The MER3 Helicase Involved in Meiotic Crossing Over Is Stimulated by Single-stranded DNA-binding Proteins and Unwinds DNA in the 3′ to 5′ Direction
2001; Elsevier BV; Volume: 276; Issue: 34 Linguagem: Inglês
10.1074/jbc.m104003200
ISSN1083-351X
AutoresTakuro Nakagawa, Hernan Flores‐Rozas, Richard D. Kolodner,
Tópico(s)Bacterial Genetics and Biotechnology
ResumoThe meiosis-specific MER3 protein ofSaccharomyces cerevisiae is required for crossing over, which ensures faithful segregation of homologous chromosomes at the first meiotic division. The predicted sequence of the MER3 protein contains the seven motifs characteristic of the DExH-box type of DNA/RNA helicases. The purified MER3 protein is a DNA helicase, which can displace a 50-nucleotide fragment annealed to a single-stranded circular DNA. MER3 was found to have ATPase activity, which was stimulated either by single- or double-stranded DNA. The turnover rate,kcat, of ATP hydrolysis was ∼500/min in the presence of either DNA. MER3 was able to efficiently displace relatively long 631-nucleotide fragments from single-stranded circular DNA only in the presence of the S. cerevisiaesingle-stranded DNA-binding protein, RPA (replication protein A). It appears that RPA inhibits re-annealing of the single-stranded products of the MER3 helicase. The MER3 helicase was found to unwind DNA in the 3′ to 5′ direction relative to single-stranded regions in the DNA substrates. Possible roles for the MER3 helicase in meiotic crossing over are discussed. The meiosis-specific MER3 protein ofSaccharomyces cerevisiae is required for crossing over, which ensures faithful segregation of homologous chromosomes at the first meiotic division. The predicted sequence of the MER3 protein contains the seven motifs characteristic of the DExH-box type of DNA/RNA helicases. The purified MER3 protein is a DNA helicase, which can displace a 50-nucleotide fragment annealed to a single-stranded circular DNA. MER3 was found to have ATPase activity, which was stimulated either by single- or double-stranded DNA. The turnover rate,kcat, of ATP hydrolysis was ∼500/min in the presence of either DNA. MER3 was able to efficiently displace relatively long 631-nucleotide fragments from single-stranded circular DNA only in the presence of the S. cerevisiaesingle-stranded DNA-binding protein, RPA (replication protein A). It appears that RPA inhibits re-annealing of the single-stranded products of the MER3 helicase. The MER3 helicase was found to unwind DNA in the 3′ to 5′ direction relative to single-stranded regions in the DNA substrates. Possible roles for the MER3 helicase in meiotic crossing over are discussed. double strand break nucleotide(s) kilobase pair(s) Bloom syndrome replication protein A single-stranded DNA-binding protein polymerase chain reaction During meiosis, two successive rounds of chromosome segregation occur following a single round of DNA replication. The first meiotic division, meiosis I, is unique in that homologous chromosomes synapse and then segregate to opposite poles. Crossing over, but not gene conversion, provides a physical connection between homologous chromosomes and ensures their proper segregation at meiosis I (for review, see Refs. 1Roeder G.S. Genes Dev. 1997; 11: 2600-2621Crossref PubMed Scopus (689) Google Scholar and 2Kleckner N. