Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Structural Elucidation of the Specificity of the Antibacterial Agent Triclosan for Malarial Enoyl Acyl Carrier Protein Reductase

2002; Elsevier BV; Volume: 277; Issue: 15 Linguagem: Inglês

10.1074/jbc.m112000200

ISSN

1083-351X

Autores

Remo Perozzo, Mack Kuo, Amar Bir Singh Sidhu, Jacob T. Valiyaveettil, Robert Bittman, William R. Jacobs, David A. Fidock, James C. Sacchettini,

Tópico(s)

Chemical Synthesis and Analysis

Resumo

The human malaria parasite Plasmodium falciparum synthesizes fatty acids using a type II pathway that is absent in humans. The final step in fatty acid elongation is catalyzed by enoyl acyl carrier protein reductase, a validated antimicrobial drug target. Here, we report the cloning and expression of the P. falciparum enoyl acyl carrier protein reductase gene, which encodes a 50-kDa protein (PfENR) predicted to target to the unique parasite apicoplast. Purified PfENR was crystallized, and its structure resolved as a binary complex with NADH, a ternary complex with triclosan and NAD+, and as ternary complexes bound to the triclosan analogs 1 and 2 with NADH. Novel structural features were identified in the PfENR binding loop region that most closely resembled bacterial homologs; elsewhere the protein was similar to ENR from the plant Brassica napus (root mean square for Cαs, 0.30 Å). Triclosan and its analogs 1 and 2 killed multidrug-resistant strains of intra-erythrocytic P. falciparum parasites at sub to low micromolar concentrations in vitro. These data define the structural basis of triclosan binding to PfENR and will facilitate structure-based optimization of PfENR inhibitors. The human malaria parasite Plasmodium falciparum synthesizes fatty acids using a type II pathway that is absent in humans. The final step in fatty acid elongation is catalyzed by enoyl acyl carrier protein reductase, a validated antimicrobial drug target. Here, we report the cloning and expression of the P. falciparum enoyl acyl carrier protein reductase gene, which encodes a 50-kDa protein (PfENR) predicted to target to the unique parasite apicoplast. Purified PfENR was crystallized, and its structure resolved as a binary complex with NADH, a ternary complex with triclosan and NAD+, and as ternary complexes bound to the triclosan analogs 1 and 2 with NADH. Novel structural features were identified in the PfENR binding loop region that most closely resembled bacterial homologs; elsewhere the protein was similar to ENR from the plant Brassica napus (root mean square for Cαs, 0.30 Å). Triclosan and its analogs 1 and 2 killed multidrug-resistant strains of intra-erythrocytic P. falciparum parasites at sub to low micromolar concentrations in vitro. These data define the structural basis of triclosan binding to PfENR and will facilitate structure-based optimization of PfENR inhibitors. type I fatty acid synthase type II fatty acid synthase acyl carrier protein enoyl acyl carrier protein reductase 2-(N-morpholino)ethanesulfonic acid the translation product of the pfenr gene Treatment of Plasmodium falciparum malaria has depended for decades on the use of the aminoquinoline chloroquine or the synergistic antifolate combination pyrimethamine-sulfadoxine. These drugs were characterized by their potency against the P. falciparum asexual intra-erythrocytic stages (responsible for malaria pathogenesis), their affordability and their safety. The occurrence and spread of drug-resistant strains of P. falciparum have largely contributed to a recent resurgence of malaria, which claims 1 to 3 million lives annually and which is endemic in inter-tropical areas representing 40% of the world's population (1.WHOThe World Health Report. World Health Organization, Geneva1999: 49-63Google Scholar). The current situation of antimalarial chemotherapy and resistance, in conjunction with the reappearance of malaria in formerly well-controlled areas, reinforces the need for new, highly potent antimalarials. Recent investigations into Apicomplexan parasites, including Plasmodium and Toxoplasma, have uncovered the existence of a unique organelle, the apicoplast (2.McFadden G.I. Reith M.E. Munholland J. Lang-Unnasch N. Nature. 