Identification of rab7 as a Melanosome-Associated Protein Involved in the Intracellular Transport of Tyrosinase-Related Protein 1
2001; Elsevier BV; Volume: 117; Issue: 1 Linguagem: Inglês
10.1046/j.0022-202x.2001.01402.x
ISSN1523-1747
AutoresPaul Gomez, Dong Luo, Kuninori Hirosaki, Kyoka Shinoda, Toshiharu Yamashita, Junichi Suzuki, Kaoru Otsu, Kiichi Ishikawa, Kowichi Jimbow,
Tópico(s)RNA regulation and disease
ResumoThe melanosome is a unique secretory granule of the melanocyte in which melanin pigments are synthesized by tyrosinase gene family glycoproteins. Melanogenesis is a highly regulated process because of its inherent toxicity. An understanding of the various regulatory mechanisms is important in delineating the pathophysiology involved in pigmentary disorders and melanoma. We have purified and analyzed the total melanosomal proteins from B16 mouse melanoma tumors in order to identify new proteins that may be involved in the control of the melanogenesis process. Melanosomal proteins were resolved by two-dimensional sodium dodecyl sulfate polyacrylamide gel electrophoresis, a predominant spot (27 kDa with isoelectric point 5.8–6.4) was excised and digested with cyanogen bromide, and the fragments were sequenced. Synthetic oligonucleotide primers were synthesized corresponding to the peptide sequences, and reverse transcriptase polymerase chain reaction amplification of total RNA from B16 cells was carried out. Sequencing of one of the polymerase-chain-reaction-mediated clones demonstrated 80%-97% sequence homology of 200 bp nucleotide with GTP-binding proteins at the 3′-untranslated region. GTP-binding assay on two-dimensional gels of melanosomal proteins showed the presence of several (five to six) small GTP-binding proteins, suggesting that small GTP-binding proteins are associated with the melanosome. Among the known GTP-binding proteins with similar molecular weight and isoelectric point ranges, rab3, rab7, and rab8 were found to be present in the melanosomal fraction by immunoblotting. Confocal immunofluorescence microscopy showed that rab7 is colocalized with the tyrosinase-related protein 1 around the perinuclear area as well as, in part, in the perikaryon, thereby suggesting that rab7 might be involved in the intracellular transport of tyrosinase-related protein 1. Tyrosinase-related protein 1 transport was blocked by the treatment of B16 cells with antisense oligonucleotide to rab7. We suggest (i) that rab7 is a melanosome-associated molecule, (ii) that tyrosinase-related protein 1 is present in late-endosome delineated granules, and (iii) that rab7 is involved in the transport of tyrosinase-related protein 1 from the late-endosome delineated granule to the melanosome. The melanosome is a unique secretory granule of the melanocyte in which melanin pigments are synthesized by tyrosinase gene family glycoproteins. Melanogenesis is a highly regulated process because of its inherent toxicity. An understanding of the various regulatory mechanisms is important in delineating the pathophysiology involved in pigmentary disorders and melanoma. We have purified and analyzed the total melanosomal proteins from B16 mouse melanoma tumors in order to identify new proteins that may be involved in the control of the melanogenesis process. Melanosomal proteins were resolved by two-dimensional sodium dodecyl sulfate polyacrylamide gel electrophoresis, a predominant spot (27 kDa with isoelectric point 5.8–6.4) was excised and digested with cyanogen bromide, and the fragments were sequenced. Synthetic oligonucleotide primers were synthesized corresponding to the peptide sequences, and reverse transcriptase polymerase chain reaction amplification of total RNA from B16 cells was carried out. Sequencing of one of the