EVI1 Abrogates Interferon-α Response by Selectively Blocking PML Induction
2004; Elsevier BV; Volume: 280; Issue: 1 Linguagem: Inglês
10.1074/jbc.m410836200
ISSN1083-351X
AutoresSilvia Buonamici, Donglan Li, Fady M. Mikhail, Antonella Sassano, Leonidas C. Platanias, Oscar R. Colamonici, John Anastasi, Giuseppina Nucifora,
Tópico(s)Immune Cell Function and Interaction
ResumoEVI1 is an oncogene frequently associated with chronic and acute myeloid leukemia. In hematopoietic cells, EVI1 impairs several pathways including proliferation, differentiation, and apoptosis. Interferon-α (IFN-α) is a powerful cytokine that controls the immune response and limits the expansion of several tissues including bone marrow. These properties contribute to the effectiveness of IFN-α in the treatment of many neoplastic disorders especially chronic myeloid leukemia. We report here that in murine hematopoietic progenitors the expression of EVI1 completely abrogates the antiproliferative and apoptotic effects of IFN-α. EVI1 does not repress the JAK/STAT signaling pathway or the activation of many IFN-responsive genes. On the contrary, EVI1 prolongs the phosphorylation of STAT1 and the activation of an IFN-dependent reporter gene. However, EVI1 specifically represses the IFN-dependent induction of the tumor suppressor PML and blocks the apoptotic pathways activated by PML. We show that the position of the ISRE, which is located within the first exon of PML, is critical to block PML induction by IFN-α. The relocation of the ISRE to a position upstream of the transcription start site is sufficient to re-establish the response to IFN in the presence of EVI1. Our data suggest that stabilized STAT1 phosphorylation and prolonged binding of the STAT1 complex to the first exon could impair PML transcription and inhibit the activation of PML-dependent apoptotic pathways resulting in loss of IFN response. These results point to a novel mechanism utilized by an oncogene to escape normal cell response to growth-controlling cytokines. EVI1 is an oncogene frequently associated with chronic and acute myeloid leukemia. In hematopoietic cells, EVI1 impairs several pathways including proliferation, differentiation, and apoptosis. Interferon-α (IFN-α) is a powerful cytokine that controls the immune response and limits the expansion of several tissues including bone marrow. These properties contribute to the effectiveness of IFN-α in the treatment of many neoplastic disorders especially chronic myeloid leukemia. We report here that in murine hematopoietic progenitors the expression of EVI1 completely abrogates the antiproliferative and apoptotic effects of IFN-α. EVI1 does not repress the JAK/STAT signaling pathway or the activation of many IFN-responsive genes. On the contrary, EVI1 prolongs the phosphorylation of STAT1 and the activation of an IFN-dependent reporter gene. However, EVI1 specifically represses the IFN-dependent induction of the tumor suppressor PML and blocks the apoptotic pathways activated by PML. We show that the position of the ISRE, which is located within the first exon of PML, is critical to block PML induction by IFN-α. The relocation of the ISRE to a position upstream of the transcription start site is sufficient to re-establish the response to IFN in the presence of EVI1. Our data suggest that stabilized STAT1 phosphorylation and prolonged binding of the STAT1 complex to the first exon could impair PML transcription and inhibit the activation of PML-dependent apoptotic pathways resulting in loss of IFN response. These results point to a novel mechanism utilized by an oncogene to escape normal cell response to growth-controlling cytokines. EVI1 was identified as the integration site of an activating ecotropic retrovirus leading to acute myeloid leukemia in susceptible strains of mice (1Morishita K. Parker D.S. Mucenski M.L. Jenkins N.A. Copeland N.G. Ihle J.N. Cell. 1988; 54: 831-840Abstract Full Text PDF PubMed Scopus (353) Google Scholar). EVI1 has been associated with human chronic myeloid leukemia, myelodysplastic syndrome, acute myeloid leukemia, and with aggressive solid tumors including lung and endometrial cancers (2Melo J.V. Leukemia. 