Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

The Islet β Cell-enriched MafA Activator Is a Key Regulator of Insulin Gene Transcription

2005; Elsevier BV; Volume: 280; Issue: 12 Linguagem: Inglês

10.1074/jbc.m409475200

ISSN

1083-351X

Autores

Li Zhao, Min Guo, Taka‐aki Matsuoka, Derek Hagman, Susan Parazzoli, Vincent Poitout, Roland Stein,

Tópico(s)

Metabolism, Diabetes, and Cancer

Resumo

The islet-enriched MafA, PDX-1, and BETA2 activators contribute to both β cell-specific and glucose-responsive insulin gene transcription. To investigate how these factors impart activation, their combined impact upon insulin enhancer-driven expression was first examined in non-β cell line transfection assays. Individual expression of PDX-1 and BETA2 led to little or no activation, whereas MafA alone did so modestly. MafA together with PDX-1 or BETA2 produced synergistic activation, with even higher insulin promoter activity found when all three proteins were present. Stimulation was attenuated upon compromising either MafA transactivation or DNA-binding activity. MafA interacted with endogenous PDX-1 and BETA2 in coimmunoprecipitation and in vitro GST pull-down assays, suggesting that regulation involved direct binding. Dominant-negative acting and small interfering RNAs of MafA also profoundly reduced insulin promoter activity in β cell lines. In addition, MafA was induced in parallel with insulin mRNA expression in glucose-stimulated rat islets. Insulin mRNA levels were also elevated in rat islets by adenoviral-mediated expression of MafA. Collectively, these results suggest that MafA plays a key role in coordinating and controlling the level of insulin gene expression in islet β cells. The islet-enriched MafA, PDX-1, and BETA2 activators contribute to both β cell-specific and glucose-responsive insulin gene transcription. To investigate how these factors impart activation, their combined impact upon insulin enhancer-driven expression was first examined in non-β cell line transfection assays. Individual expression of PDX-1 and BETA2 led to little or no activation, whereas MafA alone did so modestly. MafA together with PDX-1 or BETA2 produced synergistic activation, with even higher insulin promoter activity found when all three proteins were present. Stimulation was attenuated upon compromising either MafA transactivation or DNA-binding activity. MafA interacted with endogenous PDX-1 and BETA2 in coimmunoprecipitation and in vitro GST pull-down assays, suggesting that regulation involved direct binding. Dominant-negative acting and small interfering RNAs of MafA also profoundly reduced insulin promoter activity in β cell lines. In addition, MafA was induced in parallel with insulin mRNA expression in glucose-stimulated rat islets. Insulin mRNA levels were also elevated in rat islets by adenoviral-mediated expression of MafA. Collectively, these results suggest that MafA plays a key role in coordinating and controlling the level of insulin gene expression in islet β cells. Insulin is selectively expressed in the pancreatic β cells of the islet of Langerhans. Restricted expression is due to a unique combination of factors that stimulate through conserved enhancer region sequences located approximately between nucleotides -340 and -90 relative to the transcription start site (1Karlsson O. Edlund T. Moss J.B. Rutter W.J. Walker M.D. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 8819-8823Crossref PubMed Scopus (184) Google Scholar, 2Shieh S.Y. Tsai M.J. J. Biol. Chem. 1991; 266: 16708-16714Abstract Full Text PDF PubMed Google Scholar, 3Whelan J. Poon D. Weil P.A. Stein R. Mol. Cell. Biol. 1989; 9: 3253-3259Crossref PubMed Scopus (88) Google Scholar, 4Crowe D.T. Tsai M.J. Mol. Cell. Biol. 1989; 9: 1784-1789Crossref PubMed Scopus (103) Google Scholar). Detailed analysis has revealed that activation is primarily controlled by PAX6, PDX-1, MafA, and BETA2 binding to the C2 (-317 to -311 bp), A3 (-201 to -196 bp), C1 (-126 to -101 bp), and E1 (-100 to -91 bp) elements, respectively (5Ohneda K. Ee H. German M. Semin. Cell Dev. Biol. 2000; 11: 227-233Crossref PubMed Scopus (106) Google Scholar, 6Melloul D. Marshak S. Cerasi E. Diabetologia. 