The Vitamin K-dependent Carboxylase Has Been Acquired by Leptospira Pathogens and Shows Altered Activity That Suggests a Role Other than Protein Carboxylation
2005; Elsevier BV; Volume: 280; Issue: 41 Linguagem: Inglês
10.1074/jbc.m504345200
ISSN1083-351X
AutoresMark A. Rishavy, Kevin W. Hallgren, Anna V. Yakubenko, Richard L. Zuerner, Kurt W. Runge, Kathleen L. Berkner,
Tópico(s)Leptospirosis research and findings
ResumoLeptospirosis is an emerging infectious disease whose pathology includes a hemorrhagic response, and sequencing of the Leptospira interrogans genome revealed an ortholog of the vitamin K-dependent (VKD) carboxylase as one of several hemostatic proteins present in the bacterium. Until now, the VKD carboxylase was known to be present only in the animal kingdom (i.e. metazoans that include mammals, fish, snails, and insects), and this restricted distribution and high sequence similarity between metazoan and Leptospira orthologs strongly suggests that Leptospira acquired the VKD carboxylase by horizontal gene transfer. In metazoans, the VKD carboxylase is bifunctional, acting as an epoxidase that oxygenates vitamin K to a strong base and a carboxylase that uses the base to carboxylate Glu residues in VKD proteins, rendering them active in hemostasis and other physiologies. In contrast, the Leptospira ortholog showed epoxidase but not detectable carboxylase activity and divergence in a region of identity in all known metazoan VKD carboxylases that is important to Glu interaction. Furthermore, although the mammalian carboxylase is regulated so that vitamin K epoxidation does not occur unless Glu substrate is present, the Leptospira VKD epoxidase showed unfettered epoxidation in the absence of Glu substrate. Finally, human VKD protein orthologs were not detected in the L. interrogans genome. The combined data, then, suggest that Leptospira exapted the metazoan VKD carboxylase for some use other than VKD protein carboxylation, such as using the strong vitamin K base to drive a new reaction or to promote oxidative damage or depleting vitamin K to indirectly inhibit host VKD protein carboxylation. Leptospirosis is an emerging infectious disease whose pathology includes a hemorrhagic response, and sequencing of the Leptospira interrogans genome revealed an ortholog of the vitamin K-dependent (VKD) carboxylase as one of several hemostatic proteins present in the bacterium. Until now, the VKD carboxylase was known to be present only in the animal kingdom (i.e. metazoans that include mammals, fish, snails, and insects), and this restricted distribution and high sequence similarity between metazoan and Leptospira orthologs strongly suggests that Leptospira acquired the VKD carboxylase by horizontal gene transfer. In metazoans, the VKD carboxylase is bifunctional, acting as an epoxidase that oxygenates vitamin K to a strong base and a carboxylase that uses the base to carboxylate Glu residues in VKD proteins, rendering them active in hemostasis and other physiologies. In contrast, the Leptospira ortholog showed epoxidase but not detectable carboxylase activity and divergence in a region of identity in all known metazoan VKD carboxylases that is important to Glu interaction. Furthermore, although the mammalian carboxylase is regulated so that vitamin K epoxidation does not occur unless Glu substrate is present, the Leptospira VKD epoxidase showed unfettered epoxidation in the absence of Glu substrate. Finally, human VKD protein orthologs were not detected in the L. interrogans genome. The combined data, then, suggest that Leptospira exapted the metazoan VKD carboxylase for some use other than VKD protein carboxylation, such as using the strong vitamin K base to drive a new reaction or to promote oxidative damage or