polymerase-chain-reaction-mediated clones demonstrated 80%-97% sequence homology of 200 bp nucleotide with GTP-binding proteins at the 3′-untranslated region. GTP-binding assay on two-dimensional gels of melanosomal proteins showed the presence of several (five to six) small GTP-binding proteins, suggesting that small GTP-binding proteins are associated with the melanosome. Among the known GTP-binding proteins with similar molecular weight and isoelectric point ranges, rab3, rab7, and rab8 were found to be present in the melanosomal fraction by immunoblotting. Confocal immunofluorescence microscopy showed that rab7 is colocalized with the tyrosinase-related protein 1 around the perinuclear area as well as, in part, in the perikaryon, thereby suggesting that rab7 might be involved in the intracellular transport of tyrosinase-related protein 1. Tyrosinase-related protein 1 transport was blocked by the treatment of B16 cells with antisense oligonucleotide to rab7. We suggest (i) that rab7 is a melanosome-associated molecule, (ii) that tyrosinase-related protein 1 is present in late-endosome delineated granules, and (iii) that rab7 is involved in the transport of tyrosinase-related protein 1 from the late-endosome delineated granule to the melanosome. human melanosome specific antigen-5 large granule fraction mannose-6-phosphate receptor phosphatidylinositol 3-kinase sucrose density gradient small molecular weight GTP-binding protein tyrosinase-related protein Melanin synthesis (melanogenesis) is a complex process that is initiated by the hydroxylation of tyrosine to 3,4-dihydroxyphenylalanine (DOPA) and followed by oxidation to dopaquinone, both reactions catalyzed by the enzyme tyrosinase. Dopaquinone undergoes several enzymatic and nonenzymatic reactions after this initial step to form fully polymerized melanin pigments. Recently a number of genes and their encoded proteins were identified to be involved in the control of this process (Kwon et al., 1987Kwon B.S. Haq A.K. Pomerantz S.H. Halaban R. Isolation and sequence of a cDNA clone for human tyrosinase that maps at the mouse c-albino locus.Proc Natl Acad Sci. 1987; 84: 7473-7477Crossref PubMed Scopus (381) Google Scholar;Park et al., 1993Park H.Y. Russakovsky V. Ohno S. Gilchrest B.A. The beta isoform of protein kinase C stimulates human melanogenesis by activating tyrosinase in pigment cells.J Bio Chem. 1993; 268: 11742-11749PubMed Google Scholar;del Marmol and Beermann, 1996del Marmol V. Beermann F. Tyrosinase and related proteins in mammalian pigmentation.FEBS Lett. 1996; 381: 165-168https://doi.org/10.1016/0014-5793(96)00109-3Abstract Full Text PDF PubMed Scopus (321) Google Scholar;Jimbow et al., 1998Jimbow K. Prota G. Quevedo W.C. Biology of melanocytes.in: Freedberg I.M. Eisen A.Z. Wolff E. Austen K.F. Goldsmith L.A. Katz S.I. Fitzpatrick T.B. Fitzpatrick's Dermatology in General Medicine. 5th edn. McGraw-Hill, 1998: 192-220Google Scholar). Although tyrosinase, the c-locus enzyme, is known to be of great importance, there appear to be a number of genes and encoded proteins that regulate this melanogenesis cascade, e.g., the p-locus and s-locus genes and two tyrosinase gene family proteins, tyrosinase-related proteins 1 and 2 (TRP-1 and TRP-2) (Barton et al., 1988Barton D.E. Kwon B.S. Francke U. Human tyrosinase gene, mapped to chromosome 11 (q14 q21), defines second region of homology with mouse chromosome 7.Genomics. 