2002; 45: 309-326Crossref PubMed Scopus (276) Google Scholar). These distinct factors are enriched in islet cells, with BETA2 (7Naya F.J. Stellrecht C.M. Tsai M.J. Genes Dev. 1995; 9: 1009-1019Crossref PubMed Scopus (523) Google Scholar, 8Naya F.J. Huang H.P. Qiu Y. Mutoh H. DeMayo F.J. Leiter A.B. Tsai M.J. Genes Dev. 1997; 11: 2323-2334Crossref PubMed Scopus (851) Google Scholar) and PAX6 (9Sander M. Neubuser A. Kalamaras J. Ee H.C. Martin G.R. Ger-man M.S. Genes Dev. 1997; 11: 1662-1673Crossref PubMed Scopus (459) Google Scholar) present in all islet cell types, PDX-1 in β and a subset of δ cells (10Guz Y. Montminy M.R. Stein R. Leonard J. Gamer L.W. Wright C.V. Teitelman G. Development. 1995; 121: 11-18Crossref PubMed Google Scholar), and only the recently isolated MafA protein exclusively in β cells (11Olbrot M. Rud J. Moss L.G. Sharma A. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 6737-6742Crossref PubMed Scopus (261) Google Scholar, 12Kataoka K. Han S.I. Shioda S. Hirai M. Nishizawa M. Handa H. J. Biol. Chem. 2002; 277: 49903-49910Abstract Full Text Full Text PDF PubMed Scopus (242) Google Scholar, 13Matsuoka T.A. Zhao L. Artner I. Jarrett H.W. Friedman D. Means A. Stein R. Mol. Cell. Biol. 2003; 23: 6049-6062Crossref PubMed Scopus (258) Google Scholar). Although MafA appears to be the major regulator of C1-mediated activation (11Olbrot M. Rud J. Moss L.G. Sharma A. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 6737-6742Crossref PubMed Scopus (261) Google Scholar, 12Kataoka K. Han S.I. Shioda S. Hirai M. Nishizawa M. Handa H. J. Biol. Chem. 2002; 277: 49903-49910Abstract Full Text Full Text PDF PubMed Scopus (242) Google Scholar, 13Matsuoka T.A. Zhao L. Artner I. Jarrett H.W. Friedman D. Means A. Stein R. Mol. Cell. Biol. 2003; 23: 6049-6062Crossref PubMed Scopus (258) Google Scholar), the closely related MafB protein is found in a fraction of islet β cells in vivo and is capable of activating insulin transcription in vitro (13Matsuoka T.A. Zhao L. Artner I. Jarrett H.W. Friedman D. Means A. Stein R. Mol. Cell. Biol. 2003; 23: 6049-6062Crossref PubMed Scopus (258) Google Scholar). PDX-1, MafA, and BETA2 also control glucose-regulated transcription of the insulin gene, the principal metabolic regulator of β cell function (8Naya F.J. Huang H.P. Qiu Y. Mutoh H. DeMayo F.J. Leiter A.B. Tsai M.J. Genes Dev. 1997; 11: 2323-2334Crossref PubMed Scopus (851) Google Scholar, 14Marshak S. Totary H. Cerasi E. Melloul D. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 15057-15062Crossref PubMed Scopus (153) Google Scholar, 15Petersen H.V. Peshavaria M. Pedersen A.A. Philippe J. Stein R. Madsen O.D. Serup P. FEBS Lett. 1998; 431: 362-366Crossref PubMed Scopus (73) Google Scholar, 16Sharma A. Stein R. Mol. Cell. Biol. 1994; 14: 871-879Crossref PubMed Google Scholar, 17Zhao L. Cissell M.A. Henderson E. Colbran R. Stein R. J. Biol. Chem. 2000; 275: 10532-10537Abstract Full Text Full Text PDF PubMed Scopus (34) Google Scholar). Gene ablation experiments performed in mice on pax6, pdx-1, and BETA2 have established a critical function for each in pancreatic development. Thus, PDX-1 is essential for the growth of the endocrine and exocrine compartments, with pancreatic development arresting at the early post-bud stage in homozygous pdx-1 mutant mice, resulting in pancreatic agenesis (18Jonsson J. Carlsson L. Edlund T. Edlund H. Nature. 