depleting vitamin K to indirectly inhibit host VKD protein carboxylation. The vitamin K-dependent (VKD) 2The abbreviations used are: VKD, vitamin K-dependent; Gla, γ-carboxylated glutamic acid; ORF, open reading frame; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid; BES, N,N-bis[2-hydroxyethyl]-2-aminoethanesulfonic acid. carboxylase converts Glu residues to γ-carboxylated Glu (or Gla) residues in VKD proteins. In mammals this post-translational modification is required for VKD protein activities in a wide range of physiologies that includes hemostasis, calcium homeostasis, and growth control (1Berkner K.L. Runge K.W. J. Thromb. Haemost. 2004; 2: 2118-2132Crossref PubMed Scopus (145) Google Scholar). VKD protein carboxylation cannot occur in the absence of reduced vitamin K, as the carboxylase uses the energy of oxygenation of the reduced vitamin K to drive Glu carboxylation. Combined chemical modeling and biochemical studies indicate that the carboxylase deprotonates reduced vitamin K to generate a highly reactive vitamin K intermediate (K- in Fig. 1) with sufficient basicity (pKa ∼25) to deprotonate Glu (2Dowd P. Hershline R. Ham S.W. Naganathan S. Science. 1995; 269: 1684-1691Crossref PubMed Scopus (112) Google Scholar). This Glu carbanion is then carboxylated to Gla by the addition of CO2 while the vitamin K base is protonated to form the vitamin K epoxide product. The carboxylase, then, acts as both a vitamin K epoxidase and a Glu carboxylase and so is a bifunctional enzyme. The carboxylase is characterized by complex interactions with VKD proteins. All mammalian VKD proteins contain a high affinity carboxylase-binding site, usually a propeptide that is cleaved subsequent to carboxylation, that targets them to the carboxylase. Propeptide tethering results in processive carboxylation so that multiple Glu residues in the Gla domains of VKD proteins are all converted to Gla residues (3Stenina O. Pudota B.N. McNally B.A. Hommema E.L. Berkner K.L. Biochemistry. 2001; 40: 10301-10309Crossref PubMed Scopus (32) Google Scholar, 4Morris D.P. Stevens R.D. Wright D.J. Stafford D.W. J. Biol. Chem. 1995; 270: 30491-30498Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar). Full carboxylation transforms the Gla domain into a calcium binding module that promotes binding of the VKD proteins to cell surfaces that contain exposed anionic phospholipids or to hydroxyapatite. Carboxylation was first discovered in mammals; however, more recent studies show that carboxylase activity that depends upon vitamin K is also present in nonmammalian organisms, namely the marine snail Conus and Drosophila (5Bandyopadhyay P.K. Garrett J.E. Shetty R.P. Keate T. Walker C.S. Olivera B.M. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 1264-1269Crossref PubMed Scopus (92) Google Scholar, 6Czerwiec E. Begley G.S. Bronstein M. Stenflo J. Taylor K. Furie B.C. Furie B. Eur. J. Biochem. 2002; 269: 6162-6172Crossref PubMed Scopus (45) Google Scholar, 7Li T. Yang C.T. Jin D. Stafford D.W. J. Biol. Chem. 2000; 275: 18291-18296Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar, 8Walker C.S. Shetty R.P. Clark K.A. Kazuko S.G. Letsou A. Olivera B.M. Bandyopadhyay P.K. J. Biol. Chem. 2001; 276: 7769-7774Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). Conus venom contains short VKD peptides that paralyze prey by antagonizing neurotransmission (5Bandyopadhyay P.K. Garrett J.E. Shetty R.P. Keate T. Walker C.S. Olivera B.M. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 1264-1269Crossref PubMed Scopus (92) Google Scholar, 6Czerwiec E. Begley G.S. Bronstein M. Stenflo J. Taylor K. Furie B.C. Furie B. Eur. J. Biochem. 