1988; 3: 17-24Crossref PubMed Scopus (136) Google Scholar;Jackson, 1988Jackson I.J.A. cDNA encoding tyrosinase-related protein maps to the brown locus in mouse.Proc Natl Acad Sci USA. 1988; 85: 4392-4396Crossref PubMed Scopus (204) Google Scholar;Halaban and Moellmann, 1990Halaban R. Moellmann G. Murine and human b locus pigmentation genes encode a glycoprotein (gp75) with catalase activity.Proc Natl Acad Sci USA. 1990; 87: 4809-4813Crossref PubMed Scopus (116) Google Scholar;Vijayasaradhi et al., 1990Vijayasaradhi S. Bouchard B. Houghton A.N. The melanoma antigen gp75 is the human homologue of the mouse b (brown) locus gene product.J Exp Med. 1990; 171: 1375-1380Crossref PubMed Scopus (168) Google Scholar;Kwon et al., 1991Kwon B.S. Chintamaneni C. Kozak C.A. et al.A melanocyte-specific gene, Pmel 17, maps near the silver coat color locus on mouse chromosome 10 and is in a syntenic region on human chromosome 12.Proc Natl Acad Sci. 1991; 88: 9228-9232Crossref PubMed Scopus (130) Google Scholar;Jackson et al., 1992Jackson I.J. Chambers D.M. Tsukamoto K. Copeland N.G. Gilbert D.J. Jenkins N.A. Hearing V. A second tyrosinase-related protein, TRP2, maps to and is mutated at the mouse slaty locus.EMBO (Eur Mol Biol Organ) J. 1992; 11: 527-535PubMed Google Scholar;Rinchik et al., 1993Rinchik E.M. Bultman S.J. Horsthemke B. et al.A gene for the mouse pink-eyed dilution locus and for human type II oculocutaneous albinism.Nature (Lond). 1993; 361: 72-76Crossref PubMed Scopus (309) Google Scholar). Both TRP-1 and TRP-2 possess about 40% amino acid homology with tyrosinase, having similar structural features, e.g., two copper-binding sites, two cysteine-rich regions, a signal peptide region, and a transmembrane anchor domain (Kwon et al., 1987Kwon B.S. Haq A.K. Pomerantz S.H. Halaban R. Isolation and sequence of a cDNA clone for human tyrosinase that maps at the mouse c-albino locus.Proc Natl Acad Sci. 1987; 84: 7473-7477Crossref PubMed Scopus (381) Google Scholar;Muller et al., 1988Muller G. Ruppert S. Schmid E. Schutz G. Functional analysis of alternatively spliced tyrosinase gene transcripts.EMBO (Eur Mol Biol Organ) J. 1988; 7: 2723-2730PubMed Google Scholar;del Marmol and Beermann, 1996del Marmol V. Beermann F. Tyrosinase and related proteins in mammalian pigmentation.FEBS Lett. 1996; 381: 165-168https://doi.org/10.1016/0014-5793(96)00109-3Abstract Full Text PDF PubMed Scopus (321) Google Scholar). TRP-1 and TRP-2 have been shown to be involved primarily in the post-tyrosinase steps of the melanogenesis cascade through dihydroxyindole-2-carboxylic acid (DHICA) oxidase and dopachrome tautomerase activities, respectively, and thus may have important roles in melanin biosynthesis (Tsukamoto et al., 1992Tsukamoto K. Jackson I.J. Urabe K. Montague P.M. Hearing V.J. A second tyrosinase-related protein, TRP2, is a melanogenic enzyme termed DOPAchrome tautomerase.EMBO (Eur Mol Biol Organ) J. 1992; 11: 519-526PubMed Google Scholar;Winder et al., 1993Winder A.J. Wittbjer A. Rosengren E. Rorsman H. The mouse brown (b) locus protein has dopachrome tautomerase activity and is located in lysosomes in transfected fibroblasts.J Cell Sci. 1993; 106: 153-166PubMed Google Scholar,Winder et al., 1994Winder A.J. Wittbjer A. Odh G. Rosengren E. Rorsman H. The mouse brown (b) locus protein functions as a dopachrome tautomerase.Pigment Cell Res. 1994; 7: 305-310Crossref PubMed Scopus (12) Google Scholar;Kobayashi et al., 1994Kobayashi T. Urabe K. Winder A. DHICA oxidase activity of TRP1 and interactions with other melanogenic enzymes.Pigment Cell Res. 1994; 7: 227-234Crossref PubMed Scopus (48) Google Scholar;Yokoyama et al., 1994Yokoyama K. Suzuki H. Yasumoto K.I. Tomita Y. Shibahara S. Molecular cloning and functional analysis of a cDNA coding for human DOPAchrome tautomerase/tyrosinase-related protein-2.Biochim Biophys Acta. 1994; 1217: 317-321Crossref PubMed Scopus (108) Google Scholar;Zhao et al., 1994bZhao H. Zhou Y. Nordlund J.J. Boissy R.E. Human TRP1 has tyrosine hydroxylase but no DOPA oxidase activity.Pigment Cell Res. 1994; 7: 131-140Crossref PubMed Scopus (43) Google