1996; 381: 482Crossref PubMed Scopus (424) Google Scholar, 3.Wilson R.J. Denny P.W. Preiser P.R. Rangachari K. Roberts K. Roy A. Whyte A. Strath M. Moore D.J. Moore P.W. Williamson D.H. J. Mol. Biol. 1996; 261: 155-172Crossref PubMed Scopus (470) Google Scholar, 4.Kohler S. Delwiche C.F. Denny P.W. Tilney L.G. Webster P. Wilson R.J. Palmer J.D. Roos D.S. Science. 1997; 275: 1485-1489Crossref PubMed Scopus (619) Google Scholar). The finding that ciprofloxacin-mediated inhibition of plastid replication in Toxoplasma gondii tachyzoites blocked parasite propagation provided evidence for the indispensable nature of this non-photosynthetic plastid organelle (5.Fichera M.E. Roos D.S. Nature. 1997; 390: 407-409Crossref PubMed Scopus (511) Google Scholar). Studies of plastid inhibitors and apicoplast mis-segregation mutants confirmed the essential requirement of this organelle for normal parasite development and indicated that inhibition of apicoplast function or loss of this organelle resulted in parasite death following reinvasion of host cells (5.Fichera M.E. Roos D.S. Nature. 1997; 390: 407-409Crossref PubMed Scopus (511) Google Scholar, 6.Sullivan M. Li J. Kumar S. Rogers M.J. McCutchan T.F. Mol. Biochem. Parasitol. 2000; 109: 17-23Crossref PubMed Scopus (55) Google Scholar, 7.He C.Y. Shaw M.K. Pletcher C.H. Striepen B. Tilney L.G. Roos D.S. EMBO J. 2001; 20: 330-339Crossref PubMed Scopus (154) Google Scholar). This organelle appears to derive ultimately from a cyanobacterial endosymbiont (4.Kohler S. Delwiche C.F. Denny P.W. Tilney L.G. Webster P. Wilson R.J. Palmer J.D. Roos D.S. Science. 1997; 275: 1485-1489Crossref PubMed Scopus (619) Google Scholar, 8.Palmer J.D. Delwiche C.F. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 7432-7435Crossref PubMed Scopus (88) Google Scholar, 9.McFadden G.I. Waller R.F. Bioessays. 1997; 19: 1033-1040Crossref PubMed Scopus (101) Google Scholar) and as such was postulated to contain prokaryotic-type metabolic pathways, of significant interest from the perspective of developing antiparasitic drugs (10.McFadden G.I. Roos D.S. Trends Microbiol. 1999; 7: 328-333Abstract Full Text Full Text PDF PubMed Scopus (211) Google Scholar). Recent studies indicate that these pathways include fatty acid and isoprenoid biosynthesis (11.Jomaa H. Wiesner J. Sanderbrand S. Altincicek B. Weidemeyer C. Hintz M. Turbachova I. Eberl M. Zeidler J. Lichtenthaler H.K. Soldati D. Beck E. Science. 1999; 285: 1573-1576Crossref PubMed Scopus (1044) Google Scholar, 12.Waller R.F. Keeling P.J. Donald R.G. Striepen B. Handman E. Lang-Unnasch N. Cowman A.F. Besra G.S. Roos D.S. McFadden G.I. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 12352-12357Crossref PubMed Scopus (644) Google Scholar). Proteins involved in these pathways are often the products of nuclear genes that encode N-terminal signal and transit peptide sequences for apicoplast localization (12.Waller R.F. Keeling P.J. Donald R.G. Striepen B. Handman E. Lang-Unnasch N. Cowman A.F. Besra G.S. Roos D.S. McFadden G.I. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 12352-12357Crossref PubMed Scopus (644) Google Scholar, 13.Roos D.S. Crawford M.J. Donald R.G. Kissinger J.C. Klimczak L.J. Striepen B. Curr. Opin. Microbiol. 