1996; 10: 751-756PubMed Google Scholar, 3Yokoi S. Yasui K. Iizasa T. Imoto I. Fujisawa T. Inazawa J. Clin. Cancer Res. 2003; 9: 4705-4713PubMed Google Scholar, 4Buonamici S. Chakraborty S. Senyuk V. Nucifora G. Blood Cells Mol. Dis. 2003; 31: 206-212Crossref PubMed Scopus (65) Google Scholar, 5Massion P.P. Kuo W.L. Stokoe D. Olshen A.B. Treseler P.A. Chin K. Chen C. Polikoff D. Jain A.N. Pinkel D. Albertson D.G. Jablons D.M. Gray J.W. Cancer Res. 2002; 62: 3636-3640PubMed Google Scholar, 6Bohlander S.K. Cytogenet. Cell Genet. 2000; 91: 52-56Crossref PubMed Scopus (35) Google Scholar, 7Morishita K. Parganas E. Douglass E.C. Ihle J.N. Oncogene. 1990; 5: 963-971PubMed Google Scholar). Recently the causative association between EVI1 and myelodysplastic syndrome was confirmed in a mouse model (8Buonamici S. Li D. Chi Y. Zhao R. Wang X. Brace L. Ni H. Saunthararajah Y. Nucifora G. J. Clin. Invest. 2004; 114: 713-719Crossref PubMed Scopus (166) Google Scholar). EVI1 exists also in a longer form called MDS1/EVI1 that includes a methyltransferase-like SET domain at the N terminus. This form is independently regulated and transcribed from an upstream promoter and has not been associated with neoplastic transformation (9Nucifora G. Begy C.R. Kobayashi H. Roulston D. Claxton D. Pedersen-Bjergaard J. Parganas E. Ihle J.N. Rowley J.D. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 4004-4008Crossref PubMed Scopus (253) Google Scholar, 10Fears S. Mathieu C. Zeleznik-Le N. Huang S. Rowley J.D. Nucifora G. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 1642-1647Crossref PubMed Scopus (187) Google Scholar, 11Barjesteh van Waalwijk van Doorn-Khosrovani S. Erpelinck C. van Putten W.L. Valk P.J. van der Poel-van de Luytgaarde S. Hack R. Slater R. Smit E.M. Beverloo H.B. Verhoef G. Verdonck L.F. Ossenkoppele G.J. Sonneveld P. de Greef G.E. Lowenberg B. Delwel R. Blood. 2003; 101: 837-845Crossref PubMed Scopus (290) Google Scholar). MDS1/EVI1 belongs to the PR-domain family of proteins, which includes 16 members characterized by zinc finger domains and by a SET domain (12Jiang G.L. Huang S. Histol. Histopathol. 2000; 15: 109-117PubMed Google Scholar, 13Schneider R. Bannister A.J. Kouzarides T. Trends Biochem. Sci. 2002; 27: 396-402Abstract Full Text Full Text PDF PubMed Scopus (256) Google Scholar). Several members of this family also exist in the shorter form that lacks the SET domain like EVI1 and which has been associated with solid and hematopoietic cancers (14Nishikata I. Sasaki H. Iga M. Tateno Y. Imayoshi S. Asou N. Nakamura T. Morishita K. Blood. 2003; 102: 3323-3332Crossref PubMed Scopus (106) Google Scholar, 15Liu L. Shao G. Steele-Perkins G. Huang S. J. Biol. Chem. 1997; 272: 2984-2991Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar, 16Buyse I.M. Takahashi E.I. Huang S. Genomics. 1996; 34: 119-121Crossref PubMed Scopus (44) Google Scholar, 17Mock B.A. Liu L. LePaslier D. Huang S. Genomics. 1996; 37: 24-28Crossref PubMed Scopus (43) Google Scholar, 18Barjesteh van Waalwijk van Doorn-Khosrovani S. Erpelinck C. Lowenberg B. Delwel R. Exp. Hematol. 2003; 31: 1066-1072Abstract Full Text Full Text PDF PubMed Scopus (16) Google Scholar). EVI1 is a nuclear transcription repressor with 2 domains of 7 and 3 zinc finger motifs that bind to DNA in vitro (4Buonamici S. Chakraborty S. Senyuk V. Nucifora G. Blood Cells Mol. Dis. 2003; 31: 206-212Crossref PubMed Scopus (65) Google Scholar, 19Sitailo S. Sood R. Barton K. Nucifora G. Leukemia. 