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 8167-8174Crossref PubMed Scopus (357) Google Scholar). The distribution of crossovers along a chromosome is regulated. When multiple crossovers occur on a chromosome, they are further apart than predicted from the frequency of individual crossovers, a phenomenon called crossover interference. This regulation takes place so that every pair of homologous chromosomes sustains at least one crossover, and it underscores the importance of crossing over for faithful segregation of chromosomes. An extensive body of evidence has accumulated indicating that crossing over is under the control of a specific set of proteins that are required for crossing over but not gene conversion (3Sym M. Roeder G.S. Cell. 1994; 79: 283-292Abstract Full Text PDF PubMed Scopus (235) Google Scholar, 4Ross-Macdonald P. Roeder G.S. Cell. 1994; 79: 1069-1080Abstract Full Text PDF PubMed Scopus (324) Google Scholar, 5Hollingsworth N.M. Ponte L. Halsey C. Genes Dev. 1995; 9: 1728-1739Crossref PubMed Scopus (333) Google Scholar, 6Hunter N. Borts R.H. Genes Dev. 1997; 11: 1573-1582Crossref PubMed Scopus (200) Google Scholar, 7Chua P.R. Roeder G.S. Cell. 1998; 93: 349-359Abstract Full Text Full Text PDF PubMed Scopus (187) Google Scholar, 8Nakagawa T. Ogawa H. EMBO J. 1999; 18: 5714-5723Crossref PubMed Scopus (113) Google Scholar, 9Wang T.F. Kleckner N. Hunter N. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 13914-13919Crossref PubMed Scopus (239) Google Scholar, 10Tsubouchi H. Ogawa H. Mol. Biol. Cell. 2000; 11: 2221-2233Crossref PubMed Scopus (177) Google Scholar, 11Kirkpatrick D.T. Ferguson J.R. Petes T.D. Symington L.S. Genetics. 2000; 156: 1549-1557PubMed Google Scholar). The initiation of meiotic recombination involves the programmed induction of DNA double strand breaks (DSBs)1 (12Cao L. Alani E. Kleckner N. Cell. 1990; 61: 1089-1101Abstract Full Text PDF PubMed Scopus (536) Google Scholar). The ends of DSBs are rapidly resected to produce 3′-overhangs of about 600 nucleotides (nt) long (13Bishop D.K. Park D. Xu L. Kleckner N. Cell. 1992; 69: 439-456Abstract Full Text PDF PubMed Scopus (977) Google Scholar). The 3′-single strands then participate in strand invasion reactions catalyzed by protein complexes containing RAD51 (14Shinohara A. Ogawa H. Ogawa T. Cell. 1992; 69: 457-470Abstract Full Text PDF PubMed Scopus (1052) Google Scholar, 15Sung P. Science. 1994; 265: 1241-1243Crossref PubMed Scopus (754) Google Scholar) and/or DMC1 (13Bishop D.K. Park D. Xu L. Kleckner N. Cell. 1992; 69: 439-456Abstract Full Text PDF PubMed Scopus (977) Google Scholar, 16Li Z. Golub E.I. Gupta R. Radding C.M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 11221-11226Crossref PubMed Scopus (128) Google Scholar), the yeast counterparts of theEscherichia coli strand exchange protein, RecA (17Friedberg E.C. Walker G.C. Siede W. DNA Repair and Mutagenesis. American Society for Microbiology Press, Washington, D. C.1995: 407-464Google Scholar). Double-Holliday junctions are the prominent intermediates formed during homologous recombination initiating from DSBs (18Schwacha A. Kleckner N. Cell. 1994; 76: 51-63Abstract Full Text PDF PubMed Scopus (282) Google Scholar, 19Szostak J.W. Orr-Weaver T.L. Rothstein R.J. Stahl F.W. Cell. 1983; 33: 25-35Abstract Full Text PDF PubMed Scopus (1755) Google Scholar, 20Paques F. Haber J.E. Microbiol. Mol. Biol. Rev. 1999; 63: 349-404.7Crossref PubMed Google Scholar). It should be noted that both of the two 3′-single-strand ends originating from a single DSB must invade the same chromatid to form a double-Holliday junction. It is possible that the two different outcomes of recombination, crossing over and gene conversion, result from alternate resolutions of double-Holliday junctions. However, it is also possible that crossing over and gene conversion events are differentiated from each other before or during the formation of the joint molecules. The observation that mutations in the genes that are specifically required for crossing over show a defect in the transition from DSBs to the joint molecules supports this latter view (8Nakagawa T. Ogawa H. EMBO J. 1999; 18: 5714-5723Crossref PubMed Scopus (113) Google Scholar, 21Storlazzi A. Xu L. Schwacha A. Kleckner N. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9043-9048Crossref PubMed Scopus (129) Google Scholar). However, the determination of the stage at which recombination crossover control is imposed remains elusive. The MER3 gene of Saccharomyces cerevisiae is expressed only in meiosis (8Nakagawa T. Ogawa H. EMBO J. 1999; 18: 5714-5723Crossref PubMed Scopus (113) Google Scholar, 22Nakagawa T. Ogawa H. Genes Cells. 1997; 2: 65-79Crossref PubMed Scopus (39) Google Scholar). In the absence of MER3, the frequency of crossing over is reduced, and the distribution of crossovers along a chromosome is randomized because of an apparent defect in crossover interference. The predicted sequence of the MER3 protein contains the seven motifs characteristic of the DExH-box type of DNA/RNA helicases (23Gorbalenya A.E. Koonin E.V. Curr. Opin. Struct. Biol. 1993; 3: 419-429Crossref Scopus (1034) Google Scholar). Interestingly, the MER3 sequence shows significant homology to S. cerevisiae SGS1 (24Gangloff S. McDonald J.P. Bendixen C. Arthur L. Rothstein R. Mol. Cell. Biol. 1994; 14: 8391-8398Crossref PubMed Scopus (617) Google Scholar) andHomo sapiens BLM (25Ellis N.A. Groden J. Ye T.Z. Straughen J. Lennon D.J. Ciocci S. Proytcheva M. German J. Cell. 1995; 83: 655-666Abstract Full Text PDF PubMed Scopus (1211) Google Scholar) helicases, which are involved in DNA replication, recombination, and cell cycle regulation (26Watt P.M. Hickson I.D. Borts R.H. Louis E.J. Genetics. 1996; 144: 935-945Crossref PubMed Google Scholar, 27Myung K. Datta A. Chen C. Kolodner R.D. Nat. Genet. 2001; 27: 113-116Crossref PubMed Scopus (267) Google Scholar, 28Frei C. Gasser S.M. Genes Dev. 2000; 14: 81-96Crossref PubMed Google Scholar, 29Lee S.K. Johnson R.E., Yu, S.L. Prakash L. Prakash S. Science. 1999; 286: 2339-2342Crossref PubMed Scopus (126) Google Scholar, 30Wang W. Seki M. Narita Y. Sonoda E. Takeda S. Yamada K. Masuko T. Katada T. Enomoto T. EMBO J. 2000; 19: 3428-3435Crossref PubMed Scopus (126) Google Scholar, 31Liao S. Graham J. Yan H. Genes Dev. 2000; 14: 2570-2575Crossref PubMed Scopus (39) Google Scholar). Consistent with the presence of the helicase motifs, an initial study has demonstrated that the purified MER3 protein can displace 50-nt DNA fragments annealed to single-stranded circular DNA. 2T. Nakagawa and R. D. Kolodner, submitted for publication. The MER3 protein binds to both single- and double-stranded DNA, with a slight preference for single-stranded DNA. The mer3G166D mutation, which causes an amino acid substitution changing an invariable glycine to an aspartic acid in a putative nucleotide-binding domain of MER3, decreases crossing over and impairs crossover interference. The spore viability of the mer3GD mutant is also decreased, which is likely to be due to a high incidence of non-disjunction of homologous chromosomes at meiosis I. The mutant MER3GD protein is defective for DNA helicase activity but has DNA binding activity that is indistinguishable from that seen for wild-type MER3. These genetic and biochemical data suggest that the DNA helicase activity of MER3 is required for meiotic crossing over and, in turn, for faithful segregation of homologous chromosomes. To better understand the role of the MER3 protein in meiotic recombination, we have extensively characterized the ATPase and DNA helicase activity of MER3. The MER3 protein was found to have an ATPase activity that was stimulated by either poly(dA) or M13mp18 replicative form I (M13 RF) DNA. The MER3 protein could displace 50-, 100-, and 631-nt single strands from M13mp18 single-stranded DNA, although high concentrations of MER3 were required to displace the longer fragments. The displacement of 631-nt-long