2002; 269: 6162-6172Crossref PubMed Scopus (45) Google Scholar, 9Blandl T. Warder S.E. Prorok M. Castellino F.J. FEBS Lett. 2000; 470: 139-146Crossref PubMed Scopus (29) Google Scholar). The Conus VKD peptides and mammalian VKD proteins exhibit the same overall organization, i.e. they have a propeptide that is immediately upstream of the Gla domain. However, there is no obvious homology between Conus and mammals in either of these two domains. Nonetheless, interspecies cross-reactivity occurs: the Conus carboxylase can carboxylate a pentapeptide (FLEEL) derived from the mammalian Gla domain as well as a mammalian-derived propeptide-containing substrate (6Czerwiec E. Begley G.S. Bronstein M. Stenflo J. Taylor K. Furie B.C. Furie B. Eur. J. Biochem. 2002; 269: 6162-6172Crossref PubMed Scopus (45) Google Scholar). The Drosophila VKD carboxylase has also been shown to carboxylate FLEEL (7Li T. Yang C.T. Jin D. Stafford D.W. J. Biol. Chem. 2000; 275: 18291-18296Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar). Drosophila VKD proteins have not been identified, however, and so the functional consequences of VKD carboxylation in this organism are currently unknown. An important point regarding the Conus and Drosophila carboxylase orthologs is that in both cases they use vitamin K epoxidation to drive Glu carboxylation. Therefore, the fundamental role of vitamin K in these organisms is the same as that in mammals. Until now, the VKD carboxylase was known to be present only in multicellular organisms. Although vitamin K is found in some bacteria and plants, it is used there in respiration or photosynthesis, respectively, and VKD proteins are not present in these organisms. It was therefore a surprise when a VKD carboxylase ortholog was observed in the bacterial pathogen Leptospira interrogans (serovars Lai and Copenhageni) as a consequence of genome sequencing projects (10Nascimento A.L. Ko A.I. Martins E.A. Monteiro-Vitorello C.B. Ho P.L. Haake D.A. Verjovski-Almeida S. Hartskeerl R.A. Marques M.V. Oliveira M.C. Menck C.F. Leite L.C. Carrer H. Coutinho L.L. Degrave W.M. Dellagostin O.A. El-Dorry H. Ferro E.S. Ferro M.I. Furlan L.R. Gamberini M. Giglioti E.A. Goes-Neto A. Goldman G.H. Goldman M.H. Harakava R. Jeronimo S.M. Junqueira-de-Azevedo I.L. Kimura E.T. Kuramae E.E. Lemos E.G. Lemos M.V. Marino C.L. Nunes L.R. de Oliveira R.C. Pereira G.G. Reis M.S. Schriefer A. Siqueira W.J. Sommer P. Tsai S.M. Simpson A.J. Ferro J.A. Camargo L.E. Kitajima J.P. Setubal J.C. Van Sluys M.A. J. Bacteriol. 2004; 186: 2164-2172Crossref PubMed Scopus (340) Google Scholar, 11Ren S.X. Fu G. Jiang X.G. Zeng R. Miao Y.G. Xu H. Zhang Y.X. Xiong H. Lu G. Lu L.F. Jiang H.Q. Jia J. Tu Y.F. Jiang J.X. Gu W.Y. Zhang Y.Q. Cai Z. Sheng H.H. Yin H.F. Zhang Y. Zhu G.F. Wan M. Huang H.L. Qian Z. Wang S.Y. Ma W. Yao Z.J. Shen Y. Qiang B.Q. Xia Q.C. Guo X.K. Danchin A. Saint Girons I. Somerville R.L. Wen Y.M. Shi M.H. Chen Z. Xu J.G. Zhao G.P. Nature. 2003; 422: 888-893Crossref PubMed Scopus (484) Google Scholar). Pathogenic Leptospira species that include L. interrogans and L. borgpetersenii cause leptospirosis, a global zoonotic disease characterized by the infection of a wide spectrum of animals and by the potential for severe morbidity and mortality in humans (12Faine S. Leptospira and Leptospirosis. CRC Press, Inc., Boca Raton, FL1994Google Scholar). The molecular mechanisms of leptospirosis are poorly understood due to the lack of a transformation method for studying the pathogenic strains (13Zuerner R. Haake D. Adler B. Segers R. Saier M.H. Garcia-Lara J. The Spirochetes: Molecular and Cellular Biology. Horizon Scientific Press, Oxford2001: 137-145Google Scholar). A notable phenotype of fulminant leptospirosis is the hemorrhagic response which, given the critical role of the mammalian carboxylase in hemostasis, raised the question of whether the VKD carboxylase