Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Regulated Proteolytic Processing of Tie1 Modulates Ligand Responsiveness of the Receptor-tyrosine Kinase Tie2

2007; Elsevier BV; Volume: 282; Issue: 42 Linguagem: Inglês

10.1074/jbc.m702535200

ISSN

1083-351X

Autores

Marie B. Marron, Harprit Singh, Tariq A. Tahir, Jais Kavumkal, Hak-Zoo Kim, Gou Young Koh, Nicholas P.J. Brindle,

Tópico(s)

Angiogenesis and VEGF in Cancer

Resumo

Regulated ectodomain shedding followed by intramembrane proteolysis has recently been recognized as important in cell signaling and for degradation of several type I transmembrane proteins. The receptor-tyrosine kinase Tie1 is known to undergo ectodomain cleavage generating a membrane-tethered endodomain. Here we show Tie1 is a substrate for regulated intramembrane proteolysis. After Tie1 ectodomain cleavage the newly formed 45-kDa endodomain undergoes additional proteolytic processing mediated by γ-secretase to generate an amino-terminal-truncated 42-kDa fragment that is subsequently degraded by proteasomal activity. This sequential processing occurs constitutively and is stimulated by phorbol ester and vascular endothelial growth factor. To assess the biological significance of regulated Tie1 processing, we analyzed its effects on angiopoietin signaling. Activation of ectodomain cleavage causes loss of phosphorylated Tie1 holoreceptor and generation of phosphorylated receptor fragments in the presence of cartilage oligomeric protein angiopoietin 1. A key function of γ-secretase is in preventing accumulation of these phosphorylated fragments. We also find that regulated Tie1 processing modulates ligand responsiveness of the Tie-1-associated receptor Tie2. Activation of Tie1 ectodomain cleavage increases cartilage oligomeric protein angiopoietin 1 activation of Tie2. This correlates with increased ability of Tie2 to bind ligand after shedding of the Tie1 extracellular domain. A similar enhancement of ligand activation of Tie2 is seen when Tie1 expression is suppressed by RNA interference. Together these data indicate that Tie1, via its extracellular domain, limits the ability of ligand to bind and activate Tie2. Furthermore the data suggest that regulated processing of Tie1 may be an important mechanism for controlling signaling by Tie2. Regulated ectodomain shedding followed by intramembrane proteolysis has recently been recognized as important in cell signaling and for degradation of several type I transmembrane proteins. The receptor-tyrosine kinase Tie1 is known to undergo ectodomain cleavage generating a membrane-tethered endodomain. Here we show Tie1 is a substrate for regulated intramembrane proteolysis. After Tie1 ectodomain cleavage the newly formed 45-kDa endodomain undergoes additional proteolytic processing mediated by γ-secretase to generate an amino-terminal-truncated 42-kDa fragment that is subsequently degraded by proteasomal activity. This sequential processing occurs constitutively and is stimulated by phorbol ester and vascular endothelial growth factor. To assess the biological significance of regulated Tie1 processing, we analyzed its effects on angiopoietin signaling. Activation of ectodomain cleavage causes loss of phosphorylated Tie1 holoreceptor and generation of phosphorylated receptor fragments in the presence of cartilage oligomeric protein angiopoietin 1. A key function of γ-secretase is in preventing accumulation of these phosphorylated fragments. We also find that regulated Tie1 processing modulates ligand responsiveness of the Tie-1-associated receptor Tie2. Activation of Tie1 ectodomain cleavage increases cartilage oligomeric protein angiopoietin 1 activation of Tie2. This correlates with increased ability of Tie2 to bind ligand after shedding of the Tie1 extracellular