The Bacterial Histone-like Protein HU Specifically Recognizes Similar Structures in All Nucleic Acids
2002; Elsevier BV; Volume: 277; Issue: 31 Linguagem: Inglês
10.1074/jbc.m201978200
ISSN1083-351X
AutoresAnna Balandina, Dmitri Kamashev, Josette Rouvière‐Yaniv,
Tópico(s)Bacteriophages and microbial interactions
ResumoHU, a major component of the bacterial nucleoid, shares properties with histones, high mobility group proteins (HMGs), and other eukaryotic proteins. HU, which participates in many major pathways of the bacterial cell, binds without sequence specificity to duplex DNA but recognizes with high affinity DNA repair intermediates. Here we demonstrate that HU binds to double-stranded DNA, double-stranded RNA, and linear DNA-RNA duplexes with a similar low affinity. In contrast to this nonspecific binding to total cellular RNA and to supercoiled DNA, HU specifically recognizes defined structures common to both DNA and RNA. In particular HU binds specifically to nicked or gapped DNA-RNA hybrids and to composite RNA molecules such as DsrA, a small non-coding RNA. HU, which modulates DNA architecture, may play additional key functions in the bacterial machinery via its RNA binding capacity. The simple, straightforward structure of its binding domain with two highly flexible β-ribbon arms and an α-helical platform is an alternative model for the elaborate binding domains of the eukaryotic proteins that display dual DNA- and RNA-specific binding capacities. HU, a major component of the bacterial nucleoid, shares properties with histones, high mobility group proteins (HMGs), and other eukaryotic proteins. HU, which participates in many major pathways of the bacterial cell, binds without sequence specificity to duplex DNA but recognizes with high affinity DNA repair intermediates. Here we demonstrate that HU binds to double-stranded DNA, double-stranded RNA, and linear DNA-RNA duplexes with a similar low affinity. In contrast to this nonspecific binding to total cellular RNA and to supercoiled DNA, HU specifically recognizes defined structures common to both DNA and RNA. In particular HU binds specifically to nicked or gapped DNA-RNA hybrids and to composite RNA molecules such as DsrA, a small non-coding RNA. HU, which modulates DNA architecture, may play additional key functions in the bacterial machinery via its RNA binding capacity. The simple, straightforward structure of its binding domain with two highly flexible β-ribbon arms and an α-helical platform is an alternative model for the elaborate binding domains of the eukaryotic proteins that display dual DNA- and RNA-specific binding capacities. double-stranded single-stranded small cytoplasmic RNA RNA recognition motif integration host factor The Escherichia coli HU protein is a major component of the bacterial nucleoid (1Rouviere-Yaniv J. Gros F. Proc. Natl. Acad. Sci. U. S. A. 1975; 72: 3428-3432Crossref PubMed Scopus (250) Google Scholar, 2Rouviere-Yaniv J. Cold Spring Harbor Symp. Quant. Biol. 1978; 42: 439-447Crossref PubMed Google Scholar, 3Wery M. Woldringh C. Rouviere-Yaniv J. Biochimie (Paris). 2001; 83: 193-200Crossref PubMed Scopus (53) Google Scholar). This small basic histone-like protein that can introduce negative supercoiling into a close circular DNA molecule in the presence of topoisomerase I is highly conserved and found in all bacterial species (4Rouviere-Yaniv J. Yaniv M. Germond J.E. Cell. 1979; 17: 265-274Abstract Full Text PDF PubMed Scopus (329) Google Scholar, 5Haselkorn R. Rouviere-Yaniv J. Proc. Natl. Acad. Sci. U. S. A. 1976; 73: 1917-1920Crossref PubMed Scopus (60) Google Scholar, 6Grove A. Galeone A. Maryol L. Geiduschek E.P. J. Mol. Biol. 1996; 260: 196-206Crossref PubMed Scopus (38) Google Scholar, 7Oberto J. Rouviere-Yaniv J. J. Bacteriol. 