Scholar;del Marmol and Beermann, 1996del Marmol V. Beermann F. Tyrosinase and related proteins in mammalian pigmentation.FEBS Lett. 1996; 381: 165-168https://doi.org/10.1016/0014-5793(96)00109-3Abstract Full Text PDF PubMed Scopus (321) Google Scholar;Jimenez-Cervantes et al., 1997Jimenez-Cervantes C. Solano F. Kobayashi T. Urabe K. Hearing V.J. Lozano J.A. GarciaBorron J.C. A new enzymatic function in the melanogenic pathway.J Biol Chem. 1997; 269: 17993-18001Google Scholar). Melanogenesis occurs within a subcellular organelle called the melanosome, which is the site of synthesis as well as deposition of melanin pigments in the melanocyte. The biosynthesis and maturation of melanosomes provide more sites for the regulation of melanogenesis. Early electron microscopy studies revealed four successive stages in the maturation of melanosomes, i.e., stage I, a spherical vacuole with ill-defined matrix filaments; stage II, in which the melanosome changes to the elliptical shape with a well-defined filamentous/lamellar matrix; stage III, an ellipsoidal granule with partial deposition of electron-opaque melanin pigments on these filaments; and stage IV, a mature granule with complete opacification of melanosomal contents by melanin pigments. It is this stage IV melanosome that is ready to be transported to the surrounding keratinocytes (Jimbow et al., 1998Jimbow K. Prota G. Quevedo W.C. Biology of melanocytes.in: Freedberg I.M. Eisen A.Z. Wolff E. Austen K.F. Goldsmith L.A. Katz S.I. Fitzpatrick T.B. Fitzpatrick's Dermatology in General Medicine. 5th edn. McGraw-Hill, 1998: 192-220Google Scholar). The elucidation of the mechanism in the biosynthesis and maturation of melanosomes is important because this process may be exploited for the development of new therapeutic strategies in the cancer of melanocytes, malignant melanoma (Jimbow et al., 1993aJimbow K. Iwashina T. Alena F. Yamada K. Pankovich J. Umemura T. Exploitation of pigment biosynthesis pathway as a selective chemotherapeutic approach for malignant melanoma.J Invest Dermatol. 1993; 100: 231S-238SAbstract Full Text PDF PubMed Google Scholar;Singh et al., 1994Singh M.V. Price K.J. Bhatnagar R. Malhotra S.K. Novel rod-shaped structures identified in glioma cell nuclei by immunolabelling and confocal laser fluorescence microscopy.Biomed Lett. 1994; 50: 163-172Google Scholar). Its alteration may also directly affect the development of certain hyperpigmentary and hypopigmentary diseases; hence this characterization may provide the basis for the development of modalities for diagnosis and treatment of these pigmentary diseases. In order to identify new proteins that would be directly or indirectly involved in the biosynthesis, maturation, and even transfer of melanosomes, this study isolated melanosomal proteins by two-dimensional sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis (2D-PAGE). Reverse transcriptase polymerase chain reaction (RT-PCR) mediated molecular cloning of one gene, corresponding to a spot in 2D-PAGE, demonstrated a strong nucleotide sequence homology with guanosine triphosphate (GTP) binding proteins (Rall and Harris, 1987Rall T. Harris B.A. Identification of the lesion in the stimulatory GTP-binding protein of the uncoupled S49 lymphoma.FEBS Lett. 1987; 224: 365-371Abstract Full Text PDF PubMed Scopus (37) Google Scholar). Here, we show that at least five to six small molecular weight GTP-binding proteins (SMG-binding proteins), i.e., rab3, rab7, and rab8, plus two or three others common to any organelles, are present in the melanosomal fraction, and among them rab7, which has been associated with protein transport to the late endosome, was found to be involved with the transport of TRP-1 to the melanosome. As we are also interested in the transport of melanosomal proteins, we pursued our studies toward understanding TRP-1 transport in relation to rab7. Mouse B16 melanoma cells and human melanoma cell lines G361 and MeWo were obtained from the American Type Culture Collection (ATCC, Rockville, MD). A murine immortal line of melan a2 was kindly supplied by Dr. D.C. Bennet (Bennett et al., 1987Bennett D.C. Cooper P.J. Hart J.R. A line of non-tumorgenic mouse melanocytes syngeneic with the B16 melanoma and requiring a tumor promoter for growth.Int J Cancer. 