domain. A similar enhancement of ligand activation of Tie2 is seen when Tie1 expression is suppressed by RNA interference. Together these data indicate that Tie1, via its extracellular domain, limits the ability of ligand to bind and activate Tie2. Furthermore the data suggest that regulated processing of Tie1 may be an important mechanism for controlling signaling by Tie2. Regulated sequential proteolytic processing has recently emerged as an important mechanism in signal transduction and degradation of transmembrane proteins (1Brown M.S. Ye J. Rawson R.B. Goldstein J.L. Cell. 2000; 100: 391-398Abstract Full Text Full Text PDF PubMed Scopus (1135) Google Scholar, 2Kopan R. Ilagan M.X. Nat. Rev. Mol. Cell Biol. 2004; 5: 499-504Crossref PubMed Scopus (488) Google Scholar). Such processing has been described for a number of transmembrane proteins, including Notch, amyloid precursor protein and the receptortyrosine kinase ErbB-4 and involves an initial metalloprotease-mediated ectodomain shedding followed by secondary cleavage of the remaining membrane-associated fragment (3Lieber T. Kidd S. Young M.W. Genes Dev. 2002; 16: 209-221Crossref PubMed Scopus (189) Google Scholar, 4Brou C. Logeat F. Gupta N. Bessia C. LeBail O. Doedens J.R. Cumano A. Roux P. Black R.A. Israel A. Mol. Cell. 2000; 5: 207-216Abstract Full Text Full Text PDF PubMed Scopus (885) Google Scholar, 5Schroeter E.H. Kisslinger J.A. Kopan R. Nature. 1998; 393: 382-386Crossref PubMed Scopus (1337) Google Scholar, 6Buxbaum J.D. Liu K.N. Luo Y. Slack J.L. Stocking K.L. Peschon J.J. Johnson R.S. Castner B.J. Cerretti D.P. Black R.A. J. Biol. Chem. 1998; 273: 27765-27767Abstract Full Text Full Text PDF PubMed Scopus (833) Google Scholar, 7Lammich S. Kojro E. Postina R. Gilbert S. Pfeiffer R. Jasionowski M. Haass C. Fahrenholz F. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 3922-3927Crossref PubMed Scopus (974) Google Scholar, 8Vecchi M. Carpenter G. J. Cell Biol. 1997; 139: 995-1003Crossref PubMed Scopus (114) Google Scholar). These sequential cleavage events have been designated RIP 4The abbreviations used are: RIP, regulated intramembrane proteolysis; ALLN, N-acetyl-Leu-Leu-Nle-CHO (Nle, norleucine); Ang1, angiopoietin-1; HMEC-1, human microvascular endothelial cells; HUVEC, human umbilical vein endothelial cells; VEGF, vascular endothelial growth factor; VEGFR, VEGF receptor; EGF, epidermal growth factor; PBS, phosphate-buffered saline; PMA, phorbol 12-myristate 13-acetate; siRNA, small interfering RNA; TAPI, tumor necrosis factor-α protease inhibitor.4The abbreviations used are: RIP, regulated intramembrane proteolysis; ALLN, N-acetyl-Leu-Leu-Nle-CHO (Nle, norleucine); Ang1, angiopoietin-1; HMEC-1, human microvascular endothelial cells; HUVEC, human umbilical vein endothelial cells; VEGF, vascular endothelial growth factor; VEGFR, VEGF receptor; EGF, epidermal growth factor; PBS, phosphate-buffered saline; PMA, phorbol 12-myristate 13-acetate; siRNA, small interfering RNA; TAPI, tumor necrosis factor-α protease inhibitor. for regulated intramembrane proteolysis (1Brown M.S. Ye J. Rawson R.B. Goldstein J.L. Cell. 2000; 100: 391-398Abstract Full Text Full Text PDF PubMed Scopus (1135) Google Scholar, 2Kopan R. Ilagan M.X. Nat. Rev. Mol. Cell Biol. 2004; 5: 499-504Crossref PubMed Scopus (488) Google Scholar). The initiating and key regulatory step in RIP is ectodomain cleavage, and in most cases this is catalyzed by members of a disintegrin and metalloprotease (ADAM) family, although matrix metalloproteases and the aspartyl proteases β-site amyloid precursor protein-cleaving enzymes 1 and 2 have also been implicated to a lesser degree (9Blobel C.P. Curr. Opin. Cell Biol. 2000; 12: 606-612Crossref PubMed Scopus (224) Google Scholar, 10Hooper N.M. Turner A.J. Biochem. Soc. Trans. 