1996; 178: 293-297Crossref PubMed Google Scholar). HU plays a role in DNA replication, recombination, and repair (8Bramhill D. Kornberg A. Cell. 1988; 54: 915-918Abstract Full Text PDF PubMed Scopus (333) Google Scholar, 9Boubrik F. Rouviere-Yaniv J. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 3958-3962Crossref PubMed Scopus (100) Google Scholar, 10Li S. Waters R. J. Bacteriol. 1998; 180: 3750-3756Crossref PubMed Google Scholar). It participates in Mu transposition (11Lavoie B.D. Shaw G.S. Millner A. Chaconas G. Cell. 1996; 85: 761-771Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar) and regulation of gene transcription (12Aki T. Adhya S. EMBO J. 1997; 16: 3666-3674Crossref PubMed Scopus (154) Google Scholar). HU has been shown to be important for optimal survival of cells in the stationary phase and under various stress conditions (13Claret L. Rouviere-Yaniv J. J. Mol. Biol. 1997; 273: 93-104Crossref PubMed Scopus (149) Google Scholar). HU belongs to the family of architectural nuclear proteins that control DNA topology by introducing bends into double-stranded (ds)1 DNA and stabilize higher-order nucleoprotein complexes. HU resembles eukaryotic proteins of the high mobility group (HMG) class in its DNA binding properties because it binds dsDNA with low affinity and no sequence specificity. In contrast, it displays high affinity for some altered DNA structures such as junctions, nicks, gaps, forks, and overhangs even under stringent salt conditions (14Pontiggia A. Negri A. Beltrame M. Bianchi M.E. Mol. Microbiol. 1993; 7: 343-350Crossref PubMed Scopus (169) Google Scholar, 15Bonnefoy E. Takahashi M. Rouviere-Yaniv J. J. Mol. Biol. 1994; 242: 116-129Crossref PubMed Scopus (125) Google Scholar, 16Castaing B. Zelwer C. Laval J. Boiteux S. J. Biol. Chem. 1995; 270: 10291-10296Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar, 17Kamashev D. Balandina A. Rouviere-Yaniv J. EMBO J. 1999; 18: 5434-5444Crossref PubMed Scopus (81) Google Scholar, 18Pinson V. Takahashi M. Rouviere-Yaniv J. J. Mol. Biol. 1999; 287: 485-497Crossref PubMed Scopus (102) Google Scholar). The DNA structural motif for HU recognition consists of either two dsDNA modules with propensity to be inclined or one dsDNA module adjacent to a ssDNA binding module (19Kamashev D. Rouviere-Yaniv J. EMBO J. 2000; 19: 6527-6535Crossref PubMed Scopus (148) Google Scholar). X-ray crystallography and NMR studies have established the structure of HU dimer in the absence of DNA (20Tanaka I. Appelt K. Dijk J. White S.W. Wilson K.S. Nature. 1984; 310: 376-381Crossref PubMed Scopus (288) Google Scholar, 21White S.W. Wilson K.S. Appelt K. Tanaka I. Acta Crystallogr. Sec. D. 1999; 55: 801-809Crossref PubMed Scopus (52) Google Scholar, 22Vis H. Mariani M. Vorgias C.E. Wilson K.S. Kaptein R. Boelens R. J. Mol. Biol. 1995; 254: 692-703Crossref PubMed Scopus (99) Google Scholar). The two subunits are intertwined to form a compact α-helical hydrophobic core with two extended positively charged β-ribbon arms. Our recent studies suggest that HU contacts duplex DNA via the minor groove with its flexible arms, whereas the high affinity binding to its specific binding motif requires an additional contact with the HU body (19Kamashev D. Rouviere-Yaniv J. EMBO J. 2000; 19: 6527-6535Crossref PubMed Scopus (148) Google Scholar). Similar to histones, HU has been shown to bind to poly(U) homopolymer, 2J. Rouviere-Yaniv, unpublished data. but the role of this abundant protein in RNA binding was underestimated. Recently we have shown that HU binds with high affinity to mRNA fromrpoS, encoding the stress sigma factor of RNA polymerase, and stimulates its translation (23Balandina A. Claret L. Hengge-Aronis R. Rouviere-Yaniv J. Mol. Microbiol. 