1999; 13: 1639-1645Crossref PubMed Scopus (63) Google Scholar, 20Delwel R. Funabiki T. Kreider B.L. Morishita K. Ihle J.N. Mol. Cell. Biol. 1993; 13: 4291-4300Crossref PubMed Scopus (122) Google Scholar, 21Funabiki T. Kreider B.L. Ihle J.N. Oncogene. 1994; 9: 1575-1581PubMed Google Scholar). EVI1 interacts with co-repressors and co-activators of which are also reversibly acetylated (22Chakraborty S. Senyuk V. Sitailo S. Chi Y. Nucifora G. J. Biol. Chem. 2001; 276: 44936-44943Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). A striking feature of EVI1 is its ability to strongly accelerate cell cycle and proliferation by interacting with BRG1, a member of the SWI/SNF chromatin-remodeling complex (23Chi Y. Senyuk V. Chakraborty S. Nucifora G. J. Biol. Chem. 2003; 278: 49806-49811Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar). The expression of EVI1 in hematopoietic cells abrogates the growth-inhibitory effect of transforming growth-β, a regulator of hematopoietic cell expansion, by interaction with SMAD3 and the inactivation of SMAD signaling (24Sood R. Talwar-Trikha A. Chakrabarti S.R. Nucifora G. Leukemia. 1999; 13: 348-357Crossref PubMed Scopus (106) Google Scholar, 25Kurokawa M. Mitani K. Irie K. Matsuyama T. Takahashi T. Chiba S. Yazaki Y. Matsumoto K. Hirai H. Nature. 1998; 394: 92-96Crossref PubMed Scopus (301) Google Scholar). IFN-α 1The abbreviations used are: IFN-α, interferon-α; STAT, signal transducers and activators of transcription; ISG, interferon-stimulated genes; BM, bone marrow; HA, hemagglutinin; WT, wild type; RT, reverse transcriptase; RQ, reverse quantitative; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; EMSA, electrophoretic mobility shift assay; ELISA, enzyme-linked immunosorbent assay; IRF, interferon regulatory factor. 1The abbreviations used are: IFN-α, interferon-α; STAT, signal transducers and activators of transcription; ISG, interferon-stimulated genes; BM, bone marrow; HA, hemagglutinin; WT, wild type; RT, reverse transcriptase; RQ, reverse quantitative; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; EMSA, electrophoretic mobility shift assay; ELISA, enzyme-linked immunosorbent assay; IRF, interferon regulatory factor. belongs to a cytokine family that exhibits antiviral properties, immunomodulating effects, and antiproliferative activity on normal and transformed cells (26Pestka S. Langer J.A. Zoon K.C. Samuel C.E. Annu. Rev. Biochem. 1987; 56: 727-777Crossref PubMed Scopus (1588) Google Scholar). These diverse properties are mediated through binding to a high affinity cell surface receptor that in turn activates a variety of intracellular signals and modulates gene expression and apoptosis (27Thyrell L. Erickson S. Zhivotovsky B. Pokrovskaja K. Sangfelt O. Castro J. Einhorn S. Grander D. Oncogene. 2002; 21: 1251-1262Crossref PubMed Scopus (175) Google Scholar, 28Stark G.R. Kerr I.M. Williams B.R. Silverman R.H. Schreiber R.D. Annu. Rev. Biochem. 1998; 67: 227-264Crossref PubMed Scopus (3343) Google Scholar, 29Darnell Jr., J.E. Science. 1997; 277: 1630-1635Crossref PubMed Scopus (3330) Google Scholar, 30Chawla-Sarkar M. Lindner D.J. Liu Y.F. Williams B.R. Sen G.C. Silverman R.H. Borden E.C. Apoptosis. 