2000; 28: 441-446Crossref PubMed Google Scholar). For both Notch and ErbB-4 ectodomain shedding requires ADAM17, also known as tumor necrosis factor-α-converting enzyme (TACE) (4Brou C. Logeat F. Gupta N. Bessia C. LeBail O. Doedens J.R. Cumano A. Roux P. Black R.A. Israel A. Mol. Cell. 2000; 5: 207-216Abstract Full Text Full Text PDF PubMed Scopus (885) Google Scholar, 11Rio C. Buxbaum J.D. Peschon J.J. Corfas G. J. Biol. Chem. 2000; 275: 10379-10387Abstract Full Text Full Text PDF PubMed Scopus (264) Google Scholar). This protease has also been implicated in β-amyloid precursor protein cleavage (6Buxbaum J.D. Liu K.N. Luo Y. Slack J.L. Stocking K.L. Peschon J.J. Johnson R.S. Castner B.J. Cerretti D.P. Black R.A. J. Biol. Chem. 1998; 273: 27765-27767Abstract Full Text Full Text PDF PubMed Scopus (833) Google Scholar). After loss of ectodomain, the remaining transmembrane and intracellular domain fragments of RIP substrates are cleaved by the γ-secretase complex to release the intracellular domain into the cytosol (1Brown M.S. Ye J. Rawson R.B. Goldstein J.L. Cell. 2000; 100: 391-398Abstract Full Text Full Text PDF PubMed Scopus (1135) Google Scholar, 2Kopan R. Ilagan M.X. Nat. Rev. Mol. Cell Biol. 2004; 5: 499-504Crossref PubMed Scopus (488) Google Scholar). The γ-secretase complex comprises catalytic presenilin 1 or 2 together with nicastrin, Pen-2, and Aph-1 (12Haass C. Steiner H. Trends Cell Biol. 2002; 12: 556-562Abstract Full Text Full Text PDF PubMed Scopus (158) Google Scholar). Released intracellular domains for some proteins can modulate cell function and for these RIP constitutes a key signal transduction mechanism, communicating events at the plasma membrane with intracellular compartments. For example, once released from the membrane, the intracellular domain of Notch translocates to the nucleus where it modulates transcription (5Schroeter E.H. Kisslinger J.A. Kopan R. Nature. 1998; 393: 382-386Crossref PubMed Scopus (1337) Google Scholar, 13Jarriault S. Brou C. Logeat F. Schroeter E.H. Kopan R. Israel A. Nature. 1995; 377: 355-358Crossref PubMed Scopus (1208) Google Scholar). The receptor-tyrosine kinase Tie1 undergoes regulated ectodomain proteolysis (14Yabkowitz R. Myer S. Yanagihara D. Brankow D. Staley T. Elliot G. Hu S. Ratzkin B. Blood. 1997; 90: 706-715Crossref PubMed Google Scholar). A metalloprotease cleaves the receptor ectodomain, generating a 45-kDa membrane-anchored Tie1 endodomain that comprises the transmembrane and intracellular portions of the receptor (15McCarthy M.J. Burrows R. Bell S.C. Christie G. Bell P.R.F. Brindle N.P.J. Lab. Investig. 1999; 79: 889-895PubMed Google Scholar, 16Yabkowitz R. Meyer S. Black T. Elliott G. Merewether L.A. Yamane H.K. Blood. 1999; 93: 1969-1979Crossref PubMed Google Scholar). It is not known how, or indeed even if this endodomain is further processed. 45-kDa Tie1 endodomain is found in tissues in which angiogenesis and vessel remodeling occurs, such as placenta (15McCarthy M.J. Burrows R. Bell S.C. Christie G. Bell P.R.F. Brindle N.P.J. Lab. Investig. 1999; 79: 889-895PubMed Google Scholar), and it has also been reported in breast tumors (17Yang X.H. Hand R.A. Livasy C.A. Cance W.G. Craven R.J. Tumour Biol. 2003; 24: 61-69Crossref PubMed Scopus (9) Google Scholar). Ectodomain cleavage of Tie1 is stimulated by phorbol ester, vascular endothelial growth factor (VEGF), tumor necrosis factor-α, and changes in shear stress (16Yabkowitz R. Meyer S. Black T. Elliott G. Merewether L.A. Yamane H.K. Blood. 