2001; 39: 1069-1079Crossref PubMed Scopus (104) Google Scholar). Interestingly, in parallel to this work it was shown that HBsu, the HU protein of Bacillus subtilis, specifically binds the Alu domain of a small cytoplasmic RNA (scRNA), a homologue of mammalian signal recognition particle RNA (24Nakamura K. Yahagi S. Yamazaki T. Yamane K. J. Biol. Chem. 1999; 274: 13569-13576Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). In the eukaryotic field, a growing body of evidence shows that a number of proteins including transcriptional factors containing zinc finger or RNA recognition motifs are able to bind specifically to both DNA and RNA (25Engelke D.R., Ng, S.Y. Shastry B.S. Roeder R.G. Cell. 1980; 19: 717-728Abstract Full Text PDF PubMed Scopus (432) Google Scholar, 26Pelham H.R. Brown D.D. Proc. Natl. Acad. Sci. U. S. A. 1980; 77: 4170-4174Crossref PubMed Scopus (345) Google Scholar, 27Honda B.M. Roeder R.G. Cell. 1980; 22: 119-126Abstract Full Text PDF PubMed Scopus (146) Google Scholar, 28Caricasole A. Duarte A. Larsson S.H. Hastie N.D. Little M. Holmes G. Todorov I. Ward A. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 7562-7566Crossref PubMed Scopus (192) Google Scholar, 29Arranz V. Harper F. Florentin Y. Puvion E. Kress M. Ernoult-Lange M. Mol. Cell. Biol. 1997; 17: 2116-2126Crossref PubMed Scopus (29) Google Scholar, 30Hamann S. Stratling W. Nucleic Acids Res. 1998; 26: 4108-4115Crossref PubMed Scopus (13) Google Scholar, 31DeAngelo D.J. DeFalco J. Rybacki L. Childs G. Mol. Cell. Biol. 1995; 15: 1254-1264Crossref PubMed Google Scholar, 32Newberry E.P. Latifi T. Towler D.A. Biochemistry. 1999; 38: 10678-10690Crossref PubMed Scopus (84) Google Scholar, 33Basu A. Dong B. Krainer A.R. Howe C.C. Mol. Cell. Biol. 1997; 17: 677-686Crossref PubMed Scopus (73) Google Scholar). Although HU does not possess any sequence or structural homology to RNA recognition motifs (RRMs) or zinc finger motifs, its small DNA-binding domain formed from two β-ribbon arms and an α-helical core, is able to bind with high specificity to RpoS mRNA (20Tanaka I. Appelt K. Dijk J. White S.W. Wilson K.S. Nature. 1984; 310: 376-381Crossref PubMed Scopus (288) Google Scholar, 21White S.W. Wilson K.S. Appelt K. Tanaka I. Acta Crystallogr. Sec. D. 1999; 55: 801-809Crossref PubMed Scopus (52) Google Scholar, 22Vis H. Mariani M. Vorgias C.E. Wilson K.S. Kaptein R. Boelens R. J. Mol. Biol. 1995; 254: 692-703Crossref PubMed Scopus (99) Google Scholar, 23Balandina A. Claret L. Hengge-Aronis R. Rouviere-Yaniv J. Mol. Microbiol. 2001; 39: 1069-1079Crossref PubMed Scopus (104) Google Scholar). In this study we investigated the general RNA binding features of HU. We measured HU affinity to total cellular RNA and found that HU binds to RNA as strongly as to supercoiled DNA, formerly believed to be the main target for the nucleoid-associated HU (2Rouviere-Yaniv J. Cold Spring Harbor Symp. Quant. Biol. 1978; 42: 439-447Crossref PubMed Google Scholar). The characteristics of HU-nonspecific binding to double-stranded RNA and DNA as well as to simple linear DNA-RNA hybrids are shown to be similar. In contrast, HU binding to discontinuous DNA-RNA structures is much stronger than that to DNA and RNA duplexes and displays the same affinity as with nicked DNA, one of the structures that HU binds specifically. We searched for the structural determinant(s) of HU-RNA recognition using DsrA RNA, a small noncoding stable RNA that modulates the translation of several key transcriptional regulators such RpoS or H-NS (34Sledjeski D. Gottesman S. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 2003-2007Crossref PubMed Scopus (191) Google Scholar, 35Sledjeski D. Gupta A. Gottesman S. EMBO J. 1996; 15: 3993-4000Crossref PubMed Scopus (296) Google Scholar, 36Majdalani N. Cunning C. Sledjeski D. Elliott T. Gottesman S. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 12462-12467Crossref PubMed Scopus (423) Google Scholar, 37Lease R.A. Cusick M.E. Belfort M. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 12456-12461Crossref PubMed Scopus (236) Google Scholar, 38Lease R.A. Belfort M. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 9919-9924Crossref PubMed Scopus (164) Google Scholar). We found that DsrA RNA is one of the specific targets for HU binding. Truncation of DsrA RNA showed that HU bound with high affinity an RNA structure similar to that of a DNA overhang, one of its specific targets on DNA (19Kamashev D. Rouviere-Yaniv J. EMBO J. 2000; 19: 6527-6535Crossref PubMed Scopus (148) Google Scholar). The DNA fragments corresponding to DsrA RNA and DsrA deletion mutants RNA C, D, and E were amplified by PCR using the pDDS164 plasmid (provided by S. Gottesman, Ref. 34Sledjeski D. Gottesman S. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 2003-2007Crossref PubMed Scopus (191) Google Scholar) as a template and appropriate primers. In the case of the smallest RNA-F, two complementary DNA oligonucleotides were annealed. The resulting DNAs were cloned under the control of the T7 promoter into the EcoRI and HindIII sites of pGem3Z (Promega). The [α-32P]RNAs were synthesized from a plasmid linearized with HindIII by in vitrotranscription. Before use, the RNAs were renatured by incubating at 65 °C for 5 min and cooling on ice. For construction of the RNA duplex the DNA synthetic oligonucleotides X1 and Y1 were annealed with their complementary DNA strands and cloned under the control of the T7 promoter into the EcoRI and HindIII sites of pGem3Z. The corresponding α-32P-labeled X and non-labeled Y RNA were prepared from plasmid linearized with HindIII byin vitro transcription. These complementary RNAs were annealed in buffer A (20 mm Tris-HCl, pH 7.5, 100 mm NaCl) by incubation at 80 °C for 3 min followed by slow cooling. For the construction of the DNA-RNA hybrid, the synthetic DNA oligonucleotide H was annealed with α-32P-labeled X RNA in buffer A as described above. The following oligonucleotides X1, Y1, H, and X RNA are: X1, AATTCGGGTAGGAGCCACCTTATGAGGAATTCGCCCA; Y1, AATTCCTCATAAGGTGGCTCCTACCCGAATTCGCCCA; H, TGGGCGAATTCCTC ATAAGGTGGCTCCTACCCGAATTCGCCC; X RNA, GG- GCGAATTCGGGTAGGAGCCACCTTATGAGGAATTCGCCCA. Duplex DNA was constructed from oligonucleotide H, and a complimentary oligonucleotide. DNA containing a nick was constructed from oligonucleotides X, C, and D. 3′-DNA overhang was constructed from oligonucleotides X and C. DNA-RNA nick and 3′-DNA-RNA overhang were constructed as DNA structures, but oligonucleotide C was replaced with the corresponding oligoribonucleotide. Oligonucleotides X and H were 5′-labeled and annealed with appropriate oligonucleotides or oligoribonucleotides in buffer A by incubation at 80 °C for 3 min followed by slow cooling. The following oligonucleotides X, C, and D are: X, AGTCTAGACTGCAGTTGAGTCCTTGCTAGGACGGAT- CCCT; C, A CTCAACTGCAGTCTAGACT (5′-phosphorylated); D, AGGGATCCGTCCTAGCAAG G. Binding assays were carried out as described previously (20Tanaka I. Appelt K. Dijk J. White S.W. Wilson K.S. Nature. 1984; 310: 376-381Crossref PubMed Scopus (288) Google Scholar) in high salt buffer (20 mmTris-HCl, pH 7.5, 200 mm NaCl, 10% glycerol) or in low salt buffer, which had the same ingredients but contained only 10 mm NaCl. Electrophoresis was carried out either in 22.5 or 90 mm Tris borate buffer, pH 8.6, for low or high salt conditions, respectively. Total RNA was prepared by hot phenol extraction of E. coli K-12 C600 cells grown in LB medium to exponential phase. E. coli bulk tRNA was a gift from A. Rak. The supercoiled form of the plasmid pNB1 (Biolabs) was purified on an agarose gel and electroeluted. To prepare the linear DNA sample, the same plasmid was linearized withScaI. HU protein at a final concentration of 13 nm was mixed with 2 fmol of 32P-labeled nicked DNA, and varying concentrations of non-labeled nucleic acids were added in 15 μl of high salt buffer. Samples were analyzed as described previously (23Balandina A. Claret L. Hengge-Aronis R. Rouviere-Yaniv J. Mol. Microbiol. 