fragments was stimulated by either the single-stranded DNA-binding protein of S. cerevisiae, RPA (33Alani E. Thresher R. Griffith J.D. Kolodner R.D. J. Mol. Biol. 1992; 227: 54-71Crossref PubMed Scopus (151) Google Scholar), or that of E. coli, SSB (34McEntee K. Weinstock G.M. Lehman I.R. Proc. Natl. Acad. Sci. U. S. A. 1980; 77: 857-861Crossref PubMed Scopus (175) Google Scholar). These single-stranded DNA-binding proteins appear to stimulate the activity of MER3 by preventing the re-annealing of the DNA region once it is unwound by the MER3 helicase. The polarity of the MER3 helicase was determined to be 3′ to 5′ with regard to the single-stranded region present in the DNA substrates. Possible roles for a processive 3′ to 5′ DNA helicase like MER3 in crossover control are discussed. The MER3 and MER3G166D proteins tagged with a FLAG epitope at their C termini were over-expressed under the control of GAL10 promoter in yeast cells and were purified by binding to FLAG affinity gel (Sigma) followed by sequential chromatography on MonoQ HR5/5, HiTrap heparin, and MonoS HR5/5 (Amersham Pharmacia Biotech) columns as previously described.2 The final protein preparations were more than 98% pure MER3. The yeastRPA1 gene (yRPA1) was amplified using primers 10786 (5′-CGACCGCTCGAGACACCATGAGCAGTGTTCAACTTTCG-3′), 10787 (5′-GCTCCCAAGCTTAAGAGATGCTGAACCGCCC-3′), and pRPA1 (35Heyer W.D. Rao M.R. Erdile L.F. Kelly T.J. Kolodner R.D. EMBO J. 1990; 9: 2321-2329Crossref PubMed Scopus (157) Google Scholar) as template. The resulting PCR product of 2.0 kb was used to replace theXhoI to HindIII region of pRDK249 (2 µ,GAL10, amp r , URA3) (36Johnson A.W. Kolodner R.D. J. Biol. Chem. 1991; 266: 14046-14054Abstract Full Text PDF PubMed Google Scholar). TheEcoRV to HindIII region of this construct was then replaced by a 1.8-kb EcoRV-HindIII fragment derived from pRPA1 yielding plasmid pRDK273. yRPA2 was amplified using primers 10994 (5′-CGACCGCTCGAGACACCATGGCAAGTATGTATTAGTGCTAGG-3′), 10993 (5′-GCTCCCAAGCTTATGTACACCTAGAACCAGATAC-3′) and a clone containing the yRPA2 open reading frame isolated from a YEp213 yeast genomic library as the template. The PCR product of 1.3 kb was inserted between the XhoI and HindIII sites of plasmid pRDK249. A 2.0-kb BamHI-HindIII fragment from the pRDK249 derivative, which contained the GAL10 promoter andyRPA2, was introduced between the BamHI andHindIII sites of pRS425 (2 µ,amp r , LEU2) creating plasmid pRDK274.yRPA3 was amplified using primers 10788 (5′-CGACCGCTGCAGCTCGAGACACCATGGCCAGCGAAACACCAAG-3′), 10789 (5′-GGCCTTGGGCCCGCGGAAGGCGTTAAGGCAGC-3′), and a YEP213 yeast library-derived clone that contained the yRPA3 gene as template. The PCR product of 560 bp was cloned between thePstI and ApaI sites of pRS424 (2 µ,amp r , TRP1). A 750-bpBamHI-XhoI fragment from pRDK249, which contained the GAL10 promoter, was introduced upstream of theyRPA3 gene generating plasmid pRDK275. Correct clones were confirmed by DNA sequencing. The yRPA overexpressor strain (RDKY2275) was created by transforming plasmids pRDK273, pRDK274, and pRDK275 into yeast strain RDKY1293 (MATα, ura3–52, trp1, leu2Δ1, his3Δ200, pep4::HIS3, prb1Δ1.6R, can1, GAL). The overproducer strain was grown at 30 °C with vigorous shaking in 2 liters of Leu−Ura− Trp− minimal drop-out medium supplemented with 2% (w/v) raffinose. The expression fromGAL10 promoter was induced by the addition of a final concentration of 2% (w/v) galactose at anA 600 of 2.0 and incubation was continued until late log phase. Cells were collected by centrifugation and washed with ice-cold water followed by two washes with buffer A [25 mm Tris·HCl (pH 7.5), 1 mm EDTA, 0.01% Nonidet P-40, 10% glycerol, 1 mm dithiothreitol, 10 mm benzamidine, 1 µg/ml pepstatin A, 2 µmleupeptin, 1 µm