2003; 8: 237-249Crossref PubMed Scopus (656) Google Scholar). In a very simplified view, IFN-α binds to the Type I IFN membrane receptor inducing its dimerization and the activation of two Janus family tyrosine kinases, TYK-2 and JAK-1, which leads to activation and homo- or heterodimerization of the signal transducers and activators of transcription (STAT) proteins (most frequently STAT1 and STAT2 for the IFN-α pathway). The activated STAT1-STAT2 dimer interacts with p48 to form the mature ISGF3 complex that translocates to the nucleus and activates transcription of IFN-stimulated genes (ISGs) by binding to the IFN-α-stimulated response elements (ISRE) in their promoter (27Thyrell L. Erickson S. Zhivotovsky B. Pokrovskaja K. Sangfelt O. Castro J. Einhorn S. Grander D. Oncogene. 2002; 21: 1251-1262Crossref PubMed Scopus (175) Google Scholar, 28Stark G.R. Kerr I.M. Williams B.R. Silverman R.H. Schreiber R.D. Annu. Rev. Biochem. 1998; 67: 227-264Crossref PubMed Scopus (3343) Google Scholar, 29Darnell Jr., J.E. Science. 1997; 277: 1630-1635Crossref PubMed Scopus (3330) Google Scholar). The activation of the IFN-α pathway leads to the expression of literally hundreds of ISGs, many of which are activated in a tissue-specific fashion. The tumor suppressor PML and several components of the PML bodies, including SP100, are up-regulated by IFN-α in almost all cell types (31Borden K.L. Mol. Cell. Biol. 2002; 22: 5259-5269Crossref PubMed Scopus (261) Google Scholar, 32Lavau C. Marchio A. Fagioli M. Jansen J. Falini B. Lebon P. Grosveld F. Pandolfi P.P. Pelicci P.G. Dejean A. Oncogene. 1995; 11: 871-876PubMed Google Scholar, 33Grotzinger T. Sternsdorf T. Jensen K. Will H. Eur. J. Biochem. 1996; 238: 554-560Crossref PubMed Scopus (108) Google Scholar). This up-regulation leads to a noticeable increase in the number of the PML nuclear bodies, which have been implicated in the control of several apoptotic pathways (34Wang Z.G. Ruggero D. Ronchetti S. Zhong S. Gaboli M. Rivi R. Pandolfi P.P. Nat. Genet. 1998; 20: 266-272Crossref PubMed Scopus (97) Google Scholar, 35Quignon F. De Bels F. Koken M. Feunteun J. Ameisen J.C. de The H. Nat. Genet. 1998; 20: 259-265Crossref PubMed Scopus (340) Google Scholar). The direct role of PML in growth arrest and apoptosis induced by IFN-α was later confirmed by showing that cells with biallelic inactivation of Pml are unresponsive to IFN-α (34Wang Z.G. Ruggero D. Ronchetti S. Zhong S. Gaboli M. Rivi R. Pandolfi P.P. Nat. Genet. 1998; 20: 266-272Crossref PubMed Scopus (97) Google Scholar). In general, the gene-activating effects of IFN-α last about 5 h (29Darnell Jr., J.E. Science. 1997; 277: 1630-1635Crossref PubMed Scopus (3330) Google Scholar, 36Bluyssen H.A. Levy D.E. J. Biol. Chem. 1997; 272: 4600-4605Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar, 37Fu X.Y. Kessler D.S. Veals S.A. Levy D.E. Darnell Jr., J.E. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 8555-8559Crossref PubMed Scopus (332) Google Scholar, 38Veals S.A. Santa Maria T. Levy D.E. Mol. Cell. Biol. 1993; 13: 196-206Crossref PubMed Google Scholar). The mechanisms that regulate the inactivation of the ISGF3 complex are less clear. Several phosphatases have been implicated in this process but as yet no single enzyme has been clearly demonstrated to be universally involved in part because many of these enzymes seem to be cell type-specific (39Starr R. Hilton D.J. Bioessays. 1999; 21: 47-52Crossref PubMed Scopus (229) Google Scholar, 40Shuai K. Liu B. Nat. Rev. Immunol. 2003; 3: 900-911Crossref PubMed Scopus (1025) Google Scholar). Here we have examined the role of EVI1 in the IFN-α response and found that EVI1 blocks the inhibitory effect of IFN-α in normal murine bone marrow (BM) cells and cell lines. EVI1 does not affect the signaling pathway of IFN-α or the assembly of the activated ISGF3 complex, which efficiently binds to the DNA in cells that express EVI1. The expression of many ISGs we tested is not altered by EVI1 and we find, rather surprisingly, that in the presence of EVI1 the phosphorylation of STAT1 and the consequent activation of an IFN-responsive reporter gene are actually and significantly prolonged. However, we also find that among all the IFN-responsive genes we tested, only Pml is not induced above basal level as expected when EVI1 is expressed and, as a consequence, we find that Pml-depending apoptotic pathways are not activated. A difference between the PML promoter and those of other IFN-responsive genes is the position of the ISRE, which in PML occurs uniquely within the first exon (33Grotzinger T. Sternsdorf T. Jensen K. Will H. Eur. J. Biochem. 