Table I). Stabilization of the anionic semiquinone is typical for d-amino-acid oxidases and for the family of flavoprotein oxidases (24Massey V. Gibson Q.H. Fed. Proc. U. S. A. 1964; 23: 18-29Google Scholar).Table ISemiquinone formation and stabilization and redox potentials of wild-type, Y223F, and Y223S d-amino-acid oxidasesSemiquinone measuredE 0′1E 0′2E mKinetically stabilizedThermodynamically stabilized%mVWild-type≥9565−60aThe redox potentials were measured at pH 8.5 and 15 °C using methylene blue (−29 mV) as redox standards, and xanthine/xanthine oxidase as the source of reducing equivalents (20).−200bThe redox potentials were measured at pH 8.5 and 15 °C using indigo disulfonate (−159 mV) as redox standards, and xanthine/xanthine oxidase as the source of reducing equivalents (20).−130Y223S≥9560−36aThe redox potentials were measured at pH 8.5 and 15 °C using methylene blue (−29 mV) as redox standards, and xanthine/xanthine oxidase as the source of reducing equivalents (20).−170bThe redox potentials were measured at pH 8.5 and 15 °C using indigo disulfonate (−159 mV) as redox standards, and xanthine/xanthine oxidase as the source of reducing equivalents (20).−103Y223F9063−59aThe redox potentials were measured at pH 8.5 and 15 °C using methylene blue (−29 mV) as redox standards, and xanthine/xanthine oxidase as the source of reducing equivalents (20).−203cThe redox potentials were measured at pH 8.5 and 15 °C using cresyl violet (−197 mV) as redox standards, and xanthine/xanthine oxidase as the source of reducing equivalents (20).−131a The redox potentials were measured at pH 8.5 and 15 °C using methylene blue (−29 mV) as redox standards, and xanthine/xanthine oxidase as the source of reducing equivalents (20Massey V. Curti B. Ronchi S. Zanetti G. Flavins and Flavoproteins. Walter de Gruyter & Co., Berlin1991: 59-66Google Scholar).b The redox potentials were measured at pH 8.5 and 15 °C using indigo disulfonate (−159 mV) as redox standards, and xanthine/xanthine oxidase as the source of reducing equivalents (20Massey V. Curti B. Ronchi S. Zanetti G. Flavins and Flavoproteins. Walter de Gruyter & Co., Berlin1991: 59-66Google Scholar).c The redox potentials were measured at pH 8.5 and 15 °C using cresyl violet (−197 mV) as redox standards, and xanthine/xanthine oxidase as the source of reducing equivalents (20Massey V. Curti B. Ronchi S. Zanetti G. Flavins and Flavoproteins. Walter de Gruyter & Co., Berlin1991: 59-66Google Scholar). Open table in a new tab In order to assess changes in the thermodynamic properties of the flavin center caused by mutation at Tyr-223, the redox potentials of the enzymes were measured by the dye equilibration method of Minnaert (19Minnaert K. Biochim. Biophys. Acta. 1965; 110: 42-56Crossref PubMed Google Scholar) using the xanthine/XO reduction system (20Massey V. Curti B. Ronchi S. Zanetti G. Flavins and Flavoproteins. Walter de Gruyter & Co., Berlin1991: 59-66Google Scholar). A representative experiment is shown in Fig. 2 in which the potential of theEFlox/EFlseq couple of Y223F was measured in reference to methylene blue. A replot (Fig. 2,inset) of the log (oxidized/reduced) methylene blue as a function of log (oxidized/semiquinone) flavin species gives the potential of theEFlox/EFlseq couple when the potential of the indicator is known (19Minnaert K. Biochim. Biophys. Acta. 1965; 110: 42-56Crossref PubMed Google Scholar). The line plotted in theinset of Fig. 2 has a slope of 1.96 in excellent agreement with the theoretical value of 2 expected for a 2- to 1-electron couple. Decreasing the concentration of XO, and thus slowing the rate at which the reaction proceeds, had no effect on the potentials measured. In the case of Y223F, the potentials of both couples are identical to those of the wild-type enzyme, whereas the Y223S mutant has potentials each about 25 mV more positive than the wild type (Table I). This change in the Y223S potentials should have little influence on catalysis because the FAD midpoint potential of −103 mV makes enzyme reduction byd-alanine (rate-limiting for wild-type enzyme) slightly more thermodynamically favorable; retardation of the oxidative half-reaction is not an issue because the O2/H2O2 couple is