1994; 371: 606-609Crossref PubMed Scopus (1562) Google Scholar, 19Offield M.F. Jetton T.L. Labosky P.A. Ray M. Stein R.W. Magnuson M.A. Hogan B.L. Wright C.V. Development. 1996; 122: 983-995Crossref PubMed Google Scholar). In contrast, the loss of PAX6 and BETA2 affects only islet cell development, with the number of α cells dramatically reduced in pax6 gene knock-out mice (9Sander M. Neubuser A. Kalamaras J. Ee H.C. Martin G.R. Ger-man M.S. Genes Dev. 1997; 11: 1662-1673Crossref PubMed Scopus (459) Google Scholar), and a severe, but general loss in total islet cell number in the absence of BETA2 (7Naya F.J. Stellrecht C.M. Tsai M.J. Genes Dev. 1995; 9: 1009-1019Crossref PubMed Scopus (523) Google Scholar, 8Naya F.J. Huang H.P. Qiu Y. Mutoh H. DeMayo F.J. Leiter A.B. Tsai M.J. Genes Dev. 1997; 11: 2323-2334Crossref PubMed Scopus (851) Google Scholar). Human heterozygous carriers of dysfunctional mutations in PAX6 (20Yasuda T. Kajimoto Y. Fujitani Y. Watada H. Yamamoto S. Watarai T. Umayahara Y. Matsuhisa M. Gorogawa S. Kuwayama Y. Tano Y. Yamasaki Y. Hori M. Diabetes. 2002; 51: 224-230Crossref PubMed Scopus (127) Google Scholar), BETA2 (21Malecki M.T. Jhala U.S. Antonellis A. Fields L. Doria A. Orban T. Saad M. Warram J.H. Montminy M. Krolewski A.S. Nat. Genet. 1999; 23: 323-328Crossref PubMed Scopus (510) Google Scholar), and PDX-1 (22Stoffers D.A. Ferrer J. Clarke W.L. Habener J.F. Nat. Genet. 1997; 17: 138-139Crossref PubMed Scopus (8) Google Scholar) also contribute to the development of type 2 diabetes, presumably due to direct effects on the transcription of genes associated with β cell identity (i.e. β-glucokinase, islet amyloid polypeptide, glucose transporter type 2, as well as insulin (23Moates J.M. Nanda S. Cissell M.A. Tsai M.J. Stein R. Diabetes. 2003; 52: 403-408Crossref PubMed Scopus (61) Google Scholar, 24Watada H. Kajimoto Y. Miyagawa J. Hanafusa T. Hamaguchi K. Matsuoka T. Yamamoto K. Matsuzawa Y. Kawamori R. Yamasaki Y. Diabetes. 1996; 45: 1826-1831Crossref PubMed Google Scholar, 25Waeber G. Thompson N. Nicod P. Bonny C. Mol. Endocrinol. 1996; 10: 1327-1334Crossref PubMed Scopus (325) Google Scholar, 26Serup P. Jensen J. Andersen F.G. Jorgensen M.C. Blume N. Holst J.J. Madsen O.D. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9015-9020Crossref PubMed Scopus (130) Google Scholar, 27Chakrabarti S.K. James J.C. Mirmira R.G. J. Biol. Chem. 2002; 277: 13286-13293Abstract Full Text Full Text PDF PubMed Scopus (256) Google Scholar, 28Cissell M.A. Zhao L. Sussel L. Henderson E. Stein R. J. Biol. Chem. 2003; 278: 751-756Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar)). Unfortunately, the role MafA plays in β cell development has not been determined. However, a significant part is strongly suggested by the exclusive presence of MafA in developing islet insulin producing cells and adult islet β cells (13Matsuoka T.A. Zhao L. Artner I. Jarrett H.W. Friedman D. Means A. Stein R. Mol. Cell. Biol. 2003; 23: 6049-6062Crossref PubMed Scopus (258) Google Scholar, 29Matsuoka T.A. Artner I. Henderson E. Means A. Sander M. Stein R. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 2930-2933Crossref PubMed Scopus (233) Google Scholar), its importance in pdx-1 (30Samaras S.E. Zhao L. Means A. Henderson E. Matsuoka T.A. Stein R. J. Biol. Chem. 2003; 278: 12263-12270Abstract Full Text Full Text PDF PubMed Scopus (53) Google Scholar) and insulin gene transcription (11Olbrot M. Rud J. Moss L.G. Sharma A. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 6737-6742Crossref PubMed Scopus (261) Google Scholar, 12Kataoka K. Han S.I. Shioda S. Hirai M. Nishizawa M. Handa H. J. Biol. Chem. 2002; 277: 49903-49910Abstract Full Text Full Text PDF PubMed Scopus (242) Google Scholar, 13Matsuoka T.A. Zhao L. Artner I. Jarrett H.W. Friedman D. Means A. Stein R. Mol. Cell. Biol. 2003; 23: 6049-6062Crossref PubMed Scopus (258) Google Scholar, 29Matsuoka T.A. Artner I. Henderson E. Means A. Sander M. Stein R. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 2930-2933Crossref PubMed Scopus (233) Google Scholar), and the general association of proteins in the large Maf family with developmental processes (i.e. MafB (31Blanchi B. Kelly L.M. Viemari J.C. Lafon I. Burnet H. Bevengut M. Tillmanns S. Daniel L. Graf T. Hilaire G. Sieweke M.H. Nat. Neurosci. 2003; 6: 1091-1100Crossref PubMed Scopus (148) Google Scholar), c-Maf (32Kim J.I. Li T. Ho I.C. Grusby M.J. Glimcher L.H. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 3781-3785Crossref PubMed Scopus (196) Google Scholar, 33MacLean H.E. Kim J.I. Glimcher M.J. Wang J. Kronenberg H.M. Glimcher L.H. Dev. Biol. 2003; 262: 51-63Crossref PubMed Scopus (72) Google Scholar), and NRL (34Mears A.J. Kondo M. Swain P.K. Takada Y. Bush R.A. Saunders T.L. Sieving P.A. Swaroop A. Nat. Genet. 2001; 29: 447-452Crossref PubMed Scopus (710) Google Scholar)). Islet-enriched activator binding promotes the assembly of the insulin transcription complex. This process is mediated by interactions between activators themselves and by contact with the RNA polymerase II transcriptional apparatus, or indirectly through bridging coactivators. Thus, PDX-1 and BETA2 binding to the p300 coactivator or its paralogue p300/cAMP response element binding protein-binding protein (CBP) 1The abbreviations used are: CBP, p300/cAMP response element binding protein-binding protein; LUC, luciferase; CMV, cytomegalovirus; aa, amino acid(s); GST, glutathione S-transferase; AdV, adenovirus; siRNA, small interference RNA; E, embryonic day.1The abbreviations used are: CBP, p300/cAMP response element binding protein-binding protein; LUC, luciferase; CMV, cytomegalovirus; aa, amino acid(s); GST, glutathione S-transferase; AdV, adenovirus; siRNA, small interference RNA; E, embryonic day. provides a docking and recruitment interface with the general transcriptional machinery (27Chakrabarti S.K. James J.C. Mirmira R.G. J. Biol. Chem. 2002; 277: 13286-13293Abstract Full Text Full Text PDF PubMed Scopus (256) Google Scholar, 35Qiu Y. Guo M. Huang S. Stein R. Mol. Cell. Biol. 2002; 22: 412-420Crossref PubMed Scopus (155) Google Scholar, 36Qiu Y. Sharma A. Stein R. Mol. Cell. Biol. 1998; 18: 2957-2964Crossref PubMed Scopus (122) Google Scholar). In this study, MafA was found to functionally interact with PDX-1 and BETA2 to promote synergistic activation of insulin enhancer-driven reporter activity in non-β cells. MafA was also shown to play a direct and principal role in insulin gene activation in β cell lines, although p300/CBP was not involved in this response. In addition, insulin mRNA levels were found to increase in conjunction with MafA in rat islets. Our results suggest that MafA-mediated signaling is important for high level expression of the insulin gene in β cells. DNA Constructs—The -238 insulin-firefly luciferase (LUC) expression plasmids contain wild-type rat insulin II gene sequences from bp -238 to +2 and PDX-1 (A3 and A1 (37Peshavaria M. Gamer L. Henderson E. Teitelman G. Wright C.V. Stein R. Mol. Endocrinol. 1994; 8: 806-816Crossref PubMed Scopus (139) Google Scholar)), BETA2 (E1 (38Robinson G.L. Peshavaria M. Henderson E. Shieh S.Y. Tsai M.J. Teitelman G. Stein R. J. Biol. Chem. 1994; 269: 2452-2460Abstract Full Text PDF PubMed Google Scholar)), or MafA (C1 (29Matsuoka T.A. Artner I. Henderson E. Means A. Sander M. Stein R. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 2930-2933Crossref PubMed Scopus (233) Google Scholar)) binding mutations. The construction of the cytomegalovirus (CMV) enhancer-driven MafA (13Matsuoka T.A. Zhao L. Artner I. Jarrett H.W. Friedman D. Means A. Stein R. Mol. Cell. Biol. 2003; 23: 6049-6062Crossref PubMed Scopus (258) Google Scholar), PDX-1 (39Peshavaria M. Henderson E. Sharma A. Wright C.V. Stein R. Mol. Cell. Biol. 1997; 17: 3987-3996Crossref PubMed Scopus (85) Google Scholar), and BETA2 (36Qiu Y. Sharma A. Stein R. Mol. Cell. Biol. 1998; 18: 2957-2964Crossref PubMed Scopus (122) Google Scholar) expression vectors was described previously. MafA135-359 was made by PCR from wild type mouse MafA and subcloned into the polylinker of the CMV-driven expression vector, pcDNA3.1/Zeo(+) (Invitrogen). The arginine to alanine mutant at amino acid 265 in MafA was constructed in the CMV:MafA 1-359 vector using the QuikChange™ site-directed mutagenesis kit (top: 5′-CCGACTGAAACAGAAGGCGCGCACGCTCAAG-3′; the mutated nucleotides are underlined) (Stratagene). GST:MafA chimeras of full-length, amino acids (aa) 1-233, and aa 233-359 of mouse MafA were generated by in-frame fusion with the glutathione S-transferase (GST) coding sequences in the pGEM-KG bacterial expression vector (Amersham Biosciences). The Gal4:MafA chimeras containing sequences from aa 1-359 (i.e. full-length) or aa 1-233 were constructed by subcloning PCR-amplified mouse MafA fragments into pSG424 (40Lillie J.W. Green M.R. Nature. 1989; 338: 39-44Crossref PubMed Scopus (471) Google Scholar) to create in-frame GAL4 DNA binding domain:MafA fusion proteins. The construction of the GAL4:BETA2 constructs containing the hamster full-length (1-355) or aa 156-355 of BETA2 were described previously (36Qiu Y. Sharma A. Stein R. Mol. Cell. Biol. 1998; 18: 2957-2964Crossref PubMed Scopus (122) Google Scholar). The CMV-driven wild type and p300 dl10 mutant (deletion of aa 1680-1811) have also been described (41Lee J.S. Galvin K.M. See R.H. Eckner R. Livingston D. Moran E. Shi Y. Genes Dev. 1995; 9: 1188-1198Crossref PubMed Scopus (281) Google Scholar). The adenovirus type 5 E1A expression plasmid encodes for the wild type 243-aa protein. The adenovirus-5 expressing MafA under the control of the CMV enhancer/promoter (AdV-CMV) was generated using the mouse MafA cDNA as described previously (42Kelpe C.L. Moore P.C. Parazzoli S.D. Wicksteed B. Rhodes C.J. Poitout V. J. Biol. Chem. 2003; 278: 30015-30021Abstract Full Text Full Text PDF PubMed Scopus (190) Google Scholar). The correctness of each construct was verified by restriction enzyme digestion and DNA sequence analysis. Small interfering RNAs (siRNA) of MafA were expressed from the RNA polymerase III H1 gene promoter in the pSUPER mammalian expression vector (43Brummelkamp T.R. Bernards R. Agami R. Science. 2002; 296: 550-553Crossref PubMed Scopus (3963) Google Scholar). The targeted regions of murine MafA mRNA were selected using the online program available from Ambion Inc. (www.ambion.com/techlib/misc/siRNA_finder.html), and labeled relative to the nucleotides spanned from the ATG translation start codon. The following oligonucleotides were used for cloning into pSUPER (the MafA sequences are underlined): +64/+84 bp, 5′-GATCCCCAACGACTTCGACCTGATGAAGTTCAAGAGACTTCATCAGGTCGAAGTCGTTTTTTTGGAAA-3′; +82/+102, 5′-GATCCCCAAGTTCGAGGTGAAGAAGGAGTTCAAGAGACTCCTTCTTCACCTCGAACTTTTTTTGGAAA-3′; +955/+975, 5′-GATCCCCAAATACGAGAAGTTGGCGGGCTTCAAGAGAGCCCGCCAACTTCTCGTATTTTTTTTGGAAA-3′; +1054/+1074, 5′-GATCCCCAAAGGCGCACCCGACTTCTTTTTCAAGAGAAAAGAAGTCGGGTGCGCCTTTTTTTTGGAAA-3′. Cell Line Transfections and Rat Islet Isolation—The non-β (HeLa and HEK293) and β (βTC3 and MIN6) cell lines were grown in Dulbecco's modified Eagle's medium in the presence of 10% heat-inactivated fetal calf serum, 25 mm glucose, penicillin (100 units/ml), and streptomycin (100 μg/ml). Insulin -238 LUC (0.25 μg) was transfected with MafA, PDX-1, and/or BETA2 expression vectors (0.25 μg/each) using the Lipofectamine procedure (Invitrogen). The CMV-driven