1996; 238: 554-560Crossref PubMed Scopus (108) Google Scholar). Mutation analyses of the PML promoter and that of an IFN-responsive gene unaffected by EVI1 confirm that the position of the ISRE is critical to the abrogation of the IFN response by EVI1. We conclude that EVI1 inhibits the IFN response by selectively repressing proapoptotic genes that, like PML, contain the ISRE in their transcribed sequence. Our data point at a novel mechanism that is exploited by oncogenes to escape cytokine-dependent control of cell proliferation. DNA Constructs—The plasmid FLAG-EVI1 used in reporter gene assays has been previously described (22Chakraborty S. Senyuk V. Sitailo S. Chi Y. Nucifora G. J. Biol. Chem. 2001; 276: 44936-44943Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). HA-EVI1 was cloned in the EcoRI and BamHI restriction site of the MSCV vector (Clontech, San Jose, CA). The human WT ISG15 promoter from nucleotide -121 to +21 was amplified by genomic PCR and cloned in the HindIII and XhoI restriction sites of the promoterless luciferase reporter pGL3-basic vector (Promega, Madison, WI). The mutant ISG15 promoter ISRE was constructed by PCR of genomic DNA with a 5′ primer that starts at nucleotide -86 of the normal promoter and a 3′ primer that anneals to nucleotide +21 and contains an extension identical to the region -121 to -86 that spans the ISRE of the WT ISG15 promoter. The sequence of the 3′ extension is -121CATGCCTCGGGAAAGGGAAACCGAAACTGAAGCCAA-86, where the ISG15 ISRE consensus site is indicated in bold. Therefore this mutant promoter is identical to the WT promoter but the ISRE and flanking nucleotides have been repositioned from nucleotides -121 to -86 to nucleotides +21 to +56. After cloning, the WT and mutant ISG15 promoters were sequenced. The human WT PML promoter was constructed with the same strategy using genomic PCR from nucleotide -157 to nucleotide +58. The fragment was cloned in the HindIII and XhoI restriction sites of pGL3-basic vector (Promega, Madison, WI). PML-ISRE mutant promoter was constructed by PCR with a 5′ primer containing the extension +31ATCTAAACCGAGAATCGAAACTAAGCTG+58 in which the PML ISRE consensus site is indicated in bold. Both plasmids were verified by DNA sequencing. Cell Culture and Murine BM Progenitors Culture—The maintenance, transfection, and culture of the retroviral producer cell line Phoenix (ATCC) have been reported (22Chakraborty S. Senyuk V. Sitailo S. Chi Y. Nucifora G. J. Biol. Chem. 2001; 276: 44936-44943Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar, 41Senyuk V. Chakraborty S. Mikhail F.M. Zhao R. Chi Y. Nucifora G. Oncogene. 2002; 21: 3232-3240Crossref PubMed Scopus (54) Google Scholar). The infection, selection, culture, and differentiation of murine BM progenitors infected with the empty MSCV retrovirus or MSCV-HA-EVI1 were carried out as described (41Senyuk V. Chakraborty S. Mikhail F.M. Zhao R. Chi Y. Nucifora G. Oncogene. 