1987; 39: 414-418Crossref PubMed Scopus (385) Google Scholar). They were grown in RPMI 1640 medium supplemented with 10% (vol/vol) fetal bovine serum and antibiotics (penicillin, 100 U per ml; streptomycin, 100 µg per ml; Gibco, Grand Island, NY) at 37°C in a humidified atmosphere with 5% (vol/vol) CO2. B16 cells (107 per 200 µl phosphate-buffered saline, PBS) were inoculated into C57 BL/6 J (6–8-wk-old) mice subcutaneously, and the melanoma tissues were obtained as previously reported (Jimbow et al., 1982Jimbow K. Jimbow M. Chiba M. Characterization of structural properties for morphological differentiation of melanosomes: II. Electron microscopic and SDS-PAGE comparison of melanosomal matrix proteins in B16 and Harding Passey melanomas.J Invest Dermatol. 1982; 78: 76-81Crossref PubMed Scopus (28) Google Scholar). After about 3 wk the tumors were collected and kept in cold PBS, cut into approximately 3 mm3 pieces, and transplanted to other mice. The tumors were collected after about 3 wk (necrotic tissue was discarded) into PBS and melanosomal fraction was purified from the fresh tumors. Melanosomes and melano somal proteins were purified by our previously reported method (Jimbow et al., 1982Jimbow K. Jimbow M. Chiba M. Characterization of structural properties for morphological differentiation of melanosomes: II. Electron microscopic and SDS-PAGE comparison of melanosomal matrix proteins in B16 and Harding Passey melanomas.J Invest Dermatol. 1982; 78: 76-81Crossref PubMed Scopus (28) Google Scholar) with some modifications. Briefly, 50–60 g of tumor tissue was transferred to 150 ml of a solution (purification buffer) containing 0.5 M sucrose, 4 mM phosphate, pH 6.8, and 2 mM phenylmethylsulfonyl fluoride and minced with scissors. The tissue was homogenized with a Teflon homogenizer. After filtering through the gauze, the homogenate was centrifuged through a 0.5 M sucrose solution at 5000g for 3 min. The supernatant was collected and the centrifugation was repeated twice more. The final supernatant was centrifuged at 25,000g for 10 min and the pelleted large granule fraction (LGF) was collected. The pellet was rinsed twice with the purification buffer and resuspended in 18 ml of the same buffer. The suspension was slightly homogenized to break the aggregated LGF and centrifuged on 1.0–2.0 M discontinuous sucrose density gradient (SDG) at 45,000g for 2 h in a PRS 27-2 rotor (Hitachi Electronic, Japan). The pellet was collected and subjected to the same purification procedure again. The final pellet was processed for the dissociation of melanosomal (and membrane-associated) proteins using different solubilizing buffers followed by centrifugation at 45,000g for 30 min. The supernatant was collected and stored in 90% (vol/vol) acetone in the cold room. The activities of tyrosinase, acid phosphatase, and succinate dehydrogenase were assayed by the methods ofPomerantz, 1963Pomerantz S.H. Separation purification, and properties of two tyrosinases from hamster melanoma.J Biol Chem. 1963; 238: 2351-2357Abstract Full Text PDF PubMed Google Scholar,Trouet, 1974Trouet A. Isolation of modified liver lysosomes.Meth Enzymol. 1974; 31: 323-329Crossref PubMed Scopus (173) Google Scholar, andAckrell et al., 1978Ackrell B.A.C. Kerney E.B. Singer T.P. Mammalian succinate dehydrogenase.Methods Enzymol. 