1999; 93: 1969-1979Crossref PubMed Google Scholar, 18Chen-Konak L. Guetta-Shubin Y. Yahav H. Shay-Salit A. Zilberman M. Binah O. Resnick N. FASEB J. 2003; 17: 2121-2123Crossref PubMed Google Scholar). Tie1 is expressed primarily in vascular endothelial cells where it is essential for blood vessel formation and maintenance (19Jones N. Iljin K. Dumont D.J. Alitalo K. Nat. Rev. Mol. Cell Biol. 2001; 2: 257-267Crossref PubMed Scopus (325) Google Scholar). Targeted disruption of the TIE1 gene in mice indicates the receptor has roles in the later stages of blood vessel development where it is required for vessel maturation and stability, and mice deficient in Tie1 die between midgestation and around the time of birth with severe hemorrhage and edema due to vessel wall defects (20Puri M. Rossant J. Alitalo K. Bernstein A. Partanen J. EMBO J. 1995; 14: 5884-5891Crossref PubMed Scopus (411) Google Scholar, 21Sato T. Tozawa Y. Deutsch U. Wolburg-Bucholz K. Fujiwara Y. Gendron-Maguire M. Gridley T. Wolburg H. Risau W. Qin Y. Nature. 1995; 376: 70-74Crossref PubMed Scopus (1488) Google Scholar, 22Patan S. Microvasc. Res. 1998; 56: 1-21Crossref PubMed Scopus (163) Google Scholar). Expression of Tie1 persists in adult vasculature (23Partanen J. Puri M. Schwartz L. Fischer K.-D. Bernstein A. Rossant J. Development. 1996; 122: 3013-3021Crossref PubMed Google Scholar), and it is up-regulated in situations of disturbed flow (24Porat R.M. Grunewald M. Globerman A. Itin A. Barshtein G. Alhonen L. Alitalo K. Keshet E. Circ. Res. 2003; 94: 394-401Crossref PubMed Scopus (67) Google Scholar). Despite its importance, the cellular functions and signaling pathways regulated by this receptor are poorly understood, principally because a ligand capable of binding and activating Tie1 has not yet been identified. However the receptor is known to interact physically with the closely related receptor-tyrosine kinase Tie2, and the two receptors exist in hetero-oligomeric complexes at the cell surface (18Chen-Konak L. Guetta-Shubin Y. Yahav H. Shay-Salit A. Zilberman M. Binah O. Resnick N. FASEB J. 2003; 17: 2121-2123Crossref PubMed Google Scholar, 25Marron M.B. Hughes D.P. Edge M.D. Forder C.L. Brindle N.P.J. J. Biol. Chem. 2000; 275: 39741-39746Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar, 26Saharinen P. Kerkela K. Ekman N. Marron M. Brindle N. Lee G.M. Augustin H. Koh G.Y. Alitalo K. J. Cell Biol. 2005; 169: 239-243Crossref PubMed Scopus (168) Google Scholar). The Tie2 receptor appears to be more active than Tie1 and regulates several endothelial functions including promotion of endothelial survival, migration, and suppression of monolayer permeability (27Peters K.G. Kontos C.D. Lin P.C. Wong A.L. Rao P. Huang L. Dewhirst M.W. Sankar S. Recent Prog. Horm. Res. 2004; 59: 51-71Crossref PubMed Scopus (141) Google Scholar). Tie2 is stimulated by the ligand angiopoietin-1 (Ang1), one of a family of four ligands, Ang1–4, identified for Tie2 (28Davis S. Aldrich T.H. Jones P.F. Acheson A. Compton D.L. Jain V. Ryan T.E. Bruno J. Radziejewski C. Maisonpierre P.C. Yancopoulos G.D. Cell. 1996; 87: 1161-1169Abstract Full Text Full Text PDF PubMed Scopus (1660) Google Scholar, 29Maisonpierre P.C. Suri C. Jones P.F. Bartunkova S. Wiegand S.J. Radziejewski C. Compton D. McClain J. Aldrich T.H. Papadopoulos N. Daly T.J. Davis S. Sato T.N. Yancopoulos G.D. Science. 1997; 277: 55-60Crossref PubMed Scopus (2899) Google Scholar, 30Valenzuela D.M. Griffiths J.A. Rojas J. Aldrich T.H. Jones P.F. Zhou H. McClain J. Copeland N.G. Gilbert D.J. Jenkins N.A. Huang T. Papadopoulos N. Maisonpierre P.C. Davis S. Yancopoulos G.D. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 1904-1909Crossref PubMed Scopus (394) Google Scholar). These secreted glycoproteins have a coiled:coil region in their amino-terminal domain and a carboxyl-terminal fibrinogen-related domain (28Davis S. Aldrich T.H. Jones P.F. Acheson A. Compton D.L. Jain V. Ryan T.E. Bruno J. Radziejewski C. Maisonpierre P.C. Yancopoulos G.D. Cell. 1996; 87: 1161-1169Abstract Full Text Full Text PDF PubMed Scopus (1660) Google Scholar, 29Maisonpierre P.C. Suri C. Jones P.F. Bartunkova S. Wiegand S.J. Radziejewski C. Compton D. McClain J. Aldrich T.H. Papadopoulos N. Daly T.J. Davis S. Sato T.N. Yancopoulos G.D. Science. 