2002; 21: 3232-3240Crossref PubMed Scopus (54) Google Scholar). EVI1-expressing SiHa stable lines were generated by calcium phosphate transfection with either the pCMV vector (vector-SiHa) or pCMV-Flag-EVI1 (EVI1-SiHa) and selection with neomycin. For reporter gene assays, cell lines were transfected with the appropriate reporter gene and either the vector pCMV or pCMV-Flag-EVI1 and were maintained in Dulbecco's modified minimum essential medium supplemented with 10% newborn calf serum (Invitrogen, Carlsbad, CA). RNA Isolation and cDNA Preparation—Total cellular RNA was extracted as described (42Buonamici S. Ottaviani E. Testoni N. Montefusco V. Visani G. Bonifazi F. Amabile M. Terragna C. Ruggeri D. Piccaluga P.P. Isidori A. Malagola M. Baccarani M. Tura S. Martinelli G. Blood. 2002; 99: 443-449Crossref PubMed Scopus (125) Google Scholar). cDNA was prepared according to the First Strand cDNA Synthesis Kit protocol (MBI Fermentas, Hanover, MD). Reverse Transcriptase (RT)-PCR and Reverse Quantitative (RQ)-PCR—RT-PCR for the evaluation of the IFN response genes was performed with the RT-PCR Profiling Kit (SuperArray Bioscience Corp., Frederick, MD) following the instructions of the manufacturer reported in the Human Interferon Response MultiGene-12™ manual. For amplification of ISG15, ISG54, PML, and IRF1 we used 2 μl of reverse transcription reaction for PCR with the following primers: ISG15 (forward, ggctgggagctgacggtgaag, reverse, GCTCCGCCCGCCAGGCTCTGT), ISG54 (forward, TGCCGAACAGCTGAGAATTG, reverse, ATTCCAGGGCTGCCTCGTTTT), IRF1 (forward, GGACATCAACAAGGATGCC, reverse, TCTTGGTGAGAGGTGGAAGC), and PML (forward, GCGCACCGATGGCTTCGACGA, reverse, CGGGCAGGTCAACGTCAAT). RQ-PCR was performed in a 25-μl reaction containing 5 μl of diluted cDNA, 12.5 μl of the Platinum Quantitative PCR SuperMix-UDG (Invitrogen, Carlsbad, CA), 300 nm forward and reverse primers, and 150 nm TaqMan probe (42Buonamici S. Ottaviani E. Testoni N. Montefusco V. Visani G. Bonifazi F. Amabile M. Terragna C. Ruggeri D. Piccaluga P.P. Isidori A. Malagola M. Baccarani M. Tura S. Martinelli G. Blood. 2002; 99: 443-449Crossref PubMed Scopus (125) Google Scholar). The primers and probes for murine GAPDH were purchased (Applied Biosystem, Foster City, CA). The primers and probe used for murine Pml were: forward, AACCCTGCGCTGACTGACAT, and reverse, GTGCCTAGTTCCTCATGCCACT; the probe was CAACCACAGCCATCTCCATTGCGA. The probe was labeled by a 5′ FAM reporter and a 3′ TAMRA quencher. The primers and probe were designed using Primer Express software (Applied Biosystem, Foster City, CA). RQ-PCR amplification was performed on the iCycler iQ detection system (Bio-Rad), and the data were collected and analyzed using iCycler iQ version 3.1 software. Apoptosis Gene Expression Profiling System—The human cDNA expression array GEArray™ Q Apoptosis (SuperArray Bioscience Corp., Frederick, MD) was used for the evaluation of 96 genes with known apoptotic function. The experiment was performed according to the manufacturer's protocols. Western Blot and Northern Blot Analyses—Cell lysate of mouse hematopoietic progenitors infected either with MSCV empty vector or MSCV-HA-EVI1 were quantified and Western blot analyses were performed as described (43Li Y. Sassano A. Majchrzak B. Deb D.K. Levy D.E. Gaestel M. Nebreda A.R. Fish E.N. Platanias L.C. J. Biol. Chem. 2004; 279: 970-979Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar). Ten μg of total RNA isolated from vector- or EVI1-SiHa cells was used to perform the Northern blot assay as reported (19Sitailo S. Sood R. Barton K. Nucifora G. Leukemia. 1999; 13: 1639-1645Crossref PubMed Scopus (63) Google Scholar). Electrophoretic Mobility Shift Assays (EMSA)—Fifteen μg of nuclear extract of vector- or EVI1-SiHa cells were incubated at room temperature for 30 min with 32P-labeled double-stranded oligonucleotide probe containing the ISG15 or PML ISRE-binding sites. The samples were separated by electrophoresis on a 0.5 m Tris-borate-EDTA nondenaturing 4% polyacrylamide gel at 140 V for 2 h and autoradiographed overnight as described (33Grotzinger T. Sternsdorf T. Jensen K. Will H. Eur. J. Biochem. 