2001; 39: 1069-1079Crossref PubMed Scopus (104) Google Scholar). At equilibrium, the dissociation constant of the complex formed by one nucleic acid molecule and one HU dimer is given by Equation 1, Kd=[proteinfree]×[nucleic acidfree]/[nucleic acidbound]Equation 1 where [proteinfree] is the concentration of HU not bound to nucleic acid, [nucleic acidfree] is the concentration of the protein binding sites, [nucleic acidbound] is the concentration of the nucleic acid molecules occupied by the protein, and [proteinfree] = [proteintotal] − [proteinbound] and [proteinbound] = [nucleic acidbound]. Finally, [nucleic acidbound] = [nucleic acidtotal] × b/[(f + b) × (number of protein binding sites on nucleic acid molecule)]. For a DNA that is N bp long, the number of binding sites for the ligand that covers L bp, is (N −L + 1) per DNA molecule. The values f and b measured in the experiment are proportional to the concentration of free and bound nucleic acids, respectively, quantified in arbitrary units. The radioactivity of the bands corresponding to f (free) and b (bound) fractions was determined by PhosphorImager analysis of dried gels. Thus, the final equation for calculation of the dissociation constant of the first protein-nucleic acid complex is shown in Equation 2. Kdnonspecific=[proteintotal]×(f/b)×(N−L+1)Equation 2 −[nucleic acidtotal]×(f/(f+b))×(N−L+1)Notice that this equation is adequate for nonspecific binding when the affinity of the protein is the same for any L-bp binding site of an N-bp long nucleic acid. For a nucleic acid molecule containing one specific binding site, if nonspecific interaction is negligible, we have Equation 3. Kdspecific=[proteintotal]×f/b−[nucleic acidtotal]×f/(f+b)Equation 3 The best fit over several protein concentrations was taken asK d . Equation 1 serves as an evaluation of HU dissociation constant for the first complex. Binding of the second HU dimer might be facilitated by the protein-protein interactions that can be measured by the factor of cooperativity, ω. The ω factor is determined as K d1 /K d2 , whereK d1 and K d2 are the dissociation constants of the first and second complexes, respectively. For binding of HU to double-stranded DNA, RNA, and the DNA-RNA hybrid the ω has been determined as described previously (15Bonnefoy E. Takahashi M. Rouviere-Yaniv J. J. Mol. Biol. 1994; 242: 116-129Crossref PubMed Scopus (125) Google Scholar, 18Pinson V. Takahashi M. Rouviere-Yaniv J. J. Mol. Biol. 1999; 287: 485-497Crossref PubMed Scopus (102) Google Scholar). The apparent dissociation constant of HU to non-labeled nucleic acids was calculated as in Equation 4, Kda=[Pfree]×[Afree]/[PA]Equation 4 where [Afree] is the concentration of free non-labeled nucleic acid. Assuming that binding is nonspecific and that the nucleic acid is much longer than a protein binding site, [Afree] is equal to the concentration of base pairs of free nucleic acid. [Pfree] is the concentration of the free protein, and [PA] is the concentration of the protein bound to non-labeled nucleic acid. The protein concentration in the tube [Ptotal] equals [Pa] + [Pn] + [Pfree], where [Pn] is the concentration of the protein bound to labeled nicked DNA. Because nicked DNA concentration is much less than that of non-labeled nucleic acid, then [Pa] = [Ptotal] − [Pfree]. The concentration of total non-labeled nucleic