1999; 2: 426-432Crossref PubMed Scopus (133) Google Scholar, 14.Waller R.F. Reed M.B. Cowman A.F. McFadden G.I. EMBO J. 2000; 19: 1794-1802Crossref PubMed Scopus (427) Google Scholar). Fatty acids play a critical role in providing metabolic precursors of biological membranes and represent an important form of metabolic energy, making their biosynthetic pathway an excellent target for antimicrobial agents. In higher eukaryotes and yeast the biosynthetic enzymes are integrated into large multifunctional single polypeptides, commonly referred to as type I fatty acid synthases (FAS-I).1 The FAS-I system utilizes acetyl CoA for iterative 2-carbon elongation of fatty acids. In contrast to the large eukaryotic FAS-I enzyme, plants and most prokaryotes perform the same enzymatic steps using separate, discrete enzymes. This system is referred to as type II fatty acid synthase (FAS-II) (15.Rock C.O. Cronan J.E. Biochim. Biophys. Acta. 1996; 1302: 1-16Crossref PubMed Scopus (294) Google Scholar, 16.Fulco A.J. Prog. Lipid Res. 1983; 22: 133-160Crossref PubMed Scopus (158) Google Scholar, 17.Kater M.M. Koningstein G.M. Nijkamp H.J. Stuitje A.R. Plant Mol. Biol. 1994; 25: 771-790Crossref PubMed Scopus (36) Google Scholar, 18.Smith S. FASEB J. 1994; 8: 1248-1259Crossref PubMed Scopus (533) Google Scholar). The first evidence in favor of a FAS-II pathway in malaria parasites (see Scheme FS1) came from the work of Waller et al. (12.Waller R.F. Keeling P.J. Donald R.G. Striepen B. Handman E. Lang-Unnasch N. Cowman A.F. Besra G.S. Roos D.S. McFadden G.I. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 12352-12357Crossref PubMed Scopus (644) Google Scholar). These investigators reported the presence of nuclear genes encoding the FAS-II proteins acyl carrier protein (ACP), and FabZ (β-hydroxyacyl-ACP dehydratase) in Toxoplasma gondii and ACP, FabH (β-ketoacyl-ACP synthase III), and FabF (β-ketoacyl-ACP synthase II) in P. falciparum and provided evidence for their targeting to the apicoplast (12.Waller R.F. Keeling P.J. Donald R.G. Striepen B. Handman E. Lang-Unnasch N. Cowman A.F. Besra G.S. Roos D.S. McFadden G.I. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 12352-12357Crossref PubMed Scopus (644) Google Scholar, 14.Waller R.F. Reed M.B. Cowman A.F. McFadden G.I. EMBO J. 2000; 19: 1794-1802Crossref PubMed Scopus (427) Google Scholar). Recent in vitro studies confirm that P. falciparum actively synthesizes fatty acids, predominantly C10 to C14 (19.Surolia N. Surolia A. Nat. Med. 2001; 7: 167-173Crossref PubMed Scopus (404) Google Scholar). Inhibition of fatty acid biosynthesis has been repeatedly validated as an appropriate target for antimicrobials. Specific inhibitors of the FAS-II pathway include triclosan and thiolactomycin. Triclosan, a specific inhibitor of FAS-II trans-2-enoyl-ACP reductase (ENR, also known as inhA or FabI) is effective against a broad spectrum of bacteria (20.Bhargava H.N. Leonard P.A. Am. J. Infect. Control. 1996; 24: 209-218Abstract Full Text PDF PubMed Scopus (443) Google Scholar), including Escherichia coli (21.Heath R.J. Yu Y.T. Shapiro M.A. Olson E. Rock C.O. J. Biol. Chem. 1998; 273: 30316-30320Abstract Full Text Full Text PDF PubMed Scopus (325) Google Scholar, 22.McMurry L.M. Oethinger M. Levy S.B. Nature. 1998; 394: 531-532Crossref PubMed Scopus (850) Google Scholar), mycobacteria (23.McMurry L.M. McDermott P.F. Levy S.B. Antimicrob. Agents Chemother. 1999; 43: 711-713Crossref PubMed Scopus (17) Google Scholar), and multidrug-resistant Staphylococcus aureus (24.Bartzokas C.A. Paton J.H. Gibson M.F. Graham F. McLoughlin G.A. Croton R.S. N. Engl. J. Med. 1984; 311: 1422-1425Crossref PubMed Scopus (106) Google Scholar, 25.Webster J. J. Hosp. Infect. 