1996; 238: 554-560Crossref PubMed Scopus (108) Google Scholar). Reporter Gene Studies—The reporter gene assays were performed as reported (41Senyuk V. Chakraborty S. Mikhail F.M. Zhao R. Chi Y. Nucifora G. Oncogene. 2002; 21: 3232-3240Crossref PubMed Scopus (54) Google Scholar). Immunofluorescence—The vector- or EVI1-hematopoietic BM cells were washed three times with phosphate-buffered saline and fixed in 4% paraformaldehyde in phosphate-buffered saline for 20 min. The cell membrane was permeabilized by treatment with 50% methanol and 50% acetone at -20 °C for 7 min. The cells were washed with phosphate-buffered saline, and nonspecific antibody binding was blocked with 5% normal bovine serum (Sigma). The cells were treated with goat polyclonal anti-PML antibody (Santa Cruz, Santa Cruz, CA) at a dilution 1:1000 for 1 h. After washing with phosphate-buffered saline, the cells were stained with donkey anti-goat Alexa Fluor® 594 (Molecular Probes, Eugene, OR) at a dilution 1:5000 for 1 h. The cells were washed, stained with 4,6-diamidino-2-phenylindole, and treated with a prolonged anti-fading medium (Molecular Probes). The proteins were visualized with immunofluorescence microscopy (Zeiss Inc., Thornwood, NY). ELISA—The ELISA to evaluate the STAT1 phosphorylation was performed according to the manufacturer's protocol TransAM (Active Motif, Carlsbad, CA). EVI1 Abrogates IFN-α Growth Suppression in Normal Murine BM Lineage-negative Cells—To determine whether the expression of EVI1 affects the response of primary cells to IFN-α, we used normal murine BM cells because they are highly sensitive to IFN-α and undergo growth arrest and apoptosis when cultured with this cytokine. After isolation of the BM from healthy 5-week-old mice, lineage-negative progenitors were selected and infected with recombinant retroviruses expressing EVI1 or with the empty vector by spinoculation as we described (41Senyuk V. Chakraborty S. Mikhail F.M. Zhao R. Chi Y. Nucifora G. Oncogene. 2002; 21: 3232-3240Crossref PubMed Scopus (54) Google Scholar). To eliminate non-infected cells, 150,000 cells were plated in methylcellulose-based medium and cultured with G418 (41Senyuk V. Chakraborty S. Mikhail F.M. Zhao R. Chi Y. Nucifora G. Oncogene. 2002; 21: 3232-3240Crossref PubMed Scopus (54) Google Scholar). After 7 days of culture, several colonies were clearly visible in each plate. The colonies were isolated from the methylcellulose, disaggregated, and 15,000 cells were plated in duplicate in the absence or presence of IFN-α. EVI1 is a protein with an apparent mass of about 145 kDa. The diagram of EVI1 and the expression of the protein in the BM cells are shown in Fig. 1, A and B. In the absence of IFN-α, the BM cells proliferated and produced colonies. As we also reported earlier (8Buonamici S. Li D. Chi Y. Zhao R. Wang X. Brace L. Ni H. Saunthararajah Y. Nucifora G. J. Clin. Invest. 2004; 114: 713-719Crossref PubMed Scopus (166) Google Scholar), EVI1-positive BM progenitors have a much higher plating efficiency and generate about 2 times more colonies than the control progenitor cells (Table I). The most striking difference between vector and EVI1 cells was observed when the BM cells were cultured with IFN-α. As expected, the vector BM cells formed very small and sparse colonies when they were cultured with IFN-α and the cells did not survive after 7 days of culture. In contrast, EVI1-positive cells were completely unresponsive to IFN-α and the number of the colonies was not statistically different in the presence or absence of the cytokine (Table I).Fig. 1EVI1 does not prevent ISGF3 activation and DNA binding in response to IFN-α. A, diagram