acid is [Atotal] = [Afree] + [Abound]. Because [Abound] = [Pa] × L, where L is the length of the binding site of the protein in bp, then [Afree] = [Atotal] − [Pa] × L. The dissociation constant of HU with nicked DNA isKN = [Pfree] × f/b, where f and b are proportional to the concentrations of free and bound nicked DNA, respectively, and the radioactivity of the bands corresponding to f (free) and b (bound) fractions was determined by PhosphorImager analysis of dried gels. Thus, [Pfree] =KN × b/f, and we have Equations Equation 5, Equation 6, Equation 7, Kda=[Pfree]×[Afree]/[PA]=[Pfree]×{[Atotal]Equation 5 −[Pa]×L}/[PA]=[Pfree]×{[Atotal]/[PA]−L} Kda=[Pfree]×{[Atotal]/([Ptotal]−[Pfree])−L}Equation 6 where [Pfree] = KN × b/f or as in Equation 7. Kda=(KN×b/f)×{[Atotal]/([Ptotal]−KN×b/f)−L}Equation 7 These equations were obtained assuming that the number of binding sites is equal to the length of the nucleic acid. This is the case when DNA is far from saturated with the protein. The saturation of the DNA can be evaluated according to the McGhee-von Hippel equation (39McGhee J.D. von Hippel P.H. J. Mol. Biol. 1974; 86: 469-489Crossref PubMed Scopus (2737) Google Scholar). We estimated that under the experimental conditions used, DNA is far from saturated. Indeed, in our experiments the amount of the competitor added is 100–1000 bp per one HU dimer. HU is one of the most abundant DNA-binding proteins in the bacterial cells. In contrast to its low affinity salt-sensitive binding to duplex linear DNA, HU binds with high affinity to DNA damage and repair intermediates under high salt conditions (19Kamashev D. Rouviere-Yaniv J. EMBO J. 2000; 19: 6527-6535Crossref PubMed Scopus (148) Google Scholar). We also have found recently that HU specifically recognizes the mRNA from rpoS and stimulates its translation (23Balandina A. Claret L. Hengge-Aronis R. Rouviere-Yaniv J. Mol. Microbiol. 2001; 39: 1069-1079Crossref PubMed Scopus (104) Google Scholar). HU affinity to RpoS mRNA fragment is as high as that to nicked DNA, which is 1000-fold higher than that for double-stranded DNA. Because it appears that HU is able to bind DNA and RNA, both nucleic acids may serve as HU binding targets in the cell. This finding prompted us to further investigate the RNA binding properties of HU. We first measured the affinity of HU to the major DNA and RNA species present in the bacterial cell. HU binding to supercoiled and linear DNA as well as to total cellular RNA and tRNA was compared. Gel mobility shift assays can not be applied directly to separate free and bound high molecular weight nucleic acids because plasmid DNA is too bulky to be gel-shifted by HU, and total RNA is too disperse in size to form sharp bands in the gel. To tackle the problem we applied an assay on which one nucleic acid of interest competes with labeled 40-bp nicked DNA for HU binding. HU forms a single complex with the nicked DNA with an apparent dissociation constant (K d ) of 10 nm under stringent salt conditions (16Castaing B. Zelwer C. Laval J. Boiteux S. J. Biol. Chem. 1995; 270: 10291-10296Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar, 17Kamashev D. Balandina A. Rouviere-Yaniv J. EMBO J. 1999; 18: 5434-5444Crossref PubMed Scopus (81) Google Scholar, 18Pinson V. Takahashi M. Rouviere-Yaniv J. J. Mol. Biol. 1999; 287: 485-497Crossref PubMed Scopus (102) Google Scholar). HU was mixed with labeled nicked DNA, and the complex was challenged with increasing amounts of the non-labeled nucleic acid of interest. The progressive decrease in HU-nicked DNA complex upon increase in the concentration of non-labeled DNA or RNA reflects a decrease in the concentration of free HU in the solution as a result of binding to the non-labeled nucleic acid competitor. The comparison of