ortholog plays some role in the pathogenesis of this disease. We therefore expressed and analyzed the Leptospira ortholog as a first step toward understanding its function. Our results showed that the Leptospira ortholog is an active enzyme that catalyzes vitamin K epoxidation, but unlike all other known VKD carboxylase orthologs it did not show detectable carboxylation. The Leptospira enzyme was also distinctly different from the mammalian ortholog in showing significant amounts of epoxidation in the absence of Glu substrate. The acquisition of the VKD carboxylase in a pathogen and the altered properties of the acquired protein suggest that vitamin K epoxidation has been adapted for a novel biochemical purpose that may play a role in Leptospira pathology. Isolation and Expression of the L. borgpetersenii VKD Carboxylase Ortholog ORF—The VKD carboxylase ORF was isolated by PCR based on the genome sequence of the region from the L. borgpetersenii serovar hardjo strain JB197. L. borgpetersenii genomic DNA was used as template to amplify the ORF in two parts: a 5′-half using primers Lborg1S (CTGCAGCGATCGGTTCCGGTTATTATGCGA) and Lborg1AS (GGAGCATACTTCTGGATTTCAG) and two different 3′-halves that used primers Lborg2S (GCCACTTTGTTTTTCTCCCC) and either Lborg2AS (GGTACCCTATTCTTCGTCTCCGGAGAAAAC) or Lborg2NAS (TGCGGCCGCTTCTTCGTCTCCGGAGAAAAC). The Lborg2S+Lborg2AS oligonucleotides amplify the 3′-ORF and stop codon, whereas the Lborg2S+Lborg2NAS oligonucleotides replace the stop codon with nine base pairs that encode 3 Alas and a NotI site. The three PCR products were separately cloned into pCR2.1-TOPO (Invitrogen) and sequenced. The correct 5′-PstI-BglII product and 3′-BglII-Acc65 I product from the Lborg2S+Lborg2AS amplification were cloned into PstI-Acc65 I-digested pBacPAK8 (Clontech). The resulting plasmid, Lepto.borg-pBacPAK8, was digested with Acc65 I and BglII, and the large fragment was ligated with the BglII-NotI fragment from Lborg2S+Lborg2NAS and the annealed oligonucleotides NotFLAG (GGCCGCTGACTACAAAGACGATGACGACAAGTGAG) and Acc65FLAG (GTACCTCACTTGTCGTCATCGTCTTTGTAGTCAGC). The resulting plasmid, Lepto.borgFLAG-pBacPAK8, contains the L. borgpetersenii VKD carboxylase ortholog ORF with 3 Alas followed by the FLAG epitope tag (DYKDDDDK), which was confirmed by resequencing the entire ORF. Both plasmids (Lepto.borg-pBacPAK8 and Lepto.borgFLAG-pBacPAK8) were used to generate baculovirus, as before (14Berkner K.L. McNally B.A. Methods Enzymol. 1997; 282: 313-333Crossref PubMed Scopus (18) Google Scholar), and plaques were screened by a Western using anti-FLAG antibody or by activity assay. Preparative amounts of baculovirus were then generated by amplifying the virus in insect cells (15Rishavy M.A. Pudota B.N. Hallgren K.W. Qian W. Yakubenko A.V. Song J.H. Runge K.W. Berkner K.L. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 13732-13737Crossref PubMed Scopus (25) Google Scholar). Enzyme Assays—Microsomes (4 mg/ml) were solubilized with CHAPS (0.5% final concentration) in the presence of 5 μm factor X propeptide, followed by centrifugation at 105 × g for 1 h, all at 4 °C. The supernatants were either assayed directly or were first purified on anti-FLAG-agarose (Sigma). Supernatant (0.5-1 ml) was adsorbed to resin (100 μl) by overnight incubation at 4 °C, and the resin was then washed with 25 mm Tris, 0.25% CHAPS, 0.25% phosphatidyl choline, and 150 mm NaCl, pH 7.4. Enzyme was eluted by incubating the resin with FLAG peptide (100 μg/ml; Sigma) for 1 h at 20°C. As indicated under “Results,” in one experiment resin-bound protein was assayed, rather than eluted material, because the Leptospira ortholog was not expressed at very high levels and assaying the resin-bound material allowed more concentrated samples to be analyzed. Carboxylase activity was assayed in reactions containing final concentrations of 0.6 m ammonium sulfate, 0.06% CHAPS, 0.06% sodium cholate, 0.06% phosphatidyl choline, 1.1 mm [14CO2]NaHCO3, 3 mm dithiothreitol, 9 μm propeptide, 130 μm vitamin K hydroquinone, 45 mm BES, pH 6.6, and 2.5 mm substrate (FLEEL (Sigma), EEL (Bachem), or TxIX (Anaspec)). Reactions were quenched with trichloroacetic acid and then processed for scintillation counting as previously described (14Berkner K.L. McNally B.A. Methods Enzymol. 