aprotinin, and 0.1 mmphenylmethylsulfonyl fluoride). The wet cell pellet (22 g) was squirted into liquid nitrogen through a 60-ml syringe, and the frozen cell “noodles” were ground to a fine powder under liquid nitrogen in a motorized mortar grinder (Retsch). Purification was carried out at 4 °C based on a previously described procedure (33Alani E. Thresher R. Griffith J.D. Kolodner R.D. J. Mol. Biol. 1992; 227: 54-71Crossref PubMed Scopus (151) Google Scholar). The yeast powder was resuspended with buffer A containing 0.5 m NaCl. The crude cell lysate was centrifuged in a Sorvall SA600 rotor at 15,000 rpm for 60 min, and the cleared lysate (100 ml, 660 mg) was adjusted to 0.5 m NaCl and loaded onto an Affi-gel blue (Bio-Rad) column (1.8 cm2 × 7 cm). The column was washed with 120 ml of buffer A containing 0.8 m NaCl, and the protein was eluted with 120 ml of buffer A containing 2.5 mNaCl and 40% (w/v) ethylene glycol. Peak fractions were pooled (40 ml, 95.8 mg), diluted to a conductivity equal to buffer A containing 0.5m NaCl, and loaded onto a single-stranded DNA cellulose column (3.1 cm2 × 8 cm). The column was then washed with 125 ml of buffer A containing 0.75 m NaCl, and the protein was eluted with 125 ml of buffer A containing 1.5 m NaCl and 50% ethylene glycol. Peak fractions were pooled (8 ml, 1.8 mg), dialyzed against 2 changes of 500 ml of buffer A containing 0.1m NaCl, and loaded onto a DEAE-Sepharose column (0.8 cm2 × 1.5 cm), and the protein was eluted with a linear gradient of 100–500 mm NaCl in buffer A. Peak fractions of RPA eluting at 200 mm NaCl were pooled and stored at −80 °C. Purity was similar to that observed previously (33Alani E. Thresher R. Griffith J.D. Kolodner R.D. J. Mol. Biol. 1992; 227: 54-71Crossref PubMed Scopus (151) Google Scholar). The yield was 0.6 mg/liter of cell culture. M13mp18 single-stranded circular and M13mp18 RF I were from New England Biolabs and Life Technologies, Inc., respectively. Poly(dA) and ATP were from Amersham Pharmacia Biotech.[γ-32P]ATP was from PerkinElmer Life Sciences. High pressure liquid chromatography-purified oligonucleotides were from CyberSyn, Inc. (Aston, PA). E. coli single-stranded DNA-binding protein (SSB) was from the United States Biochemical Corp. (Cleveland, OH). Reactions containing 20 mmTris·HCl (pH 7.6), 50 mm NaCl, 5 mmMgCl2, 2 mm dithiothreitol, 100 µg/ml bovine serum albumin, 0.05 Ci/ml [γ-32P]ATP, 1.5 µg/ml DNA, and 1 mm ATP (unless otherwise indicated) were pre-incubated at 30 °C for 5 min, and the reaction was initiated by the addition of 5 nm MER3 protein. For time course reactions, aliquots (5 µl) were withdrawn at the indicated time points and mixed with 2 µl of 0.2 m EDTA. 1 µl of each reaction was spotted onto polyethyleneimine cellulose thin layer chromatography plates (Sigma). The plates were developed in 1m formic acid, 0.5 m LiCl and dried, and the amounts of 32Pi and [γ-32P]ATP in the reaction mixture were determined using a PhosphorImager (445 SI, Molecular Dynamics). DNA helicase substrates were prepared essentially as described before (37Matson S.W. J. Biol. Chem. 1986; 261: 10169-10175Abstract Full Text PDF PubMed Google Scholar). An 0.6-kbClaI-BamHI fragment from M13mp18 RF I was introduced between the ClaI and BamHI sites of pBluescript II KS+ (Stratagene) to create pRDK4182. pRDK4182 was digested with ClaI, treated with calf alkaline phosphatase (New England Biolabs), purified using a PCR Purification Kit (Qiagen), and digested with BamHI, and then the resulting 0.6-kb ClaI-BamHI fragment was separated by electrophoresis through an 0.7% agarose gel and purified from the gel slice using a Gel Extraction Kit (Qiagen). The 0.6-kb Cla-BamHI fragment and the M13–100 oligonucleotide (100-nt), which is complementary to