1992; 21: 137-141Abstract Full Text PDF PubMed Scopus (44) Google Scholar) and is widely used as an antimicrobial in household formulations, including soaps and toothpaste. Recently, triclosan was found to inhibit P. falciparum growth with an IC50 of ∼1 μm (19.Surolia N. Surolia A. Nat. Med. 2001; 7: 167-173Crossref PubMed Scopus (404) Google Scholar, 26.McLeod R. Muench S.P. Rafferty J.B. Kyle D.E. Mui E.J. Kirisits M.J. Mack D.G. Roberts C.W. Samuel B.U. Lyons R.E. Dorris M. Milhous W.K. Rice D.W. Int. J. Parasitol. 2001; 31: 109-113Crossref PubMed Scopus (194) Google Scholar). This compares with a reported IC50 against P. falciparum of about 50 μm for thiolactomycin, which inhibits the condensing enzymes FabB, FabF, and FabH in plants and bacteria (Ref. 12.Waller R.F. Keeling P.J. Donald R.G. Striepen B. Handman E. Lang-Unnasch N. Cowman A.F. Besra G.S. Roos D.S. McFadden G.I. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 12352-12357Crossref PubMed Scopus (644) Google Scholar and references therein). In vivo efficacy studies using Plasmodium berghei in mice showed that subcutaneous administration of 3 mg/kg triclosan for 4 days resulted in 75% reduction in parasitemia (19.Surolia N. Surolia A. Nat. Med. 2001; 7: 167-173Crossref PubMed Scopus (404) Google Scholar). Full parasite clearance was achieved with a single injection of 38 mg/kg given to mice that already had a parasitemia of 13–27%. Liver and kidney function tests were normal even at this highest dose, indicating that the further development of triclosan and its analogs may result in pharmacologically suitable compounds for use in humans. In this report, we present the cloning of the pfenr gene and the three-dimensional structure of its translation product, PfENR, bound to triclosan and analogs that show biological activity. These data provide a framework for understanding the inhibitory mechanisms of fatty acid biosynthesis of P. falciparum and a model for undertaking structure-based drug development of selective FAS-II antimalarials. Overlapping pfenr se- quences were PCR-amplified from a P. falciparum (3D7 strain) gametocyte cDNA pSPORT plasmid library (kindly provided by Dr. Thomas Templeton, Weill Medical College of Cornell University, New York) using vector-specific primers (M13/pUC forward and reverse) combined with the following pfenr primers: 5′-TTTATTGCTGGTATAGGAGATACAAAT and 5′-ATTTGTATCTCCTATACCAGCAATAAA, 5′-TGGCCTCCTGTTTATAATATTTTT and 5′-AAAAATATTATAAACAGGAGGCCA, 5′-GAAGAAACGAAAAATAATAAAAGATATAAT and 5′-ATATCTTTTATTATTTTTCGTTTCTTC, 5′-CCAGGCTATGGTGGAGGTATG and 5′-CATACCTCCACCATAGCCTGG, 5′-GATTATGCAATAGAGTATTCA and 5′-CATATTATTTAAGTGTTTCAT. PCR conditions were: 1× (94 °C for 2 min); 35× (94 °C for 20 s, 48 °C for 10 s, 52 °C for 10 s, and 60 °C for 2 min). Amplified PCR fragments were isolated and directly sequenced using internal primers. Full-length pfenr gene was amplified using primers W1 (5′-AACGTCCCATGGATAAAATATCACAACGGTTATTATTCCTCTTTCTACAT) and W2 (5′-ATATGGATCCTCATTCATTTTCATTGCGATATATATCATCTGGTAAAAACAT), which contain NcoI and BamHI sites, respec- tively (underlined). Four silent mutations (shown in lowercase letters) were introduced with mutagenic primers M1 (5′-GAgAAGGAAGAgAAgAAgAATTCAGCTAGCCAAAATTATACATTTATAGATTAT and M2 (5′-GAATTcTTcTTcTCTTCCTTcTCACCTGAATTGTTCATAATATTATGAACATC) using a two-step megaprimer PCR method (27.Higuchi R. Krummel B. Saiki R.K. Nucleic Acids Res. 1988; 16: 7351-7367Crossref PubMed Scopus (2188) Google Scholar, 28.Innis M.A. Gelfand D.H. Sninsky J.J. White T.J. Protocols: A Guide to Methods and Application. Academic Press, San Diego, CA1990: 177-183Google Scholar). In the first step, the cDNA library was used as a template to amplify both a 5′ fragment with the primers W1 and M2 and a 3′ fragment with the primers M1 and W2. Both reactions used the PCR conditions: 1× (94 °C for 2 min); 30× (94 °C for 20 s, 53 °C for 40 s, and 60 °C for 3 min). For the second step, both fragments were gel-purified and