1997; 282: 313-333Crossref PubMed Scopus (18) Google Scholar). Epoxidase activity was assayed using the same reaction mixture except that the NaHCO3 was unlabeled. The epoxidase reactions were quenched by the addition of 2.5 volumes of 3:2 2-propanol:hexane. Samples were extracted and analyzed by high pressure liquid chromatography as before (16Pudota B.N. Miyagi M. Hallgren K.W. West K.A. Crabb J.W. Misono K.S. Berkner K.L. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 13033-13038Crossref PubMed Scopus (35) Google Scholar) except for the addition here of a standard (2 nmol K25, GL Synthesis) added after reaction quenching, which controlled for variation in vitamin K recovery during extraction. Vitamin K epoxide formation was quantitated either by direct integration of the peak using the high pressure liquid chromatography system or by scanning the chromatogram and creating TIFF files that were then analyzed by ImageQuant (Amersham Biosciences). Both methods were validated using a vitamin K epoxide standard curve. To determine the specific activity of the Leptospira ortholog, the amount of protein was quantitated using a fluorescence-based assay. Leptospira ortholog samples were gel electrophoresed along with a standard curve of human carboxylase of known concentration as well as a control FLAG-BAP fusion protein (Sigma). The gel was then processed in a Western using anti-FLAG antibody (0.4 μg/ml), doubly purified anti-rabbit alkaline phosphatase conjugate (Bio-Rad), and AttoPhos substrate (Promega, used as instructed) followed by quantitation using a StormImager. Leptospira Appears to Have Acquired the VKD Carboxylase from Metazoans by Horizontal Gene Transfer—Protein-protein BLAST searches using the human VKD carboxylase protein sequence as the query against the genome of the pathogen L. interrogans serovar Lai (11Ren S.X. Fu G. Jiang X.G. Zeng R. Miao Y.G. Xu H. Zhang Y.X. Xiong H. Lu G. Lu L.F. Jiang H.Q. Jia J. Tu Y.F. Jiang J.X. Gu W.Y. Zhang Y.Q. Cai Z. Sheng H.H. Yin H.F. Zhang Y. Zhu G.F. Wan M. Huang H.L. Qian Z. Wang S.Y. Ma W. Yao Z.J. Shen Y. Qiang B.Q. Xia Q.C. Guo X.K. Danchin A. Saint Girons I. Somerville R.L. Wen Y.M. Shi M.H. Chen Z. Xu J.G. Zhao G.P. Nature. 2003; 422: 888-893Crossref PubMed Scopus (484) Google Scholar) identified a predicted protein (GenBank™ accession number NP_713762.1) with a BLAST score of 140 and a probability of a match by random chance (the E value) of 10-34. Orthologs from two additional Leptospira pathogens were subsequently identified: the sequenced genome of L. interrogans serovar Copenhageni was shown to encode a protein (REFSEQ: accession NC_005823.1) identical to the L. interrogans serovar Lai ORF except for an N238K substitution (10Nascimento A.L. Ko A.I. Martins E.A. Monteiro-Vitorello C.B. Ho P.L. Haake D.A. Verjovski-Almeida S. Hartskeerl R.A. Marques M.V. Oliveira M.C. Menck C.F. Leite L.C. Carrer H. Coutinho L.L. Degrave W.M. Dellagostin O.A. El-Dorry H. Ferro E.S. Ferro M.I. Furlan L.R. Gamberini M. Giglioti E.A. Goes-Neto A. Goldman G.H. Goldman M.H. Harakava R. Jeronimo S.M. Junqueira-de-Azevedo I.L. Kimura E.T. Kuramae E.E. Lemos E.G. Lemos M.V. Marino C.L. Nunes L.R. de Oliveira R.C. Pereira G.G. Reis M.S. Schriefer A. Siqueira W.J. Sommer P. Tsai S.M. Simpson A.J. Ferro J.A. Camargo L.E. Kitajima J.P. Setubal J.C. Van Sluys M.A. J. Bacteriol. 