1997; 277: 55-60Crossref PubMed Scopus (2899) Google Scholar, 30Valenzuela D.M. Griffiths J.A. Rojas J. Aldrich T.H. Jones P.F. Zhou H. McClain J. Copeland N.G. Gilbert D.J. Jenkins N.A. Huang T. Papadopoulos N. Maisonpierre P.C. Davis S. Yancopoulos G.D. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 1904-1909Crossref PubMed Scopus (394) Google Scholar). Binding to Tie2 occurs via the fibrinogen-related domain, and the coiled: coil motifs are required for homo-oligomerization of the ligands (31Procopio W.N. Pelavin P.I. Lee W.M. Yeilding N.M. J. Biol. Chem. 1999; 274: 30196-30201Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar). Stimulation of Tie2 by Ang1 results in tyrosine phosphorylation of the receptor and activation of downstream signaling intermediates including phosphatidylinositol 3-kinase and Akt (32Kim I. Kim H.G. So J.-S. Kim J.H. Kwak H.J. Koh G.Y. Circ. Res. 2000; 86: 24-29Crossref PubMed Scopus (515) Google Scholar, 33Papapetropoulos A. Fulton D. Mahboubi K. Kalb R.G. O'Connor D.S. Li F. Altieri D.C. Sessa W.C. J. Biol. Chem. 2000; 275: 9102-9105Abstract Full Text Full Text PDF PubMed Scopus (544) Google Scholar). Recently, Ang1 has also been found to activate Tie1 (26Saharinen P. Kerkela K. Ekman N. Marron M. Brindle N. Lee G.M. Augustin H. Koh G.Y. Alitalo K. J. Cell Biol. 2005; 169: 239-243Crossref PubMed Scopus (168) Google Scholar). The ligand appears unable to bind directly to the Tie1 extracellular domain (28Davis S. Aldrich T.H. Jones P.F. Acheson A. Compton D.L. Jain V. Ryan T.E. Bruno J. Radziejewski C. Maisonpierre P.C. Yancopoulos G.D. Cell. 1996; 87: 1161-1169Abstract Full Text Full Text PDF PubMed Scopus (1660) Google Scholar), and the principal route of activation may be via transphosphorylation by Ang1-activated Tie2, although Ang1 is also able to partially activate Tie1 in the absence of Tie2 by an unknown mechanism (26Saharinen P. Kerkela K. Ekman N. Marron M. Brindle N. Lee G.M. Augustin H. Koh G.Y. Alitalo K. J. Cell Biol. 2005; 169: 239-243Crossref PubMed Scopus (168) Google Scholar). Regulated ectodomain cleavage of Tie1 was originally described 10 years ago (14Yabkowitz R. Myer S. Yanagihara D. Brankow D. Staley T. Elliot G. Hu S. Ratzkin B. Blood. 1997; 90: 706-715Crossref PubMed Google Scholar); however, its biological significance still remains unclear. In this study we investigate the possibility that Tie1 may be a new RIP substrate undergoing regulated sequential proteolysis. Furthermore, we seek to define the biological significance of regulated Tie1 processing. Reagents—TAPI-2, lactacystin, and N-acetyl-Leu-Leu-Nle-CHO (ALLN) were purchased from Calbiochem. Sulfo-NHS-SS-biotin was from Pierce. The γ-secretase inhibitors L-685,458 and L-405,484 were kind gifts from Merck Sharp and Dohme (The Neuroscience Research Centre), and L-685,458 was also purchased from Calbiochem. Affinity-purified polyclonal antibodies raised against the carboxyl terminus of Tie1 were obtained from Santa Cruz Biotechnology, Inc. Anti-Tie1 and Tie2 ectodomain antibodies were from R & D Systems. Anti-phospho-Tyr-1102/1108-Tie2 was from Merck, and antibodies against Akt and phospho-Ser-473-Akt were from Cell Signaling Technology. VEGF-A165 was purchased from Pepro-Tech. Comp-Ang1, an Ang1 variant with improved stability, has been described previously (34Cho C.-H. Kammerer R.A. Lee H.J. Steinmetz M.O. Ryu Y.S. Lee S.H. Yasunaga K. Kim K.-T. Kim I. Choi H.-H. Kim W. Kim S.H. Park S.K. Lee G.M. Koh G.Y. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 5547-5552Crossref PubMed Scopus (218) Google Scholar). All other reagents were as described previously (26Saharinen P. Kerkela K. Ekman N. Marron M. Brindle N. Lee G.M. Augustin H. Koh G.Y. Alitalo K. J. Cell Biol. 2005; 169: 239-243Crossref PubMed Scopus (168) Google Scholar). Cells—Human dermal microvascular endothelial cells (HMEC-1) have been described by Ades et al. (35Ades E.W. Candal F.J. Swerlick R.A. George V.G. Summers S. Bosse D.C. Lawley T.J. J. Investig. Dermatol. 1992; 99: 683-690Abstract Full Text PDF PubMed Google Scholar) and were obtained from the Centers for Disease Control and Prevention (Atlanta, GA). HMEC-1 were maintained in MCDB 131 containing 100 μg/ml streptomycin, 100 units/ml penicillin, 10% fetal calf serum, 2 mm l-glutamine, 10 ng/ml EGF, and 1 μg/ml cortisol. Human umbilical vein endothelial cells (HUVEC) were isolated as previously described (25Marron M.B. Hughes D.P. Edge M.D. Forder C.L. Brindle N.P.J. J. Biol. Chem. 2000; 275: 39741-39746Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar) and maintained in Medium 199 containing 100 μg/ml streptomycin, 100 units/ml penicillin, 20% fetal calf serum, 5 units/ml heparin, and 50 μg/ml endothelial cell growth supplement. Before experiments, cells were washed in PBS and incubated in serum-free medium for 30 min. Unless otherwise stated PMA was used at a final concentration of 10 ng/ml, VEGF at 100 ng/ml, L-658,458 at 20 nm, TAPI-2 at 100 μm, lactacystin at 20 μm, ALLN at 10 μm, and COMP-Ang1 at 340 ng/ml. Immunoblotting—Cells were washed in PBS and lysed with ice-cold lysis buffer (50 mm Tris, pH 7.4, 50 mm NaCl, 1 mm sodium fluoride, 1 mm EGTA, 1 mm sodium orthovanadate, 1% TritonX-100, complete protease inhibitor mixture), cleared of particulate material by centrifugation at 13,000 × g for 10 min, and assayed for protein content. In some experiments, indicated under “Results,” the cell-impermeable cross-linker 3,3′-dithiobis(sulfosuccinimidylpropionate) was added to a final concentration of 0.5 mm in PBS for 30 min before quenching with 20 mm Tris in PBS, washing, and cell lysis. For analysis of whole cell proteins, lysates were mixed with Laemmli sample buffer containing 100 mm dithiothreitol and boiled for 5 min. In some cases whole cell lysates were prepared by direct addition of Laemmli sample buffer containing 100 mm dithiothreitol. Equal amounts of protein were resolved by SDS-PAGE. For immunoprecipitates, lysates containing equal amounts of protein were pre-cleared by incubation with protein-G-agarose for 30 min and centrifuged at 13,000 × g for 5 min, and the supernatants were removed and immunoprecipitated by the addition of 2 μg of the indicated antibody for 2–3 h in the presence of protein-G-agarose. Immunoprecipitates were recovered by centrifugation at 13,000 × g for 5 min and washed 3 times with wash buffer (as lysis buffer but with 0.1% Triton X-100). Proteins were eluted by the addition of Laemmli sample buffer containing 100 mm dithiothreitol and boiled for 5 min before SDS/PAGE. Proteins were transferred to nitrocellulose membranes and probed with the antibodies indicated. Immunoreactive proteins were visualized with peroxidase-conjugated secondary antibodies and chemiluminescent detection (36Matthews J.A. Batki A. Hynds C. Kricka L.J. Anal. Biochem. 