Renilla luciferase expression plasmid phRL-TK (Promega) was used as a recovery marker (2 ng), with 1 μg of total DNA used for each point. The Dual Luciferase assay (Promega) was performed 40-48 h after transfection according to the manufacturer's directions. Each experiment was repeated at least four times using at least two different plasmid preparations. Rat islets were isolated by collagenase digestion from 6-week-old male Wistar rats (Harlan Sprague-Dawley, Indianapolis, IL) as described previously (44Briaud I. Harmon J.S. Kelpe C.L. Segu V.B. Poitout V. Diabetes. 2001; 50: 315-321Crossref PubMed Scopus (254) Google Scholar). After an overnight culture in RPMI 1640 containing 10% heat-inactivated fetal bovine serum, 100 units/ml penicillin, 100 μg/ml streptomycin, and 11 mm glucose, the islets were resuspended in fresh medium and incubated at 37 °C under the experimental conditions described in the figure legend. Immunoprecipitation and Western Blotting—βTC3 cells were lysed in radioimmune precipitation assay buffer (10 mm Tris-HCl, pH 8.0, 140 mm NaCl, 0.025% NaN3, 0.5% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 1 mm phenylmethylsulfonyl fluoride, 2 μg of aprotinin per milliliter), whereas rat islets were sonicated in ice-cold cell lysis buffer (50 mm HEPES (pH 7.5), 1% (v/v) Nonidet P-40, 2 mm activated sodium orthovanadate, 100 mm sodium fluoride, 10 mm sodium pyrophosphate, 4 mm EDTA, 1 mm phenylmethylsulfonyl fluoride, 1 μg/ml leupeptin, 1 μg/ml aprotinin). Cellular debris was removed from the lysed islet samples by centrifugation (14,000 rpm, 10 min, 4 °C). Extract protein was incubated overnight at 4 °C with normal rabbit immunoglobulin G (IgG) or affinity-purified anti-MafA peptide antiserum (Bethyl Laboratories, Inc., Montgomery, TX (13Matsuoka T.A. Zhao L. Artner I. Jarrett H.W. Friedman D. Means A. Stein R. Mol. Cell. Biol. 2003; 23: 6049-6062Crossref PubMed Scopus (258) Google Scholar)). The proteins were immunoprecipitated with protein A-Sepharose beads (Sigma), washed three times with radioimmune precipitation assay buffer, subjected to SDS-polyacrylamide gel electrophoresis, and then electrotransferred onto Immobilon polyvinylidene difluoride membrane (Millipore, Bedford, MA). The blot was incubated for 1 h at 4 °C in blocking buffer (10 mm Tris, pH 8.0, 150 mm NaCl, 0.05% Tween 20, and 5% nonfat dry milk) and then at 4 °C overnight with either PDX-1, BETA2 (Santa Cruz Biotechnology Inc.), MafA (Bethyl Laboratories, TX), and TATA-binding protein (Santa Cruz Biotechnology Inc.) antiserum. The PDX-1 polyclonal antiserum was developed to N-terminal region (aa 1-75) epitopes (39Peshavaria M. Henderson E. Sharma A. Wright C.V. Stein R. Mol. Cell. Biol. 1997; 17: 3987-3996Crossref PubMed Scopus (85) Google Scholar). In the MafA siRNA experiment in 293 cells, lysates from CMV:MafA (100 ng)- and MafA siRNA-pSUPER (1 μg)-transfected cells were blotted and analyzed using anti-MafA antiserum. Antibody detection was performed using enhanced chemiluminescence (Pierce Biotechnology) after incubation with a horseradish peroxidase-conjugated secondary antibody. In Vitro Translation and GST Binding Assays—GST:MafA 1-359, GST:MafA 1-233, and GST:MafA 233-359 fusion proteins were prepared as specified by the manufacturer (Amersham Biosciences). Translation reactions were performed using the TnT in vitro translation kit (Promega, Madison, WI.) with CMV:PDX-1, CMV:BETA2, and l-[35S]methionine. Labeled proteins were incubated with GST:MafA coupled to glutathione-Sepharose beads (Amersham Biosciences) for 1 h in binding buffer (50 mm Tris·HCl, pH 8.0, 150 mm NaCl, 0.1% Nonidet P-40, 2 mm EDTA, 10 mm MgCl2, 20 μm ZnCl2). The beads were washed four times with binding buffer, and the bound protein complexes were eluted with 1× gel loading