2004; 186: 2164-2172Crossref PubMed Scopus (340) Google Scholar), and a genome sequencing project for the pathogen L. borgpetersenii (AY974602) revealed the presence of a protein with 82% sequence identity to the L. interrogans ORFs (supplemental Figs. S1 and S2). A reciprocal BLAST search using the L. interrogans serovar Lai ORF as the query against the non-redundant protein data base identified VKD carboxylases in fish (Opsanus tau), a marine snail (Conus textile), insect (Drosophila melanogaster), and in several mammals, with E values ranging from 10-26 to 10-22. Notably, the sequence similarities extended over most of the length of the proteins (Fig. 2). In addition, protein structural predictions reinforced the similarity between the metazoan and Leptospira VKD orthologs, as their sequences all predicted similar membrane topologies (supplemental Fig. S2) (5Bandyopadhyay P.K. Garrett J.E. Shetty R.P. Keate T. Walker C.S. Olivera B.M. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 1264-1269Crossref PubMed Scopus (92) Google Scholar, 6Czerwiec E. Begley G.S. Bronstein M. Stenflo J. Taylor K. Furie B.C. Furie B. Eur. J. Biochem. 2002; 269: 6162-6172Crossref PubMed Scopus (45) Google Scholar, 7Li T. Yang C.T. Jin D. Stafford D.W. J. Biol. Chem. 2000; 275: 18291-18296Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar, 8Walker C.S. Shetty R.P. Clark K.A. Kazuko S.G. Letsou A. Olivera B.M. Bandyopadhyay P.K. J. Biol. Chem. 2001; 276: 7769-7774Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar, 17Wu S.M. Cheung W.F. Frazier D. Stafford D.W. Science. 1991; 254: 1634-1636Crossref PubMed Scopus (171) Google Scholar). VKD substrates for the carboxylase were not detected in the L. interrogans genome as no significant matches were found (E values >0.06) to the human VKD proteins factor VII, factor IX, protein Z, protein C, protein S, matrix Gla protein, osteocalcin, PRGP1, PRGP2, TMG3, TMG4, and Gas6. The existence of the VKD carboxylase ortholog in Leptospira was quite surprising because previously VKD carboxylases were only known to be present in the animal kingdom (i.e. Fig. 3, metazoans). The BLAST search with the L. interrogans ORF as the query also revealed VKD carboxylase orthologs in Cytophaga hutchinsonii and in environmental sequences (i.e. sequences isolated from shotgun sequencing of random bacterial samples from the Sargasso sea) (18Venter J.C. Remington K. Heidelberg J.F. Halpern A.L. Rusch D. Eisen J.A. Wu D. Paulsen I. Nelson K.E. Nelson W. Fouts D.E. Levy S. Knap A.H. Lomas M.W. Nealson K. White O. Peterson J. Hoffman J. Parsons R. Baden-Tillson H. Pfannkoch C. Rogers Y.H. Smith H.O. Science. 2004; 304: 66-74Crossref PubMed Scopus (3222) Google Scholar). This occurrence in bacteria is low, as scores of bacterial genomes have now been sequenced and VKD carboxylase orthologs are not detected in these genomes. In addition, similar VKD carboxylase orthologs are not observed in fungi, plants, protozoa, or archea bacteria despite the presence of a large number of completely sequenced genomes from these kingdoms (Fig. 3). This restricted distribution and the high degree of homology between these bacterial and metazoan orthologs strongly suggest horizontal transfer of genetic information between species (19Syvanen M. Kado C.I. Horizontal Gene Transfer. Academic Press, San Diego, CA2002Google Scholar), with VKD carboxylase mRNA from a Leptospira-infected animal being incorporated into the bacterial genome. This interpretation is supported by the presence of several other sequences in the L. interrogans serovar Lai and Copenhageni genomes that are similar to mammalian genes, i.e. platelet-activating