1978; 53: 466-483Crossref PubMed Scopus (220) Google Scholar, respectively. Protein was measured using Bio-Rad (Richmond, CA) protein assay kit using the manufacturer's recommended procedure. A combination of isoelectric focusing and SDS-PAGE was used to resolve proteins in two dimensions, essentially as described byO'Farrell, 1975O'Farrell P.H. High resolution two-dimensional electrophoresis of proteins.J Biol Chem. 1975; 250: 4007-4021Abstract Full Text PDF PubMed Google Scholar. For isoelectric focusing, samples (dissolved in 1% wt/vol SDS) were mixed with the same amount of lysis buffer (9.5 M urea 2% wt/vol, Nonidet P-40 2% vol/vol) and ampholines comprising 1.6% (vol/vol), pH range 5–7, and 0.4% (vol/vol), pH range 3–10. Tube gels used for the first dimension were 11 cm long and had an internal diameter of 4 mm. For the second dimension 10%-12% (vol/vol) SDS-PAGE was used. Gels were visualized by staining with Coomassie-Brilliant Blue (Sigma Chemical, Japan). Spots were excised from the 2D-PAGE gels using a disposable scalpel and pooled. The pieces were crushed with a microhomogenizer, rotated overnight at room temperature with 0.5 ml of 0.1% (wt/vol) SDS, and filtered through 0.45 µm Millipore filter, and the filtrates were lyophilized. The pellet residue was suspended in 200 µl of 5% (wt/vol) cyanogen bromide/80% (vol/vol) formic acid and was rotated overnight at room temperature; 800 µl of H2O was added and the solution was lyophilized. The final lyophilized pellet was suspended in 50 µl of 1% (wt/vol) SDS and boiled for 90 s. After centrifugation at 25,000g for 2 min, the peptides in the supernatant were separated with an Applied Biosystems 130 A reverse phase HPLC (Foster City, CA). Individual fractions were collected manually under ultraviolet monitoring. The amino acid sequence of the resolved peptides was determined by automated Edman degradation in an Applied Biosystems 470 A gas-phase sequencer equipped with a 120 A phenylthiohydantoin analyzer. Oligonucleotides were synthesized corresponding to the peptide sequences using an Applied Biosystems 381 A DNA synthesizer according to the supplier's instruction and purified by Sephadex gel-exclusion column. Total cellular RNA was extracted, following the method essentially as described byChomczynski and Sacchi, 1987Chomczynski P. Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.Anal Biochem. 1987; 162: 156-159Crossref PubMed Scopus (62171) Google Scholar. Five micrograms of total RNA were reversed transcribed using MMLV reverse transcriptase (Stratagene, Ontario, Canada) using 50 μM oligo-dT primer in the presence of 20 units of Rnasin (Promega Biotech, CA). Of the resulting cDNA, 10% served as template for the PCR reaction (amplification of 3′ cDNA) in 100 μl of 1 × AmpliTaq polymerase buffer (Perkin Elmer, Ontario, Canada) in the presence of 50 μM dNTP, 100 pmol oligo-dT (21 mer), and internal primers (CA[A/G] TT[T/C] ATI ACI AA[A/G] AA[T/C] GA[T/C] GG) or ACI ATI III AA(A/G) ACI GA(T/C) GG and 1 unit of AmpliTaq DNA polymerase (Perkin Elmer). The PCR amplification was carried out for 40 cycles (Tyler Research Instruments, Edmonton, Canada). Each cycle included denaturation at 94°C for 1 min, annealing of primers at 60°C for 1 min, and extension at 72°C for 2 min. After the last cycle, the samples were incubated at 72°C for 5 min. The PCR fragments were isolated and cloned into pBluescript KS vector (Stratagene). The cloned fragments were sequenced for both strands with an Applied Biosystems 373 A DNA sequencer (University of Alberta, Canada) using universal primers (Stratagene). Transfer to nitrocellulose and GTP overlay were done according to the method ofHuber et al., 