buffer (50 mm Tris-HCl (pH 6.8), 100 mm dithiothreitol, 2% SDS, 0.1% bromphenol blue, 10% glycerol), resolved by SDS-10% polyacrylamide gel electrophoresis, and visualized by fluorography. Electrophoretic Mobility Shift Assay—Batches of 350-500 islets each were washed in phosphate-buffered saline, resuspended in 400 μl of cold hypotonic buffer (10 mm HEPES (pH 7.9), 10 mm KCl, 1.5 mm MgCl2, 0.5 mm dithiothreitol, 0.1 mm EDTA, 0.1 mm EGTA, 0.5 mm phenylmethylsulfonyl fluoride, 0.5 μg/ml aprotinin, 10 μg/ml leupeptin, 1 μg/ml pepstatin), and allowed to swell on ice for 15 min before adding 25 μl of 10% (w/v) Nonidet P-40. After vortexing vigorously, the nuclei were pelleted by centrifugation (14,000 rpm, 1 min, and 4 °C) and resuspended in 50 μl of high salt buffer (20 mm HEPES (pH 7.9), 0.4 m NaCl, 0.2 mm dithiothreitol, 0.1 mm EDTA, 0.1 mm EGTA, 1 mm phenylmethylsulfonyl fluoride, 0.5 μg/ml aprotinin, 10 μg/ml leupeptin, and 1 μg/ml pepstatin) (17Zhao L. Cissell M.A. Henderson E. Colbran R. Stein R. J. Biol. Chem. 2000; 275: 10532-10537Abstract Full Text Full Text PDF PubMed Scopus (34) Google Scholar). Gel shift binding reactions (20 μl) were conducted with 5-10 μg of nuclear extract protein and radiolabeled probe at room temperature for 30 min in the binding buffer (5% (v/v) glycerol, 1 mm EDTA, 50 mm NaCl, 10 mm Tris-HCl pH 7.5, 1 mm dithiothreitol, 0.5 μg/μl poly(dI-dC)). Double-stranded oligonucleotide probes corresponding to the rat insulin II C1 (-126 TGGAAACTGCAGCTTCAGCCCCTCT -101) and E1 (-104 TCTGGCCATCTGCTGGATCCT -85) elements were annealed and labeled by end filling with the DNA Polymerase Large (Klenow) Fragment Kit (Promega) and [α-32P]dCTP (PerkinElmer Life Sciences). The identities of the MafA- and BETA2-containing complexes were determined by wild type element competition as well as super-shift analyses with α-MafA antisera. The binding complexes were resolved by electrophoretic separation on a 4.5% non-denaturing polyacrylamide gel and visualized by autoradiography. Measurement of Preproinsulin mRNA Levels—Duplicate batches of 100 islets each were infected overnight with 105 plaque-forming units per islet of the CMV-driven MafA (AdV-MafA) or the firefly luciferase (AdV-Luc (45Wicksteed B. Herbert T.P. Alarcon C. Lingohr M.K. Moss L.G. Rhodes C.J. J. Biol. Chem. 2001; 276: 22553-22558Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar)) control adenovirus in RPMI 1640 containing 10% fetal bovine serum and 11.1 mm glucose. Islets were then transferred to fresh RPMI 1640 containing 10% fetal bovine serum and 16.7 mm glucose, and incubated at 37 °C for 72 h. Total cellular RNA was isolated using the TRIzol reagent (Invitrogen) and treated with the MessageClean kit to remove DNA (Gene Hunter Corp., Nashville, TN). The ribonuclease protection assay (RPA) was carried out with a 360-bp sequence of the rat II preproinsulin gene and a conserved 245-bp sequence of the mouse β-actin gene using the Direct Protect Lysate RPA kit (Ambion, Austin, TX) (42Kelpe C.L. Moore P.C. Parazzoli S.D. Wicksteed B. Rhodes C.J. Poitout V. J. Biol. Chem. 2003; 278: 30015-30021Abstract Full Text Full Text PDF PubMed Scopus (190) Google Scholar), with the TaqMan-based reverse transcription-PCR performed using oligonucleotides to the rat preproinsulin II and β-actin coding sequences described previously (45Wicksteed B. Herbert T.P. Alarcon C. Lingohr M.K. Moss L.G. Rhodes C.J. J. Biol. Chem. 2001; 276: 22553-22558Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar). This analysis was conducted with several independently treated islet preparations. Statistical Analysis—The significance of the experimental findings was determined using analysis of variance with the least significance difference test (SAS9.1 statistical software, SAS Institute Inc, Carry, NC). A