1985; 151: 205-209Crossref PubMed Scopus (126) Google Scholar). Release of Cell Surface Tie1 Ectodomain—Cells were washed in PBS and incubated for 30 min on ice with 250 ng/ml sulfo-NHS-SS-biotin in PBS to label cell surface proteins. Cells were then washed 3 times in ice-cold medium containing 0.1% bovine serum albumin, and the reaction was quenched in 10 mm HEPES, pH 7.4 150 mm NaCl, 0.7 mm CaCl2, 0.5 mm MgCl2, and rinsed in PBS before incubation at 37 °C in serum-free medium. At the times indicated under “Results” medium was removed and centrifuged, and released biotinylated proteins were recovered by incubation with streptavidin-agarose, resolved by SDS/PAGE, and detected by immunoblotting. Total cell surface-biotinylated receptor was determined by lysing cells at time 0, recovering biotinylated protein, SDS/PAGE, and immunoblotting as above. Receptor Internalization—To measure receptor internalization, cell surface proteins were biotinylated by washing cells in PBS and incubating for 30 min on ice with 250 ng/ml sulfo-NHS-SS-biotin in PBS. Cells were then washed 3 times in ice-cold medium containing 0.1% bovine serum albumin, and the reaction was quenched in 10 mm HEPES, pH 7.4 150 mm NaCl, 0.7 mm CaCl2, 0.5 mm MgCl2, and rinsed in PBS. Internalization was initiated by incubation at 37 °C in serum-free medium. Internalization was terminated by placing cells on ice, and the remaining surface proteins were debiotinylated by incubating for three 20-min periods in 100 mm mercaptoethanesulfonic acid in 50 mm Tris, pH 8.6, 100 mm NaCl, 1 mm EDTA, 0.2% bovine serum albumin. Cells were then washed with Hepes-buffered saline and quenched in 100 mm iodoacetamide for 10 min before washing again in Hepes-buffered saline and cell lysis. Internalized biotinylated proteins were recovered with streptavidin-agarose before SDS/PAGE and immunoblotting. Immunofluorescence—Receptors were examined at the cell surface by immunofluorescence. To aid in visualization, receptors were patched using a technique similar to that described by Constantinescu et al. (37Constantinescu S.N. Keren T. Socolovsky M. Nam H.-S. Henis Y.I. Lodish H.F. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 4379-4384Crossref PubMed Scopus (212) Google Scholar), except endogenous receptors were examined. Essentially, endothelial cells were grown on cover-slips as previously described (38Price C.J. Brindle N.P.J. Arterioscler. Thromb. Vasc. Biol. 2000; 20: 2051-2056Crossref PubMed Scopus (43) Google Scholar). After treatment with control vehicle or PMA, as indicated under “Results,” cells were placed on ice, medium was removed, and cells were washed in ice-cold PBS and incubated for 10 min in ice-cold blocking medium (Dulbecco's modified Eagle's medium containing 2% (w/v) bovine serum albumin and 2% donkey serum). Tie1 or Tie2 were labeled by the addition of antibodies recognizing receptor ectodomains in blocking medium and incubated for 40 min on ice before washing in Dulbecco's modified Eagle's medium and incubation with fluorescently labeled secondary antibody for 40 min. After washing cells were fixed in 4% (w/v) formalin and viewed under an Olympus BH2 microscope with epifluorescence. Images were captured by CCD camera (Digital Pixel) and IP Lab Software (Scanalytics). siRNA Transfections—Annealed, purified, and desalted double-stranded siRNA oligonucleotides against Tie1 (AGGAGAAGCAGACAGACGUGAUCUGGA), Tie2 (CGAACCAUGAAGAUGCGUCAACAAGCU), and control randomized siRNA (AGUCCAUAAUGAGAAUCAACCGAUUAU) were obtained from MWG Biotech. In experiments with siRNA-transfected cells, endothelial cells at ∼80% confluence were transfected with 100 nm siRNA using Lipofectamine as directed in the manufacturer's protocol 48 h before treatments and cell lysis. Transfection efficiency was greater than 90% as judged by rhodamine-conjugated double-stranded siRNA. Tie1 has been reported to undergo regulated proteolytic cleavage of its extracellular domain to generate a cell-associated receptor fragment of ∼45 kDa composed of the transmembrane and intracellular domains (14Yabkowitz R. Myer S. Yanagihara D. Brankow D. Staley T. Elliot G. Hu S. Ratzkin B. Blood. 1997; 90: 706-715Crossref PubMed Google Scholar, 15McCarthy M.J. Burrows R. Bell S.C. Christie G. Bell P.R.F. Brindle N.P.J. Lab. Investig. 