1993bHuber L.A. Pimplikar S. Parton R.G. Virta H. Zerial M. Simons K. Rab8, a small GTPase involved in vesicular traffic between the TGN and the basolateral plasma membrane.J Cell Biol. 1993; 123: 35-45Crossref PubMed Scopus (366) Google Scholar. Briefly, 70–80 µg of total cellular proteins were separated by SDS-PAGE or 2D-PAGE as described above, washed 2 × 15 min in 50 mM Tris-HCl, pH 7.5, in 20% (vol/vol) glycerol solution, and electrophoretically transferred to nitrocellulose paper in 10 mM NaHCO3/3 mM Na2CO3 (pH 9.8). The transfer blots were rinsed for 30 min in GTP-binding buffer (50 mM NaH2PO4), pH 7.5, 10 µM MgCl2, 2 mM dithiothreitol, 0.2% (wt/vol) Tween-20, and 4 µM adenosine-5′-triphosphate (ATP), and then incubated with (α-32P)-GTP (1 µCi per ml, specific activity 2903 Ci per mmol, 1 Ci = 37 Gbq) for 2 h. The blots were rinsed for 60 min with several changes of binding buffer and air dried. Labeled GTP binding was visualized by autoradiography (12–24 h, -80°C) using Kodak Biomax Mr film with an intensifying screen. Molecular masses were determined by comparison with prestained SDS-PAGE molecular weight standards (Bio-Rad), electrophoresed in the gels, and transferred to nitrocellulose blots. For immunoblot analysis, samples were separated in 10% (vol/vol) SDS-PAGE and transferred onto a nitrocellulose membrane (Bio-Rad). The membrane was blocked over night with 5% (wt/vol) milk in TBS (150 mM NaCl, 10 mM Tris-HCl, pH 8.0). The primary antibodies (rab7, a rabbit polyclonal antibody against a synthetic peptide, was a gift from Dr. R. Parton, Germany, and rab3 and rab8 rabbit polyclonal antibodies were from Santa Cruz Biotechnology, CA) and a secondary antibody, affinity purified goat antirabbit horseradish peroxidase (HRP) conjugate (Bio-Rad), were added in the blocking buffer with 0.05% (wt/vol) Tween-20. The bands were visualized with the enhanced chemiluminescence system (ECL; Amersham, U.K.) according to the manufacturer's instructions. Immunoprecipitation was done essentially as described byHara et al., 1994Hara H. Lee M.H. Chen H. Luo D. Jimbow K. Role of gene expression and protein synthesis of tyrosinase, TRP-1, lamp-1, and CD63 in UVB-induced melanogenesis in human melanomas.J Invest Dermatol. 1994; 102: 495-500Crossref PubMed Scopus (35) Google Scholar. Cells were grown on the coverslips or on eight-microchamber slides for 24 h prior to treatment. B16 cells were washed once with PBS (pH 7.4) and permeabilized with 0.5% (wt/vol) saponin in 80 mM K-PIPES (pH 6.8), 5 mM ethylene glycol-bis(β-aminoethyl ether)-N, N, N′,N′-tetraacetic acid, 1 mM MgCl2 for 5 min. The cells were fixed with 3% (wt/vol) paraformaldehyde in PBS for 15 min and the procedure was continued as described byChavrier et al., 1990Chavrier P. Parton R.G. Hauri H.P. Simons K. Zerial M. Localization of low molecular weight GTP-binding proteins to exocytic and endocytic compartments.Cell. 1990; 62: 317-329Abstract Full Text PDF PubMed Scopus (858) Google Scholar. The binding with primary antibodies, HMSA-5 (a monoclonal antibody raised in our laboratory, which recognizes TRP-1) and rab7, was visualized with goat antimouse rhodamine and swine antirabbit fluorescein isothiocyanate (FITC) or with swine antirabbit FITC and goat antimouse Texas Red, respectively, diluted in 0.5% (wt/vol) saponin-PBS for 1–2 h. The slides were given three washes in PBS and one wash in double distilled water, air dried and mounted in glycerol/paraphenylenediamine. For double immunostaining, the addition of HMSA-5 antibody followed after rab7 antibody treatment, but the secondary antibodies were added together. Melanosome pellets were processed for the electron microscopy preparation essentially as described byJimbow et al., 1982Jimbow M. Kanoh H. Jimbow K. Characterization of biochemical properties of melanosomes for structural and functional differentiation: analysis of the compositions of lipids and proteins in melanosomes and their subfractions.J Invest Dermatol. 