the ratio of complexed and free nicked oligonucleotides in the absence or presence of the competitor provides the concentration of HU bound to the non-labeled nucleic acid. Thus, the dissociation constant of the non-labeled nucleic acid can be calculated on the basis of the known parameters of the HU-nicked DNA interaction as explained under "Experimental Procedures." As a control of this experimental approach, the same nicked DNA was used as a competitor of the labeled nicked DNA (Fig.1 A). The apparent dissociation constant of HU to nicked DNA found in this experiment is 12 nm, a value very close to the K d of 10 nm derived from the classical protein titration experiment (16Castaing B. Zelwer C. Laval J. Boiteux S. J. Biol. Chem. 1995; 270: 10291-10296Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar, 17Kamashev D. Balandina A. Rouviere-Yaniv J. EMBO J. 1999; 18: 5434-5444Crossref PubMed Scopus (81) Google Scholar, 18Pinson V. Takahashi M. Rouviere-Yaniv J. J. Mol. Biol. 1999; 287: 485-497Crossref PubMed Scopus (102) Google Scholar). Using this methodology, we successively measured the dissociation constants for linear and supercoiled DNAs, tRNA, and total RNA (Fig. 1 A). Based on the competition experiment, the apparent dissociation constant of HU to supercoiled DNA was estimated to be 450 nm under stringent conditions (200 mmNaCl, Fig. 1 A). Supercoiled plasmid was used as an example of genomic DNA. The plasmid was used after linearization to estimate the affinity of HU for linear DNA, and a value of K d = 1300 nm was obtained under the same high salt conditions. This apparent dissociation constant accounts for the cooperativity of HU binding and dissociation/association of HU monomers. Thus, HU protein binds supercoiled DNA 3× more strongly than linear DNA of the same length. This is in agreement with previous studies with HU chemical nuclease, which cleaves supercoiled DNA 2.5× faster than relaxed DNA (40Kobryn K. Lavoie B. Chaconas G. J. Mol. Biol. 1999; 289: 777-778Crossref PubMed Scopus (50) Google Scholar). To investigate whether RNA may serve as a potential intracellular HU target, we isolated total bacterial RNA and estimated the affinity of HU using the same technique (Fig. 1 A). The apparent dissociation constant of 2500 nm was calculated as described under "Experimental Procedures" (Fig. 1). Likewise, the affinity of HU affinity to bulk E. coli tRNA was estimated to be 2200 nm. Thus, HU binds the major species of nucleic acids present in bacterial cells with a similar affinity. Finally the graph of bound nicked DNA versus the concentration of the different competitors (Fig. 1 B) shows that the concentration of the nucleic acids species required to reduce the bound nicked DNA corresponds well with the K d (Fig. 1 B). Double-stranded RNA and DNA as well as a DNA-RNA hybrid of 40 bp (all of the same sequence) were constructed. Their binding to HU was studied using the classical gel mobility shift assay. Fig.2 shows first that the gel mobilities of the duplexes of the three different types of nucleic acids (dsDNA, dsRNA, and DNA-RNA) are rather different, probably reflecting the different conformation of the three nucleic acids. These conformations seem to be sensitive to the salt conditions. At high salt the hybrid DNA-RNA migrates the fastest, whereas in low salt dsDNA is faster. Under both sets of conditions, duplex RNA is the most retarded matrix. In terms of binding to HU, under high salt conditions (200 mm NaCl) no complex was detectable with any duplex studied (Fig. 2 A). This was expected for dsDNA because under high salt conditions only a smear is visible because of the dissociation of nonspecific HU linear DNA complexes during their migration in the polyacrylamide gel (19Kamashev D. Rouviere-Yaniv