combined in a PCR reaction with primers W1 and W2, yielding the full-length pfenr. After restriction digestion, the gene was ligated into the pET28a vector (Novagen) and transfected into E. coli (NovaBlue, Novagen). A construct containing the four silent mutations was identified and verified by restriction digestion, PCR, and automated sequencing with internal primers. This construct harboring the stabilized pfenr gene was used as a template to prepare a N-terminal and C-terminal truncated version, using expression primers E1 (5′-ACGTCCCATGGTGCATCATCATCATCATCATAATGAAGATATTTGTTTTATTGCTGGTATAGG) and E2 (5′-ATATGGATCCTCAATCATCTGGTAAAAACATTATATTTAATCCGTTATCCACATATATTGTCTG) (NcoI and BamHI sites underlined) and the PCR conditions described above. This truncated gene was li- gated into pET28a, and its sequence was verified. Recently, the full-length pfenr gene sequence also appeared in the P. falciparum genome data base as sequence from the P. falciparum "blob" chromosomes that comigrate on pulse-field gels. This has been confirmed independently by two other publications (19.Surolia N. Surolia A. Nat. Med. 2001; 7: 167-173Crossref PubMed Scopus (404) Google Scholar, 26.McLeod R. Muench S.P. Rafferty J.B. Kyle D.E. Mui E.J. Kirisits M.J. Mack D.G. Roberts C.W. Samuel B.U. Lyons R.E. Dorris M. Milhous W.K. Rice D.W. Int. J. Parasitol. 2001; 31: 109-113Crossref PubMed Scopus (194) Google Scholar). When compared with these recently published sequences, our data from multiple independent PCR products show a Gln at position 35 instead of His, and an Asn instead of a Tyr at position 88 of the complete amino acid sequence. Both changes occur at the N terminus of the enzyme in a region that is structurally distant to the site of enzymatic function. BL21(DE3) Codon+-RIL cells (Novagen) harboring the expression plasmids were grown in Terrific broth. When the A600 reached 0.8, the cells were induced with 1 mmisopropyl-1-thio-β-d-galactopyranoside for 5 h at 37 °C. Cell pellets were resuspended in buffer A (20 mmTris/HCl, pH 8.0, 500 mm NaCl, 50 mm imidazole) and disrupted using a French press. The filtered supernatant was applied to a metal chelate affinity column loaded with nickel. The column was washed with buffer B (20 mm Tris/HCl, pH 8.0, 500 mm NaCl, 150 mm imidazole) and eluted with buffer C (20 mm Tris/HCl, pH 8.0, 500 mmNaCl, 400 mm imidazole). The protein was concentrated using Centriprep 30 and applied to a Superdex 75 size-exclusion column equilibrated with buffer D (20 mm Tris/HCl, pH 7.5, 150 mm NaCl). Using hanging drop and vapor diffusion methods, PfENR was crystallized as a binary complex with NADH bound to the enzyme and as a ternary complex with NAD+ and triclosan. The protein in buffer D (20 mg/ml) was incubated with 4 mm NAD+ and 1 mmtriclosan for the ternary complex and with 4 mm NADH for the binary complex. Two microliters of these mixtures was mixed with 2 μl of well solution consisting of 2.35 m(NH4)2SO4 and 100 mmbuffer, pH 5.6 (sodium acetate for the ternary, MES for the binary complex) and equilibrated against the reservoir solution at 18 °C. The crystals of both complexes were isomorphous, belonged to the space group P43212 (cell dimensions a = b = 134.0 Å, c = 84.0 Å), and contained a dimer (half of the functional tetramer) in the asymmetric unit. Crystals of ternary complexes with NADH and the triclosan analogs1 and 2 were prepared by soaking binary ENR·NADH crystals. The inhibitors were dissolved in acetonitrile, directly added to the drops containing crystals of binary complexes, and incubated for a week. Diffraction data was collected at room temperature to 2.35- to 2.50-Å resolution from single crystals using a MacScience DIP2030 image plate detector with double-focusing mirrors coupled to a Rigaku x-ray generator utilizing a copper rotating anode (CuKαwavelength = 1.54 Å). The data were processed and scaled using DENZO/SCALEPACK (29.Otwinowski Z. Minor W. Methods Enzymol. 