so much more positive (+ 300 mV at pH 7) than the FAD/FADH2 couple. Y223F and Y223S mutations had no significant effect on the redox potentials of the enzyme-bound FAD. Dissociation constants for several ligands were measured in order to determine the contribution of residue Tyr-223 to substrate binding. In each case, binding was measured by the perturbation of the visible spectrum of the FAD upon formation of the bound complex (not shown), and with all the compounds tested and for both Y223F and Y223S mutants, the spectral modifications were identical to those observed for the binding to the wild-type DAAO. Only modest effects of 5–7-fold weakening in binding was observed for both mutants with the ligands CF3-alanine, benzoate and sulfite (Table II). CF3-alanine is not a substrate for the enzyme, as determined by anaerobic addition of the compound to the enzyme (not shown).Table IIBinding of aromatic and aliphatic competitive inhibitors, CF 3 -d-alanine, and sulfite to wild-type, Y223F, and Y223S d-amino acid oxidasesCompoundK dWild typeY223SY223FmmBenzoate0.95.06.4Anthranilate1.92.544Crotonate0.47.05.3CF3-d-alanine6.72936Sulfite0.120.660.85 Open table in a new tab The higher K d for sulfite parallels the results obtained with CF3-alanine and is somewhat surprising due to the modest changes in redox potentials of the mutants (see Table I). Binding of crotonate and anthranilate to the mutants was more substantially reduced (up to 23-fold higher K d for anthranilate observed with the Y223F-DAAO), but these compounds have little structural resemblance to amino acid substrates. Both mutants maintain the stereospecificity of the wild-type RgDAAO; they are not reduced by l-alanine and l-valine under anaerobic conditions. The ability of the Y223F and Y223S mutants to catalyze d-alanine/oxygen catalysis was measured by enzyme-monitored turnover. Air-saturated solutions of enzyme and ofd-alanine were mixed in the stopped-flow spectrophotometer, and the absorbance spectra were recorded continuously in the 350–650 nm wavelength range at 25 °C. Following the absorbance at 456 nm, an initial rapid decrease of the oxidized flavin absorption was observed, followed by a steady-state phase, and then by a further decrease to reach the final reduced state. This confirms that both the Y223F and Y223S mutants are competent catalysts (Fig. 3). With Y223F and Y223S mutants, as well as for the wild-type DAAO, the enzyme is largely present in the oxidized form during turnover. This indicates that the overall process of reoxidation of reduced DAAO with oxygen is faster than the reductive half-reaction. Although the steady-state phase is quite short, the Lineweaver-Burk plots of d-alanine/oxygen turnover (as well as with d-valine) show a set of converging lines with both DAAO mutants (shown only for Y223S with d-alanine,inset of Fig. 3), consistent with a ternary complex mechanism. For wild-type DAAO with d-alanine as substrate, a parallel line pattern in the secondary plots was instead found (5Pollegioni L. Langkau B. Tischer W. Ghisla S. Pilone M.S. J. Biol. Chem. 1993; 268: 13850-13857Abstract Full Text PDF PubMed Google Scholar), consistent with a limiting case of a ternary complex mechanism where some specific rate constants (i.e. k −2, the reverse of the reduction rate) are sufficiently small. For Y223F, k cat is only reduced by about one-third, and the K m ford-alanine and O2 are essentially unchanged. For Y223S, k cat is reduced about 80-fold,K m for d-alanine is increased 2-fold, and K m for oxygen is decreased 15-fold (Table III). The drastic change in kinetic parameters of Y223S with d-alanine was confirmed by studying the reaction of Y223S using d-valine as substrate (Table III).Table IIIComparison of the steady-state coefficients for wild-type, Y223F, and Y223S d-amino-acid oxidases with d-alanine andd-valine as substrates, at pH 8.5 and 25 °Cd-Alanined-Valinek cat (s−1)Wild typeaWild-type enzyme data are from Pollegioni et al. (5), determined in 60 mm sodium pyrophosphate buffer, pH 8.5, containing 1.5% glycerol, 0.3 mm EDTA, and 0.75 mm 2-mercaptoethanol, at 25 °C.350 (≈k 2)29Y223S4.2 (≈k 4)2.8Y223F210Not determined1/ΦAA (m−1s−1)Wild typeaWild-type enzyme da
Referência(s)