of EVI1. The 2 zinc finger (Zn) domains are indicated by gray lines. B, expression of EVI1 in BM cells. Lane 1, vector-infected BM cells. Lane 2, EVI1-infected BM cells. The asterisks indicate nonspecific hybridization bands. C, EVI1 does not inhibit the JAK/STAT1 pathway in response to IFN-α. Normal BM mouse progenitors infected either with empty vector or the EVI1-expressing retrovirus were incubated in the presence or absence of IFN-α (10,000 units/ml) for 25 min. Total cell lysates were analyzed by SDS-PAGE and analyzed with an antibody specific for the phosphorylated tyrosine 701 of STAT1 (upper panel). The blots were stripped and re-probed with an anti-STAT1 antibody to control the protein loading (lower panel). D, the DNA binding activity of ISGF3 in EVI1-positive cells is evaluated by EMSA. The binding assays were performed as described under "Experimental Procedures" with nuclear extracts of vector-SiHa (lanes 1 and 2) or EVI1-SiHa (lanes 3 and 4) cells in the presence (lanes 2 and 4) or absence of IFN-α (5,000 units/ml) (lanes 1 and 3) for 30 min. An ISGF3-DNA complex band (indicated by the arrow, lanes 2 and 4) is observed in cells treated with IFN-α. Free probe is shown in lane 5. E, Western blot analyses of vector- and EVI1-SiHa cells confirmed the expression of EVI1 (upper panel) and STAT1 (lower panel) in the cells.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Table INumber of colonies after 7 days of cultureNumber of coloniesVector cellsEVI1 cellsIFN-α-+-+Experiment 115020376380Experiment 214318365367Experiment 315713386390 Open table in a new tab EVI1 Does Not Affect the JAK/STAT Pathway of the DNA Binding of the ISGF3 Complex—Our studies indicate that EVI1 expression in mouse BM cells abrogates the antiproliferative and pro-apoptotic effects of IFN-α. Therefore, we determined whether this effect is because of down-regulation of the IFN-activated JAK/STAT pathway. The phosphorylation of STAT1 on tyrosine 701 is a critical early step required for interaction with STAT2 and translocation to the nucleus (26Pestka S. Langer J.A. Zoon K.C. Samuel C.E. Annu. Rev. Biochem. 1987; 56: 727-777Crossref PubMed Scopus (1588) Google Scholar, 27Thyrell L. Erickson S. Zhivotovsky B. Pokrovskaja K. Sangfelt O. Castro J. Einhorn S. Grander D. Oncogene. 2002; 21: 1251-1262Crossref PubMed Scopus (175) Google Scholar, 28Stark G.R. Kerr I.M. Williams B.R. Silverman R.H. Schreiber R.D. Annu. Rev. Biochem. 1998; 67: 227-264Crossref PubMed Scopus (3343) Google Scholar, 29Darnell Jr., J.E. Science. 1997; 277: 1630-1635Crossref PubMed Scopus (3330) Google Scholar). To determine whether tyrosine 701 phosphorylation is affected in normal mouse BM cells expressing EVI1, mouse progenitor cells infected either with empty retroviral vector or EVI1 retrovirus were treated with IFN-α. Total cell lysates were analyzed by SDS-PAGE and immunoblotted with an antibody that recognizes STAT1 phosphorylation on tyrosine 701. Tyrosine phosphorylation of STAT1 was inducible in the murine progenitors independently of whether EVI1 was expressed (Fig. 1C). To determine whether EVI1 affects the DNA binding of ISGF3 to the ISRE consensus we carried out EMSA with a DNA probe corresponding to the ISRE sequence of ISG15 (33Grotzinger T. Sternsdorf T. Jensen K. Will H. Eur. J. Biochem. 1996; 238: 554-560Crossref PubMed Scopus (108) Google Scholar) using the nuclear extract of human SiHa cells stably transfected either with empty retrovirus (vector-SiHa) or EVI1 retrovirus (EVI1-SiHa). We chose the ISRE of the ISG15 promoter because this sequence is routinely used as probe for this type of assay (33Grotzinger T. Sternsdorf T. Jensen K. Will H. Eur. J. Biochem. 1996; 238: 554-560Crossref PubMed Scopus (108) Go
Referência(s)