1997; 276: 307-326Crossref PubMed Scopus (38777) Google Scholar). The structure of the ternary ENR·NAD+·triclosan complex was solved by molecular replacement with AMORE (30.Navaza J. Acta Crystallogr. Sect. A. 1994; 50: 157-163Crossref Scopus (5038) Google Scholar) using only protein coordinates of the Brassica napus ENR structure (Protein Data Bank entry1ENO) as a search model. The initial solution was used as a template for the Automated Protein Modeling Server (available at www.expasy.ch/swissmod/) to generate a three-dimensional model of the PfENR sequence. The resulting model was then used to calculate an initial electron density map at 2.43 Å, which showed strong and continuous density for NAD+ and triclosan. Several rounds of model refinement included the addition of missing amino acids. In a late stage, water was automatically added and the final refinement was carried out without any noncrystallographic symmetry restraints. This yielded a final Rwork of 17.1% and a value for Rfree of 21.3%. The first 9 amino acids (including the His6-tag) were not resolved, and 40 of the 43 amino acids comprising an insertion next to the binding loop area did not show any density. There were no additional breaks in the main chain, although the density was weak for residues Ile153–Lys155 and Glu179–Asn183 that form two small loop regions. The average B-value for protein atoms was 36 Å2. The final model contained a total of 289 amino acids, one NAD+ molecule, one triclosan molecule, and 57 water molecules in each monomer. PROCHECK analysis showed 90% of all residues in the most favored and 10% in the generously allowed regions of the Ramachandran diagram. Because crystals of the binary complex with NADH were isomorphous to the ternary complex, the protein coordinates of the latter were used to calculate the initial binary complex density maps. The first map calculated at 2.40 Å clearly identified the NADH cofactor with strong and continuous density. Subsequent refinement led to an Rwork of 17.6% and an Rfree of 22.4%. Again, no density was observed for the first 9 amino acids and the same 40 amino acids of the binding loop insertion of each monomer, and the same areas for the loops showed weak density. The average B-value for main-chain atom positions of the binary structure was 31 Å2. The final model contained a total of 289 amino acids, one NADH molecule, and 77 water molecules in each monomer. The ternary structures with bound inhibitors 1 and2 were solved using the method described above. Initial maps showed strong density for NADH, and additional differences in electron density at the inhibitor binding site. Good density for 1was only observed in monomer B, whereas 2 showed excellent density in both monomers. The inhibitors were built into the model, and subsequent refinement for 1 led to an Rwork of 18.7% and an Rfree of 23.2%, with a total of 289 amino acids, one NADH, and 69 solvent molecules in each monomer and one1 molecule in subunit B. The ternary structure with bound2 was refined to an Rwork of 17.6% and an Rfree of 22.7%. The model comprised 289 amino acids, one NADH molecule, one 2 molecule, and 64 solvent molecules in each monomer. Both structures lacked density for the initial 9 amino acids and the same residues of the large loop insertion. The density for the two small loops was weak. The average B-values of the main-chain atoms of the ternary ENR·NADH·1 and ENR·NADH·2 complexes were 33 and 34 Å2, respectively. The statistics for all the structural determinations are presented in Table I.Table IData collection and refinement statisticsData collectionENR·NADHENR·NAD+·triclosanENR·NADH·1ENR·NADH·2Maximum