factor acetylhydrolase (NP_712325 and YP_001728), two von Willebrand factor type A domain proteins: batA (NP_714598 and YP_003432) and batB (NP_714599 and YP_003433) and paraoxonase 3 (NP_710580 and YP_000337) (10Nascimento A.L. Ko A.I. Martins E.A. Monteiro-Vitorello C.B. Ho P.L. Haake D.A. Verjovski-Almeida S. Hartskeerl R.A. Marques M.V. Oliveira M.C. Menck C.F. Leite L.C. Carrer H. Coutinho L.L. Degrave W.M. Dellagostin O.A. El-Dorry H. Ferro E.S. Ferro M.I. Furlan L.R. Gamberini M. Giglioti E.A. Goes-Neto A. Goldman G.H. Goldman M.H. Harakava R. Jeronimo S.M. Junqueira-de-Azevedo I.L. Kimura E.T. Kuramae E.E. Lemos E.G. Lemos M.V. Marino C.L. Nunes L.R. de Oliveira R.C. Pereira G.G. Reis M.S. Schriefer A. Siqueira W.J. Sommer P. Tsai S.M. Simpson A.J. Ferro J.A. Camargo L.E. Kitajima J.P. Setubal J.C. Van Sluys M.A. J. Bacteriol. 2004; 186: 2164-2172Crossref PubMed Scopus (340) Google Scholar, 11Ren S.X. Fu G. Jiang X.G. Zeng R. Miao Y.G. Xu H. Zhang Y.X. Xiong H. Lu G. Lu L.F. Jiang H.Q. Jia J. Tu Y.F. Jiang J.X. Gu W.Y. Zhang Y.Q. Cai Z. Sheng H.H. Yin H.F. Zhang Y. Zhu G.F. Wan M. Huang H.L. Qian Z. Wang S.Y. Ma W. Yao Z.J. Shen Y. Qiang B.Q. Xia Q.C. Guo X.K. Danchin A. Saint Girons I. Somerville R.L. Wen Y.M. Shi M.H. Chen Z. Xu J.G. Zhao G.P. Nature. 2003; 422: 888-893Crossref PubMed Scopus (484) Google Scholar). The evolution of these Leptospira proteins and their relationships to metazoan counterparts provides a unique opportunity to examine their structure and function. Therefore, the L. borgpetersenii VKD carboxylase ortholog was expressed and analyzed as a first step in the characterization of these proteins. The Leptospira VKD Carboxylase Ortholog Is a Membrane-bound Protein—The Leptospira VKD carboxylase ortholog was produced in SF21 cells because these cells do not express endogenous carboxylase activity but can synthesize active enzyme when cDNAs encoding carboxylases from several different species (mammals, Conus, and Drosophila) (6Czerwiec E. Begley G.S. Bronstein M. Stenflo J. Taylor K. Furie B.C. Furie B. Eur. J. Biochem. 2002; 269: 6162-6172Crossref PubMed Scopus (45) Google Scholar, 7Li T. Yang C.T. Jin D. Stafford D.W. J. Biol. Chem. 2000; 275: 18291-18296Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar, 20Roth D.A. Rehemtulla A. Kaufman R.J. Walsh C.T. Furie B. Furie B.C. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 8372-8376Crossref PubMed Scopus (35) Google Scholar) are exogenously introduced. Baculovirus containing the Leptospira ortholog with a C-terminal FLAG epitope was generated and used to infect SF21 cells, and the expression of this protein was monitored by Western analysis. Virtually all of the Leptospira ortholog was recovered in the microsomal fraction (Fig. 4A), which is the same result obtained with mammalian (bovine and human) VKD carboxylases and is consistent with the hydrophobic sequences predicted by the Leptospira gene (supplemental Fig. S2). The gene also predicted a potential N-glycosylation site that would not result in glycosylation in the Leptospira bacterium but could conceivably be glycosylated during insect cell expression. We therefore tested for endoglycosidase H sensitivity. Treatment of human carboxylase with endoglycosidase H resulted in a decrease in the size of the observed band (Fig. 4B), as expected. The Leptospira ortholog, however, was unaffected by endoglycosidase H treatment, indicating that N-glycosylation did not occur and therefore would not affect the function of the Leptospira ortholog expressed by insect cells. The Leptospira Ortholog Has Epoxidase Activity—In all known VKD carboxylases, the epoxidation of vitamin K hydroquinone provides the energy required for the carboxylation reaction, and so epoxidation is a prerequisite of