nucleotide coordinates 6230–6329 of M13mp18 single-stranded circular DNA, were 5′-end-labeled with [γ-32P]ATP using T4 polynucleotide kinase (New England Biolabs), and unincorporated nucleotides were removed using a Nucleotide Removal Kit (Qiagen). In separate reactions, each labeled DNA was mixed with an equal molar amount of M13mp18 single-stranded circular DNA in an annealing buffer (10 mm Tris·HCl (pH 7.6), 1 mm EDTA, 50 mm NaCl), heated to 95 °C for 10 min, and then slowly cooled to 25 °C in a PCR machine at a rate of temperature decrease of −1 °C/2 min. Each annealed DNA product was purified by electrophoresis through an 0.7% agarose gel as described above and then by chromatography through an 0.12 cm2 × 25 cm Bio-Gel A 5-m (Bio-Rad) column equilibrated and run in annealing buffer containing 100 mmNaCl. The DNA substrate containing the M13–50 oligonucleotide (50-nt) annealed to M13mp18 single-stranded circular DNA at nucleotides 6230–6279 were prepared as described previously.2 The concentration of the purified DNA was determined using a spectrophotometer (DU 640B, Beckman). To determine the polarity of translocation by the MER3 helicase, two kinds of DNA substrates were constructed using essentially the same methods as described above. To prepare the DNA substrate shown in Fig.6A, oligonucleotides T75 (5′-GACGCTGCCGAATTCTGGCTTGCTAGGACA-3′, 30-nt) and T82 (5′-CCCATAAACAAACTTCGTTAACTGAACTTGCCTGTACGATTCGTC-3′, 45-nt) were 5′-end-labeled with [γ-32P]ATP and then annealed to T81 (5′-GACGAATCGTACAGGCAAGTTCAGTTAACGAAGTTTGTTTATGGGTACTCTCGATAGTCTCTAGACAGCATGTCCTAGCAAGCCAGAATTCGGCAGCGTC, 100-nt). The annealed DNA was separated by 10% non-denaturing polyacrylamide gel electrophoresis (60:1 acrylamide/bisacrylamide) in TBE (90 mm Tris·borate, 2 mm EDTA). The DNA was recovered by soaking the excised band in elution buffer (0.5m NaCl, 0.6 m sodium acetate, 1 mmEDTA) overnight at 4 °C followed by phenol/chloroform extraction and ethanol precipitation. The recovered DNA pellet was dissolved in suspension buffer (10 mm Tris·HCl (pH 7.6), 250 mm NaCl). The concentration of purified DNA was determined using a DNA DipStick™ (Invitrogen). To prepare the DNA substrate shown in Fig. 6 D, the M13–100 oligonucleotide was 5′-end-labeled with [γ-32P]ATP and annealed to M13mp18 single-stranded circular DNA in extension buffer (40 mmTris·HCl (pH 7.6), 50 mm NaCl, 10 mmMgCl2, 1 mm dithiothreitol). The 3′-end of M13–100 was then labeled with [α-32P]dGTP using Klenow fragment (New England Biolabs). After removal of unincorporated nucleotides and digestion with HincII, the DNA substrate was purified using Bio-Gel A 5-m (Bio-Rad) as described above. The indicated amount of protein and DNA substrate (indicated concentrations are in moles of nucleotides) were incubated in 20-µl volumes containing DNA helicase buffer (20 mm Tris·HCl (pH 7.6), 50 mm NaCl, 2 mm dithiothreitol, 100 µg/ml bovine serum albumin, 2 mm MgCl2, 2 mm ATP) unless otherwise indicated. All reactions were pre-incubated at 30 °C for 5 min, started by the addition of MER3 protein, and then incubation was continued for 30 min. Reactions were stopped by the addition of 5 µl of stop buffer (50 mm Tris·HCl (pH 7.6), 50 mm EDTA, 2.5% SDS) and 0.5 µl of 25 mg/ml proteinase K followed by incubation at 37 °C for 10 min. The DNA products were analyzed by electrophoresis through non-denaturing polyacrylamide gels run in TBE. The gels were dried, and the radiolabeled DNA was visualized using a PhosphorImager. In a previous study, we demonstrated that the MER3 protein has ATPase activity and displace oligonucleotide fragments annealed to M13 single-stranded circular DNA in an ATP-dependent manner.2 To better characterize the MER3 ATPase activity, MER3 protein was incubated with [γ-32P]ATP, and