resolution (Å)2.402.432.352.50Space groupP43212P43212P43212P43212a = b (Å)133.28133.08133.37133.10c (Å)83.8384.1683.8683.69α = β = γ (°)90.0090.0090.0090.00Unique reflections30051290103202126564Rsym(%)1-aRsym = ΣhΣi‖Ihi − 〈Ih〉‖/ΣhΣiIhi, where Ihi is the intensity of observation I of reflection h.12.39.59.99.8Completeness (%)94.696.990.094.8Redundancy3.05.83.33.7I/ς9.111.59.79.3Refinement statistics Resolution range (Å)30–2.4030–2.4330–2.3530–2.50 Number of reflections28422281042883325188 Number of atoms Protein4574457445744574 Water154114138128 Ligand(s)88122120128 Rcryst(%)1-bRcryst = Σh∥Fobs‖ − ‖Fcalc∥/Σ‖Fobs‖, where Fobs and Fcalc are observed and calculated structure factors, respectively.17.617.118.717.6 Rfree(%)1-cRfree was calculated on 10% of the data omitted at random.22.421.323.222.7 Average B-factors (Å2) Protein (subunit A/B)32/3135/3634/3235/34 NAD+/NADH (subunit A/B)32.3/23.428.0/26.856.9/26.829.7/26.0 Inhibitors (subunit A/B)14.9/13.777.5/56.121.3/21.61-a Rsym = ΣhΣi‖Ihi − 〈Ih〉‖/ΣhΣiIhi, where Ihi is the intensity of observation I of reflection h.1-b Rcryst = Σh∥Fobs‖ − ‖Fcalc∥/Σ‖Fobs‖, where Fobs and Fcalc are observed and calculated structure factors, respectively.1-c Rfree was calculated on 10% of the data omitted at random. Open table in a new tab All experiments were carried out on a Shimadzu UV-1201 UV-visible spectrophotometer at 25 °C in 20 mmTris/HCl, pH 7.6, 150 mm NaCl. Kinetic parameters were determined spectrophotometrically by following the oxidation of NADH to NAD+ at 340 nm (ε = 6.3 mm−1 cm−1). Kmand Vmax values for crotonoyl-CoA were determined at a fixed and saturating concentration of NADH (200 μm) and by varying the substrate concentration (0–500 μm). Km and Vmax values for NADH were determined at variable concentrations of NADH and a fixed and saturating concentration of crotonoyl-CoA (500 μm). Kinetic parameters were obtained by fitting the initial velocity data to the Michaelis-Menten equation. Inhibition constants were determined under conditions of saturating substrate (500 μm crotonoyl-CoA, 200 μmNADH) and variable inhibitor concentration. Values for Ki were determined from the x-intercept of a Dixon plot, assuming uncompetitive inhibition. Mean values of two independent experiments are reported for kinetic parameters and inhibition data. The inhibitory activities of triclosan and its analogs against P. falciparum asexual blood stages were determined using a 72-h in vitro assay that measures decreases in [3H]hypoxanthine uptake as a marker of growth inhibition (31.Fidock D.A. Nomura T. Wellems T.E. Mol. Pharmacol. 1998; 54: 1140-1147Crossref PubMed Scopus (142) Google Scholar, 32.Desjardins R.E. Canfield C.J. Haynes J.D. Chulay J.D. Antimicrob. Agents Chemother. 1979; 16: 710-718Crossref PubMed Scopus (2288) Google Scholar). Compound 1,N-(2,4-dichlorophenyl)-2′-hydroxyaniline, was prepared with a 61% overall yield by the (DPPF)PdCl2 (DPPF, 1,1′-bisdiphenylphosphino)ferrocene-catalyzed amination of 2,4-dichlorobromobenzene with o-anisidine in the presence of sodium tert-butoxide (33.Driver M.S. Hartwig J.F. J. Am. Chem. Soc. 1996; 118: 7217-7218Crossref Scopus (503) Google Scholar), followed by demethylation of the resulting aryl methyl ether with boron tribromide in dichloromethane at low temperature. Compound 2, 4-chloro-2-hydroxyphenyl 6′-hydroxynaphthyl ether, was synthesized with a 46% overall yield by copper-catalyzed coupling of 2-bromo-4-methoxynaphthalene with 4-chloro-2-methoxyphenol using cesium carbonate as a base and 1-naphthoic acid as an additive to increase the efficiency of the coupling of the less soluble phenoxide (34.Marcoux J.F. Doye S. Buchwald S.L. J. Am. Chem. Soc. 1997; 119: 10539-10540Crossref Scopus (405) Google Scholar), followed by demethylation