carboxylation. We therefore tested whether the Leptospira ortholog could convert vitamin K hydroquinone to vitamin K epoxide. The results showed that the Leptospira ortholog, like the human VKD carboxylase ortholog, had epoxidase activity that was dose-dependent (Fig. 5). Activity was not observed in mock-infected cells or in cells infected with an irrelevant virus (containing factor IX), showing that activity was specific to the Leptospira or human orthologs. The specific activity of the Leptospira epoxidase was compared with that of the human enzyme by performing epoxidase assays in parallel with protein determination by a quantitative Western. This analysis showed that the Leptospira ortholog specific activity was lower (18%, TABLE ONE) but still comparable with that of the human carboxylase.TABLE ONEThe Leptospira VKD epoxidase specific activity is similar to that of the human ortholog Ortholog Specific activity pmol KO epoxide/pmol enzyme/h % Human 1171 100 Leptospira 215 18 Open table in a new tab The human and Leptospira orthologs were both tagged at the C terminus with a FLAG epitope, which we showed did not have any effect upon their specific activities. Thus, we previously showed that FLAG-tagged and untagged human carboxylases have the same specific activity (15Rishavy M.A. Pudota B.N. Hallgren K.W. Qian W. Yakubenko A.V. Song J.H. Runge K.W. Berkner K.L. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 13732-13737Crossref PubMed Scopus (25) Google Scholar) and in the current study performed similar analysis with an anti-C-terminal Leptospira ortholog antibody, which showed that the FLAG epitope did not change Leptospira activity (data not shown). Another condition that was tested for effect on Leptospira activity was pH value, because epoxidation is initiated by a catalytic base that requires deprotonation for reactivity (Fig. 1) and therefore is dependent upon pH values. Comparison of the activities of the Leptospira and human orthologs at several pH values showed that the response of activity to pH was similar for both enzymes (data not shown). Leptospira Vitamin K Epoxidation Does Not Result in Detectable Carboxylation—Human carboxylase and the Leptospira ortholog were assayed for carboxylase activity by measuring 14CO2 incorporation into peptide substrates, and epoxidase assays were carried out in parallel. Activity was measured using either solubilized microsomes or samples concentrated and purified on anti-FLAG antibody resin. When human carboxylase was assayed using mammalian-derived substrates (EEL, FLEEL), the amount of epoxidation observed was almost identical to that of carboxylation (i.e. giving an epoxidation:carboxylation ratio of 1.1:1.2, TABLE TWO). These data for human carboxylase were obtained with enzyme assayed in the presence of propeptide. However, the same ratio was observed when the human carboxylase was assayed in the absence of propeptide (data not shown), which is consistent with results previously reported with bovine carboxylase (21Sugiura I. Furie B. Walsh C.T. Furie B.C. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 9069-9074Crossref PubMed Scopus (31) Google Scholar) and which shows that the propeptide does not regulate the stoichiometry of the two half-reactions.TABLE TWOThe Leptospira VKD enzyme does not show detectable carboxylase activity Sample number Ortholog Substrate Epoxidase activity Carboxylase activity Activity ratio (epoxidation:carboxylation) pmol/h pmol/h units 1 Human EEL 4487 4250 1.1 2 Leptospira EEL 218 4 >55 3 Human FLEEL 12870 10456 1.2 4 Leptospira FLEEL 380 4 >95 5 Mock (−K) FLEEL ND 4 6 Human TxIX 1266 381 3.3 7 Leptospira TxIX 600 4 >150 Open table in a new tab In contrast to the human carboxylase, the Leptospira enzyme did not
Referência(s)