1999; 79: 889-895PubMed Google Scholar, 16Yabkowitz R. Meyer S. Black T. Elliott G. Merewether L.A. Yamane H.K. Blood. 1999; 93: 1969-1979Crossref PubMed Google Scholar). In experiments aimed at determining whether any additional truncation products were generated in cells, we noted the presence of another Tie1 immunoreactive species of ∼42 kDa on prolonged exposure of immunoblots in which proteins have been well resolved. An example of this is shown in Fig. 1A for HMEC-1 cells stimulated with PMA. The doublet of ∼145 kDa, representing an upper band of fully glycosylated surface-expressed and a lower band of intracellular partially glycosylated full-length Tie1 destined for the cell surface as well as the 45-kDa truncation product has been described previously (14Yabkowitz R. Myer S. Yanagihara D. Brankow D. Staley T. Elliot G. Hu S. Ratzkin B. Blood. 1997; 90: 706-715Crossref PubMed Google Scholar, 15McCarthy M.J. Burrows R. Bell S.C. Christie G. Bell P.R.F. Brindle N.P.J. Lab. Investig. 1999; 79: 889-895PubMed Google Scholar, 16Yabkowitz R. Meyer S. Black T. Elliott G. Merewether L.A. Yamane H.K. Blood. 1999; 93: 1969-1979Crossref PubMed Google Scholar). Consistent with previous reports we find PMA to stimulate loss of the upper 145-kDa band and increased 45-kDa Tie1 (Fig. 1A). In addition, a 42-kDa protein was observed in both control and stimulated cells, although the level was consistently higher in stimulated cells. Similar observations were made with HUVEC after activation with VEGF (Fig. 1B). Again, VEGF stimulated loss of the upper 145-kDa Tie1 band, although not as extensively as PMA treatment, as well as increasing 45-kDa Tie1. It is noteworthy that scanning blots from a number of experiments revealed a slight decrease in the intracellular, lower 145-kDa Tie1 band in response to both PMA and VEGF (Fig. 1, A and B, lower panels). Presumably this reflects increased mobilization of this precursor form to the cell surface and subsequent cleavage. The 42-kDa protein was present at low levels compared with full-length and 45-kDa Tie1. Under basal conditions the upper 145-, lower 145-, 45-, and 42-kDa forms of Tie1 accounted for 36.4 ± 2.4, 36.6 ± 1.9, 21.2 ± 3.9, and 5.6 ± 2 (mean and standard error) of total Tie1 respectively, determined by densitometric scanning of blots from 7 different experiments. The finding of a 42-kDa form of Tie1 suggested that the 45-kDa Tie1 endodomain may undergo further proteolytic processing. Recent studies have revealed that for a number of proteins that undergo ectodomain shedding the resulting endodomain is subjected to additional proteolytic cleavage, giving rise to further truncation products (39Song W. Nadeau P. Yuan M. Yang X. Shen J. Yankner B.A. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 6959-6963Crossref PubMed Scopus (309) Google Scholar, 40Ray W.J. Yao M. Mumm J. Schroeter E.H. Saftig P. Wolfe M. Selkoe D.J. Kopan R. Goate A.M. J. Biol. Chem. 1999; 274: 36801-36807Abstract Full Text Full Text PDF PubMed Scopus (236) Google Scholar, 41De Strooper B. Annaert W. Cupers P. Saftig P. Craessaerts K. Mumm J.S. Schroeter E.H. Schrijvers V. Wolfe M.S. Ray W.J. Goate A. Kopan R. Nature. 1999; 398: 518-522Crossref PubMed Scopus (1775) Google Scholar, 42Annaert W.G. Levesque L. Craessaerts K. Dierinck I. Snellings G. Westaway D. George-Hyslop P.S. Cordell B. Fraser P. De Strooper B. J. Cell Biol. 1999; 147: 277-294Crossref PubMed Scopus (274) Google Scholar, 43Murphy M.P. Hickman L.J. Eckman C.B. Uljon S.N. Wang R. Golde T.E. J. Biol. Chem. 1999; 274: 11914-11923Abstract Full Text Full Text PDF PubMed Scopus (146) Google Scholar, 44Ni C.Y. Murphy M.P. Golde T.E. Carpenter G. Science. 2001; 294: 2179-2181Crossref PubMed Scopus (745) Google Scholar, 45Lee H.J. Jung K.M. Huang Y.Z. Bennett L.B. Lee J.S. Mei L.

Referência(s)