the formation of 32Pi was measured using thin layer chromatography. MER3 hydrolyzed ATP, and the addition of increasing concentrations of poly(dA) or M13 RF DNA increased the amount of ATP hydrolyzed by up to 5–6-fold (Fig.1, A and B), showing that the MER3 ATPase activity is stimulated by either single- or double-stranded DNA. Stimulation of the ATPase activity by the addition of M13mp18 single-stranded circular DNA was also observed, indicating that single-stranded ends are not required to stimulate the MER3 ATPase activity (data not shown). In addition, M13 RF DNA linearized by digestion with HindIII stimulated the MER3 ATPase activity as well as undigested M13 RF DNA (at a DNA concentration of 1.5 µg/ml; data not shown), excluding the possibility that single-stranded regions that might appear in super-coiled DNA stimulate the ATPase activity. The ATPase activity reached maximal levels at poly(dA) and M13 RF DNA concentrations of 0.3 and 0.6 µg/ml, respectively, which is equivalent to 180 nt of poly(dA) or 180 bp of M13 RF DNA per MER3 molecule. To determine the turnover rate of the MER3 ATPase, the initial velocity of ATP hydrolysis was determined at different concentrations of ATP in the presence of an excess amount of DNA (10 µg/ml) (Fig. 1, Cand D). Shown in Table Iare the K m, V max, andk cat values obtained from analyses of the data presented in Fig. 1, C and D. The turnover rate,k cat was found to be about 500 ATP/min in the presence of either poly(dA) or M13 RF DNA, although theK m value was slightly lower in the presence of poly(dA) as compared with M13 RF DNA. The MER3 ATPase activity required a divalent cation. Maximal activity could be observed in the presence of either Ca2+, Mg2+, or Mn2+, whereas Zn2+ did not support the ATPase activity (Fig.2, A and B).Table IATPase activity of the MER3 proteinDNAK mV maxk catµmpmol · min−1min−1Poly(dA)470111550M13mp18 RF580106530 Open table in a new tab Figure 2Requirement of divalent cations for the MER3 ATPase activity. Reactions (20 µl each) were carried out as described in the legend to Fig. 1, A and B, except that EDTA was present at a final concentration of 0.1 mm in order to remove contaminating divalent cations; and then CaCl2, MgCl2, MnCl2, or ZnCl2 was added to a final concentration of 5 mm prior to the pre-incubation step. The amount of ATP hydrolyzed in the presence of poly(dA) (A) or M13 RF (B) is presented. The average of two independent experiments is shown, and the error bars indicate the standard deviation.View Large Image Figure ViewerDownload (PPT) An amino acid substitution changing a conserved glycine to an aspartic acid at amino acid 166, mer3G166D, in a putative nucleotide-binding domain of the helicase motifs of MER3 was previously found to virtually eliminate the MER3 DNA helicase activity.2 However, the mutant MER3GD protein had single- and double-stranded DNA-binding activity that was indistinguishable from that of the wild-type MER3 protein. To analyze the effect of this amino acid substitution on ATPase activity, the time course of ATP hydrolysis by MER3GD was determined (Fig.3). In the presence of either poly(dA) or M13 RF, the mer3G166D amino acid substitution significantly decreased the MER3 ATPase activity. Interestingly, the residual ATPase activity of MER3GD was different in the presence of different DNA cofactors. In the case of poly(dA), the rate of ATP hydrolysis carried out by MER3GD was about 17% of that of wild-type MER3 (Fig.3 A), whereas no detectable amounts of ATP were hydrolyzed by MER3GD in the presence of M13 RF DNA (Fig. 3 B). In summary, mutant MER3GD retains an ability to bind DNA but has defects in ATP hydrolysis and DNA helicase reaction. Thus, it is likely that the glycine in a putative nucleotide-binding