1982; 79: 97-102Crossref PubMed Scopus (34) Google Scholar. As it has been found that antisense oligonucleotides are most effective when complementary to intron splice sites or initiation codons (Akhtar and Juliano, 1992Akhtar S. Juliano R.L. Cellular uptake and intracellular fate of antisense oligonucleotides.Trends Cell Biol. 1992; 2: 139-144Abstract Full Text PDF PubMed Scopus (186) Google Scholar), the sequence sites selected were centered on the initiation codon ATG (ATG-antisense), and deduced from a canine rab7 cDNA (Chavrier et al., 1990Chavrier P. Parton R.G. Hauri H.P. Simons K. Zerial M. Localization of low molecular weight GTP-binding proteins to exocytic and endocytic compartments.Cell. 1990; 62: 317-329Abstract Full Text PDF PubMed Scopus (858) Google Scholar). The oligonucleotides ATG-antisense 5′ CCTAGAGGTCATCCTTCAAA CGC3 3′ and a reversed-ATG-antisense 5′ GGCGTTTGAAGGATG ACCTAG 3′ were synthesized with sulfurization modification (Bio-Can Scientific, Ontario, Canada). B16 melanoma cells were transfected with the oligonucleotides, following our previously described method (Luo et al., 1994Luo D. Chen H. Jimbow K. Co-transfection of genes encoding human tyrosinase and tyrosinase-related protein-1 prevents melanocyte death and enhances melanin pigmentation and gene expression of Lamp-1.Exp Cell Res. 1994; 213: 231-241https://doi.org/10.1006/excr.1994.1195Crossref PubMed Scopus (36) Google Scholar), with the cationic liposome reagent DOTAP, according to the supplier's instruction (Boehringer Mannheim, Germany). Purification of melanosomes from melanocytes is an important step in isolating the melanosomal proteins to be analyzed. To obtain a sufficient amount of melanosomal proteins, we raised mouse melanoma by injecting B16 melanoma cells into syngeneic C57 BL/6 J mice. Melanosomal fractions from freshly prepared mouse melanoma were prepared by SDG centrifugation (Jimbow et al., 1982Jimbow K. Jimbow M. Chiba M. Characterization of structural properties for morphological differentiation of melanosomes: II. Electron microscopic and SDS-PAGE comparison of melanosomal matrix proteins in B16 and Harding Passey melanomas.J Invest Dermatol. 1982; 78: 76-81Crossref PubMed Scopus (28) Google Scholar). Marker enzyme, tyrosinase, was used to identify melanosomal fraction. Succinate dehydrogenase and acid phosphatase activities were measured to check the contamination, if any, of mitochondria and lysosomes, respectively. Tyrosinase activity was found mostly in the pellet of mature melanosomes, whereas succinate dehydrogenase and acid phosphatase activities were found at the top fractions Fig 1. Electron microscopy observation of the melanosomal pellet showed highly purified and native melanosomes Fig 2, suggesting that the melanosomal fraction might be free of likely contaminants such as mitochondria and lysosomes.Figure 2Electron micrograph of purified melanosomes. Melanosomal pellets from freshly prepared mouse melanoma were prepared by discontinuous SDG centrifugation as explained in Materials and Methods. The highly pigmented melanosomal fraction, devoid of lysosomes and mitochondria, is noted. Bar, 200 nm.View Large Image Figure ViewerDownload (PPT) Next we labeled the melanosomal proteins of cultured B16 melanoma cells with 14C-leucine to analyze the solubility of melanosomal proteins by different detergents to extract the melanosomal proteins. We found that almost all melanosomal proteins can be extracted from melanosomes with the use of 1% (wt/vol) SDS (data not shown). Similar to o
Referência(s)