of the resulting aryl methyl ether. Full-length P. falciparum ENR was cloned using PCR primers designed on the basis of sequence alignments of reported microbial and plant ENRs as well as contig data from the P. falciparum genome project. Primers were chosen to conserved regions and were used in combination with vector-specific primers to PCR amplify overlapping fragments of the pfenr gene from a P. falciparumgametocyte stage cDNA library. This yielded a single-exon open reading frame of 1299 bp with an A/T content of 72.0%. The predicted start codon was preceded by stop codons in all three reading frames located in a 0.5-kb 5′-untranslated region with an increased A/T content of 85.0%. A stretch of 10 contiguous adenosines turned out to be particularly vulnerable for deletion mutations and was associated with minimal expression of full-length or truncated PfENR. Four silent mutations were introduced in this region, and the resulting construct was stable in E. coli and was used as a template for all further PCR reactions and expression studies. To increase protein yield and facilitate the crystallization process, the PfENR protein was expressed without the N-terminal signal and translocation peptide and the following 18 residues, as well as the C-terminal 7 amino acids, which were predicted to extend into solvent and potentially interfere with crystallization but not contribute to enzyme function. When BL21(DE3) Codon+-RIL cells (Novagen) were used for expression, the purification typically resulted in 20–30 mg of truncated PfENR per liter of media. The Km and Vmax values of the truncated PfENR (Table II) were indistinguishable from the full-length enzyme carrying silent point mutations.Table IIObserved Km and Vmax values for ENRs of different organisms using crotonoyl-CoA as substrateOrganismKmVmaxμmμm min−1P. falciparum2-aThe data for P. falciparum reflect the mean values of two independent experiments. Other data were taken from the literature (42, 60-62).48 ± 316 ± 2B. napus178NA2-bNA, not available.E. coli270010S. oleracea40112-a The data for P. falciparum reflect the mean values of two independent experiments. Other data were taken from the literature (42.Bergler H. Wallner P. Ebeling A. Leitinger B. Fuchsbichler S. Aschauer H. Kollenz G. Hogenauer G. Turnowsky F. J. Biol. Chem. 1994; 269: 5493-5496Abstract Full Text PDF PubMed Google Scholar, 60.Bernstein N.K. Cherney M.M. Loetscher H. Ridley R.G. James M.N. Nat. Struct. Biol. 1999; 6: 32-37Crossref PubMed Scopus (71) Google Scholar, 61.Slabas A.R. Sidebottom C.M. Hellyer A. Kessel R.M.J. Tombs M.P. Biochim. Biophys. Acta. 1986; 877: 271-280Crossref Scopus (61) Google Scholar, 62.Shimakata T. Stumpf P.K. Arch. Biochem. Biophys. 1982; 218: 77-91Crossref PubMed Scopus (53) Google Scholar).2-b NA, not available. Open table in a new tab pfenr encoded a predicted protein of 432 amino acids with an expected molecular mass of 49.8 kDa. Sequence alignments (Fig. 1) revealed that PfENR showed much greater overall sequence similarity to plant ENRs than to microbial ENRs. Regions of homology with plant enzymes were divided by a 43-amino acid insert (residues 325–367) that was enriched in the polar residues asparagine (30%), lysine (12%), glutamine (9%), and serine (9%). This low complexity insertion was demonstrated to be coding, because it was routinely identified in cDNA libraries (generated from oligo-dT-primed DNase I-treated poly(A)+ RNA and prepared from either asexual or sexual stage intra-erythrocytic parasites), it did not have typical splice acceptor and donor sequences (35.Coppel R.L. Black C.G. Sherman I.W. Malaria: Parasite Biology, Pathogenesis, and Protection. ASM Press, Washington, D. C.1998: 185-202Google Scholar), and it maintained the same A/T conte

Referência(s)