p value of <0.05 was considered significant. MafA Cooperates with PDX-1 and BETA2 to Induce Insulin-driven Transcription—Preventing PDX-1, BETA2, or MafA binding drastically reduces insulin enhancer-driven expression in β cells, suggesting that these factors act in a synergistic fashion to mediate transcription. Although the exact mechanisms involved in control are unclear, experiments performed in non-β cells imply that PDX-1 and BETA2 act together to cooperatively activate expression, a process augmented by the non-DNA binding p300 coactivator (27Chakrabarti S.K. James J.C. Mirmira R.G. J. Biol. Chem. 2002; 277: 13286-13293Abstract Full Text Full Text PDF PubMed Scopus (256) Google Scholar, 35Qiu Y. Guo M. Huang S. Stein R. Mol. Cell. Biol. 2002; 22: 412-420Crossref PubMed Scopus (155) Google Scholar, 36Qiu Y. Sharma A. Stein R. Mol. Cell. Biol. 1998; 18: 2957-2964Crossref PubMed Scopus (122) Google Scholar). Interestingly, MafA was recently shown to be the only islet-enriched transcription factor that is first expressed in the insulin-producing progenitors that eventually populate the islet (29Matsuoka T.A. Artner I. Henderson E. Means A. Sander M. Stein R. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 2930-2933Crossref PubMed Scopus (233) Google Scholar). In contrast, PDX-1 and BETA2 are synthesized earlier and in a broader range of islet-hormone-producing cell types (8Naya F.J. Huang H.P. Qiu Y. Mutoh H. DeMayo F.J. Leiter A.B. Tsai M.J. Genes Dev. 1997; 11: 2323-2334Crossref PubMed Scopus (851) Google Scholar, 10Guz Y. Montminy M.R. Stein R. Leonard J. Gamer L.W. Wright C.V. Teitelman G. Development. 1995; 121: 11-18Crossref PubMed Google Scholar, 19Offield M.F. Jetton T.L. Labosky P.A. Ray M. Stein R.W. Magnuson M.A. Hogan B.L. Wright C.V. Development. 1996; 122: 983-995Crossref PubMed Google Scholar, 46Ahlgren U. Jonsson J. Edlund H. Development. 1996; 122: 1409-1416Crossref PubMed Google Scholar). MafA is also capable of independently inducing endogenous insulin gene expression in an islet α cell line (αTC-6 (29Matsuoka T.A. Artner I. Henderson E. Means A. Sander M. Stein R. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 2930-2933Crossref PubMed Scopus (233) Google Scholar)). These data imply that MafA serves a unique role in mediating insulin gene expression. To test if MafA functionally interacts with other islet-enriched insulin activators, PDX-1 and BETA2 expression constructs were cotransfected with MafA and insulin enhancer/promoter-driven -238 LUC reporter constructs. These experiments were conducted in HeLa cells, a non-pancreatic cell line that does not produce insulin or islet-enriched transcription factors. As expected, wild type -238 LUC activity was not influenced by either PDX-1 or BETA2 alone (35Qiu Y. Guo M. Huang S. Stein R. Mol. Cell. Biol. 2002; 22: 412-420Crossref PubMed Scopus (155) Google Scholar), with MafA able to independently stimulate ∼20-fold (Fig. 1) (13Matsuoka T.A. Zhao L. Artner I. Jarrett H.W. Friedman D. Means A. Stein R. Mol. Cell. Biol. 2003; 23: 6049-6062Crossref PubMed Scopus (258) Google Scholar). Transactivation was stimulated in a synergistic manner when MafA was combined with either PDX-1 (Fig. 1B) or BETA2 (Fig. 1C). Additional enhancement of insulin-driven activity was also observed in the presence of all three factors (Fig. 1D). In general, PDX-1-, BETA2-, and MafA-mediated stimulation was dependent upon activator binding, because cooperativity with MafA was essentially lost in the PDX-1 (Fig. 1B, compare -238 WT responsiveness to the A3 and A1 mutants) and BETA2 (Fig. 1C) binding site mutants, whereas activation by MafA was greatly reduced in the C1 mutant (Fig. 1D). Cooperativity was also attenuated in MafA mutants deficient in activation (i.e. MafA 135-3

Referência(s)