domain is important for ATP hydrolysis, which is coupled to the DNA unwinding activity of MER3. In previous studies, it was observed that the MER3 helicase could displace a 50-nt oligonucleotide annealed to M13mp18 single-stranded circular DNA.2 To determine whether MER3 can unwind longer DNA duplexes, similar DNA substrates were constructed containing 100- or 631-nt fragments annealed to M13mp18 single-stranded circular DNA. DNA helicase assays were performed with each DNA substrate in the presence of increasing amounts of MER3 (Fig. 4, A andB). The MER3 helicase displaced both the 100- and 631-nt fragments, although higher amounts of MER3 were required to displace the 631-nt fragment compared with the 100-nt fragment. The activity of MER3 helicase as a function of protein concentration was quantified using substrates containing 50-, 100-, or 631-nt fragments annealed to M13mp18 single-stranded circular DNA (Fig. 4 C). This analysis showed that the amount of MER3 required to displace each annealed fragment increased as a function of the size of the annealed fragment. For example, 0.5, 2.5, and 10 nm MER3 was required to displace ∼30% of the fragments from the 50-, 100-, and 631-nt substrates, respectively. These results show that high concentrations of MER3 are required to unwind long DNA duplexes. One possible reason for the fact that increasing amounts of MER3 are required to unwind DNA duplexes of increasing length is that binding of MER3 to the displaced single strands is required to prevent re-annealing. If this is the case, the activity of MER3 would be expected to be stimulated by single-stranded DNA-binding proteins. To test this possibility, the activity of the MER3 helicase was measured in the presence of either S. cerevisiae RPA complex or E. coli SSB, the single-stranded DNA-binding proteins that function in DNA replication, recombination, and repair in each organism (Fig. 5). In reactions containing the annealed 50-nt fragment (Fig. 5 A), there was no detectable stimulation of strand displacement by the addition of RPA (Fig. 5 A, lane 6) or SSB (Fig. 5 A,lane 4). Also, no stimulation of MER3 by these SSBs was observed at different concentrations of MER3 (0.1, 0.4, and 0.8 nm; data not shown). However, displacement of the 631-nt fragment was stimulated by either RPA (Fig. 5 B, lane 6) or SSB (Fig. 5 B, lane 4) at the concentration of RPA or SSB that did not affect the activity of MER3 on the 50-nt substrate (Fig. 5 A). The helicase activity of MER3 on the substrate containing the 631-nt fragment was examined at different concentrations of RPA (Fig.5 C). The most efficient stimulation of strand displacement occurred at 20 nm RPA. At this concentration of RPA, the amount of 631-nt fragment displaced was increased 25-fold compared with that seen in the absence of RPA. The order of the addition of RPA and MER3 was found not to affect the strand displacement (Fig. 5 C, closed triangles and circles). Importantly, at the RPA concentrations examined, RPA alone did not displace any of the 631-nt fragment (Fig. 5 C, open circles). Given a binding site size of 90–100 nt for RPA (33Alani E. Thresher R. Griffith J.D. Kolodner R.D. J. Mol. Biol. 1992; 227: 54-71Crossref PubMed Scopus (151) Google Scholar), under these reaction conditions of 1 µm (in nucleotides) DNA and 20 nm RPA, there is sufficient RPA present to bind all of the DNA present if it is single-stranded. These results suggest that RPA stimulates MER3 by binding to the unwound regions produced by MER3 and inhibiting their re-annealing. It is also possible that RPA prevents nonspecific binding of MER3 to the single-stranded regions of the substrates, although the lack of an effect of the order of addition makes this latter possibility seem unl
Referência(s)