J. EMBO J. 2000; 19: 6527-6535Crossref PubMed Scopus (148) Google Scholar). In contrast, a defined complex could be isolated under low salt conditions with dsDNA having an apparent dissociation constant (K d ) of 450 nm for the first complex and a cooperativity of ω =K d1 /K d2 = 30. One HU dimer occupies 9 bp so that four HU complexes are formed with the 40-bp dsDNA (Fig. 2 B) (41Bonnefoy E. Rouviere-Yaniv J. EMBO J. 1991; 10: 687-696Crossref PubMed Scopus (126) Google Scholar). Fig. 2 B also shows that four HU dimers can be accommodated similarly by 40-bp dsRNA and by the hybrid DNA-RNA. Thus, each HU dimer would cover 9–10 bp of dsRNA in a manner similar to the HU binding on dsDNA. The apparent dissociation constant of the first HU-dsRNA complex is 1800 nm. It is 4-fold higher than that for dsDNA, but the cooperativity of binding is 2.5× higher, ω = 70. Dissociation constants for the second complexesK d2 for dsDNA and RNA are 15 and 25 nm, respectively. The opposing differences in the dissociation constants for the first complexes and cooperativity suggest in fact that HU binds 1.6-fold stronger dsDNA than dsRNA. This result is in agreement with the ratio of affinities obtained in our competition studies performed under stringent salt conditions, which indicated that HU binds linear DNA twice as strongly as total RNA (Fig. 1). A 40-bp DNA-RNA hybrid of the same sequence was also checked for HU binding. Formation of four complexes with the 40-bp hybrid (and three complexes with 30-bp hybrid, data not shown) corresponds also to the binding model of one HU dimer to every 9–10 bp. The apparent dissociation constant of the first complex K d = 450 nm is the same as for dsDNA, the cooperativity being slightly higher, ω = 40. Thus, HU is able to bind dsDNA, dsRNA, and DNA-RNA hybrids with very similar affinities. The conformations of B-DNA and A-RNA are known to differ significantly, while DNA-RNA hybrids were shown to assume an intermediate A/B conformation (42Salazar M. Federoff O.Y. Miller J.M. Ribeiro S.N. Reid B.R. Biochemistry. 1993; 32: 4207-4215Crossref PubMed Scopus (156) Google Scholar). Nevertheless, HU seemed to recognize both the A and B conformations of RNA and DNA duplexes. This wide spectrum of binding can be explained by the high flexibility of HU arms (21White S.W. Wilson K.S. Appelt K. Tanaka I. Acta Crystallogr. Sec. D. 1999; 55: 801-809Crossref PubMed Scopus (52) Google Scholar). HU does not recognize any particular DNA sequence, but it binds (under stringent conditions) with high affinity to some altered DNA structures. The simplest DNA structure that HU binds strongly even in the presence of excess of dsDNA competitor is either a DNA containing a single-stranded break (nicked DNA) or a DNA 3′-overhang (19Kamashev D. Rouviere-Yaniv J. EMBO J. 2000; 19: 6527-6535Crossref PubMed Scopus (148) Google Scholar). The specificity of HU DNA binding was explained by the simultaneous interaction of the HU arms with the 5′ double-stranded part of the molecule and the interaction of HU body with the flexible 3′-branch, which can be either a double- or single-stranded DNA (19Kamashev D. Rouviere-Yaniv J. EMBO J. 2000; 19: 6527-6535Crossref PubMed Scopus (148) Google Scholar). Because we have seen that under low salt conditions HU binds an RNA-DNA hybrid with a similar affinity to which it binds DNA duplex (Fig. 2), we asked whether HU also could specifically recognize both nick and 3′-overhang structures in which one of the DNA strands is replaced with RNA. Both structures are of particular interest because they are DNA replication intermediates (43Kornberg A. Baker T. DNA Replication. 2nd Ed. W. H. Freeman and Co., New York1992: 475-491Google Scholar). In addition, the DNA-RNA 3′-overhang is involved in t
Referência(s)